bl21 de3 star  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 75

    Structured Review

    Millipore bl21 de3 star
    Bl21 De3 Star, supplied by Millipore, used in various techniques. Bioz Stars score: 75/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 star/product/Millipore
    Average 75 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 star - by Bioz Stars, 2020-03
    75/100 stars

    Related Products / Commonly Used Together

    expression plasmids
    competent escherichia coli

    Images

    Related Articles

    Clone Assay:

    Article Title: Prolonging hypothermic storage (4 C) of bovine embryos with fish antifreeze protein
    Article Snippet: They were digested with Nde I/Bam HI and Bam HI/Xho I, respectively, and then introduced into the corresponding cloning sites of a pET20b vector (Merck Millipore, Darmstadt, Germany). .. Second, the host strain was changed to E.coli BL21 Star (DE3, Novagen, Madison, WI, USA), which carries a mutated rne131 for increasing mRNA stability.

    Article Title: Different motilities of microtubules driven by kinesin-1 and kinesin-14 motors patterned on nanopillars
    Article Snippet: The kinesin-14 was constructed from Drosophila melanogaster (amino acids 195 to 700) and cloned into the pBirAcm (Avidity) plasmid containing an N-terminal histidine tag and AviTag. .. The construct was expressed in BL21 (DE3) Star (Novagen) and purified by Ni-NTA affinity as previously described ( ).

    Centrifugation:

    Article Title: Community Rates of IgG4 Antibodies to Ascaris Haemoglobin Reflect Changes in Community Egg Loads Following Mass Drug Administration
    Article Snippet: Prokaryotic expression and purification of rAsHb The AsHb-containing vector construct was transformed into BL21 Star (DE3) One Shot cells and cells were grown in Luria Broth (Miller) (Sigma, St. Louis, MO, USA) containing 50μg/ml carbenicillin (Sigma). .. After 4h of incubation at 37°C under vigorous agitation (250 rpm), E . coli cells were pelleted by centrifugation and suspended in 1:25 of the initial culture volume of ice-cold RIPA lysis and extraction buffer (G Biosciences, St. Louis, MO, USA), incubated on shaking device at room temperature (RT) for 30 min and then centrifuged for 10 min at 4.500 g. The pellet was suspended again in RIPA lysis and extraction buffer and the previous incubation and centrifugation step was repeated twice more.

    Article Title: Prolonging hypothermic storage (4 C) of bovine embryos with fish antifreeze protein
    Article Snippet: Second, the host strain was changed to E.coli BL21 Star (DE3, Novagen, Madison, WI, USA), which carries a mutated rne131 for increasing mRNA stability. .. Cell culture was then carried out in a 1-l BMJ–01PI fermenter (ABLE & Biott, Tokyo, Japan) at 25 C and agitated at 60 g for 24 h. The overnight culture was harvested by centrifugation at 4,000 g for 15 min.

    Binding Assay:

    Article Title: Prolonging hypothermic storage (4 C) of bovine embryos with fish antifreeze protein
    Article Snippet: First, we constructed two genes for expressing nfeAFP11 comprising a ribosomal binding site upstream by amplifying the following two DNA fragments: GCGGATCCGGCACCCTCAGAACTACTAAGC (Bam HI site underlined) and CGGGATCCAATAATTTTGTTTAACTTTAAG (Bam HI site underlined). .. Second, the host strain was changed to E.coli BL21 Star (DE3, Novagen, Madison, WI, USA), which carries a mutated rne131 for increasing mRNA stability.

    Chromatography:

    Article Title: Different motilities of microtubules driven by kinesin-1 and kinesin-14 motors patterned on nanopillars
    Article Snippet: The construct was expressed in BL21 (DE3) Star (Novagen) and purified by Ni-NTA affinity as previously described ( ). .. Phosphocellulose (PC) tubulin was purified from porcine brains after 2 cycles of assembly-disassembly and PC chromatography ( ) and stored in liquid nitrogen.

    Labeling:

    Article Title: Different motilities of microtubules driven by kinesin-1 and kinesin-14 motors patterned on nanopillars
    Article Snippet: The construct was expressed in BL21 (DE3) Star (Novagen) and purified by Ni-NTA affinity as previously described ( ). .. Fluorophore-tagged tubulin was prepared by adding a 10-fold molar excess of carboxytetramethylrhodamine (TAMRA, C-1171, Invitrogen, Carlsbad, CA, USA) to tubulin for a labeling stoichiometry of 0.40 to 0.70 ( ).

    Purification:

    Article Title: Community Rates of IgG4 Antibodies to Ascaris Haemoglobin Reflect Changes in Community Egg Loads Following Mass Drug Administration
    Article Snippet: .. Prokaryotic expression and purification of rAsHb The AsHb-containing vector construct was transformed into BL21 Star (DE3) One Shot cells and cells were grown in Luria Broth (Miller) (Sigma, St. Louis, MO, USA) containing 50μg/ml carbenicillin (Sigma). .. Overnight cultures of the transformed bacteria were diluted 1:100 in LB + carbenicillin and grown at 37°C with shaking to an optical density of approximately 0.5–0.8 at 600nm.

    Article Title: Different motilities of microtubules driven by kinesin-1 and kinesin-14 motors patterned on nanopillars
    Article Snippet: .. The construct was expressed in BL21 (DE3) Star (Novagen) and purified by Ni-NTA affinity as previously described ( ). .. Phosphocellulose (PC) tubulin was purified from porcine brains after 2 cycles of assembly-disassembly and PC chromatography ( ) and stored in liquid nitrogen.

    Produced:

    Article Title: Prolonging hypothermic storage (4 C) of bovine embryos with fish antifreeze protein
    Article Snippet: Preparation of recombinant nfeAFP11 Our previously developed expression method using E. coli produced approximately 50 mg of nfeAFP11 per liter of culture on average [ ]. .. Second, the host strain was changed to E.coli BL21 Star (DE3, Novagen, Madison, WI, USA), which carries a mutated rne131 for increasing mRNA stability.

    Concentration Assay:

    Article Title: Community Rates of IgG4 Antibodies to Ascaris Haemoglobin Reflect Changes in Community Egg Loads Following Mass Drug Administration
    Article Snippet: Prokaryotic expression and purification of rAsHb The AsHb-containing vector construct was transformed into BL21 Star (DE3) One Shot cells and cells were grown in Luria Broth (Miller) (Sigma, St. Louis, MO, USA) containing 50μg/ml carbenicillin (Sigma). .. Protein expression was induced by addition of isopropylthiogalactoside to the culture medium to a final concentration of 1 mM.

    Incubation:

    Article Title: Community Rates of IgG4 Antibodies to Ascaris Haemoglobin Reflect Changes in Community Egg Loads Following Mass Drug Administration
    Article Snippet: Prokaryotic expression and purification of rAsHb The AsHb-containing vector construct was transformed into BL21 Star (DE3) One Shot cells and cells were grown in Luria Broth (Miller) (Sigma, St. Louis, MO, USA) containing 50μg/ml carbenicillin (Sigma). .. After 4h of incubation at 37°C under vigorous agitation (250 rpm), E . coli cells were pelleted by centrifugation and suspended in 1:25 of the initial culture volume of ice-cold RIPA lysis and extraction buffer (G Biosciences, St. Louis, MO, USA), incubated on shaking device at room temperature (RT) for 30 min and then centrifuged for 10 min at 4.500 g. The pellet was suspended again in RIPA lysis and extraction buffer and the previous incubation and centrifugation step was repeated twice more.

    Cell Culture:

    Article Title: Prolonging hypothermic storage (4 C) of bovine embryos with fish antifreeze protein
    Article Snippet: Second, the host strain was changed to E.coli BL21 Star (DE3, Novagen, Madison, WI, USA), which carries a mutated rne131 for increasing mRNA stability. .. Cell culture was then carried out in a 1-l BMJ–01PI fermenter (ABLE & Biott, Tokyo, Japan) at 25 C and agitated at 60 g for 24 h. The overnight culture was harvested by centrifugation at 4,000 g for 15 min.

    Recombinant:

    Article Title: Prolonging hypothermic storage (4 C) of bovine embryos with fish antifreeze protein
    Article Snippet: Paragraph title: Preparation of recombinant nfeAFP11 ... Second, the host strain was changed to E.coli BL21 Star (DE3, Novagen, Madison, WI, USA), which carries a mutated rne131 for increasing mRNA stability.

    Article Title: Tick saliva protein Evasin-3 modulates chemotaxis by disrupting CXCL8 interactions with glycosaminoglycans and CXCR2
    Article Snippet: Paragraph title: Expression of recombinant proteins ... Both proteins were expressed in BL21 (DE3) Star (Novagen).

    Construct:

    Article Title: Community Rates of IgG4 Antibodies to Ascaris Haemoglobin Reflect Changes in Community Egg Loads Following Mass Drug Administration
    Article Snippet: .. Prokaryotic expression and purification of rAsHb The AsHb-containing vector construct was transformed into BL21 Star (DE3) One Shot cells and cells were grown in Luria Broth (Miller) (Sigma, St. Louis, MO, USA) containing 50μg/ml carbenicillin (Sigma). .. Overnight cultures of the transformed bacteria were diluted 1:100 in LB + carbenicillin and grown at 37°C with shaking to an optical density of approximately 0.5–0.8 at 600nm.

    Article Title: Prolonging hypothermic storage (4 C) of bovine embryos with fish antifreeze protein
    Article Snippet: First, we constructed two genes for expressing nfeAFP11 comprising a ribosomal binding site upstream by amplifying the following two DNA fragments: GCGGATCCGGCACCCTCAGAACTACTAAGC (Bam HI site underlined) and CGGGATCCAATAATTTTGTTTAACTTTAAG (Bam HI site underlined). .. Second, the host strain was changed to E.coli BL21 Star (DE3, Novagen, Madison, WI, USA), which carries a mutated rne131 for increasing mRNA stability.

    Article Title: Different motilities of microtubules driven by kinesin-1 and kinesin-14 motors patterned on nanopillars
    Article Snippet: .. The construct was expressed in BL21 (DE3) Star (Novagen) and purified by Ni-NTA affinity as previously described ( ). .. Phosphocellulose (PC) tubulin was purified from porcine brains after 2 cycles of assembly-disassembly and PC chromatography ( ) and stored in liquid nitrogen.

    Expressing:

    Article Title: Community Rates of IgG4 Antibodies to Ascaris Haemoglobin Reflect Changes in Community Egg Loads Following Mass Drug Administration
    Article Snippet: .. Prokaryotic expression and purification of rAsHb The AsHb-containing vector construct was transformed into BL21 Star (DE3) One Shot cells and cells were grown in Luria Broth (Miller) (Sigma, St. Louis, MO, USA) containing 50μg/ml carbenicillin (Sigma). .. Overnight cultures of the transformed bacteria were diluted 1:100 in LB + carbenicillin and grown at 37°C with shaking to an optical density of approximately 0.5–0.8 at 600nm.

    Article Title: Prolonging hypothermic storage (4 C) of bovine embryos with fish antifreeze protein
    Article Snippet: The modified expression vector was named pET20b–dual–nfeAFP11. .. Second, the host strain was changed to E.coli BL21 Star (DE3, Novagen, Madison, WI, USA), which carries a mutated rne131 for increasing mRNA stability.

    Article Title: Tick saliva protein Evasin-3 modulates chemotaxis by disrupting CXCL8 interactions with glycosaminoglycans and CXCR2
    Article Snippet: Paragraph title: Expression of recombinant proteins ... Both proteins were expressed in BL21 (DE3) Star (Novagen).

    Modification:

    Article Title: Prolonging hypothermic storage (4 C) of bovine embryos with fish antifreeze protein
    Article Snippet: The modified expression vector was named pET20b–dual–nfeAFP11. .. Second, the host strain was changed to E.coli BL21 Star (DE3, Novagen, Madison, WI, USA), which carries a mutated rne131 for increasing mRNA stability.

    Lysis:

    Article Title: Community Rates of IgG4 Antibodies to Ascaris Haemoglobin Reflect Changes in Community Egg Loads Following Mass Drug Administration
    Article Snippet: Prokaryotic expression and purification of rAsHb The AsHb-containing vector construct was transformed into BL21 Star (DE3) One Shot cells and cells were grown in Luria Broth (Miller) (Sigma, St. Louis, MO, USA) containing 50μg/ml carbenicillin (Sigma). .. After 4h of incubation at 37°C under vigorous agitation (250 rpm), E . coli cells were pelleted by centrifugation and suspended in 1:25 of the initial culture volume of ice-cold RIPA lysis and extraction buffer (G Biosciences, St. Louis, MO, USA), incubated on shaking device at room temperature (RT) for 30 min and then centrifuged for 10 min at 4.500 g. The pellet was suspended again in RIPA lysis and extraction buffer and the previous incubation and centrifugation step was repeated twice more.

    Transformation Assay:

    Article Title: Community Rates of IgG4 Antibodies to Ascaris Haemoglobin Reflect Changes in Community Egg Loads Following Mass Drug Administration
    Article Snippet: .. Prokaryotic expression and purification of rAsHb The AsHb-containing vector construct was transformed into BL21 Star (DE3) One Shot cells and cells were grown in Luria Broth (Miller) (Sigma, St. Louis, MO, USA) containing 50μg/ml carbenicillin (Sigma). .. Overnight cultures of the transformed bacteria were diluted 1:100 in LB + carbenicillin and grown at 37°C with shaking to an optical density of approximately 0.5–0.8 at 600nm.

    Article Title: Different motilities of microtubules driven by kinesin-1 and kinesin-14 motors patterned on nanopillars
    Article Snippet: The plasmid was transformed into an E. coli Rosetta (DE3) pLysS (Novagen). .. The construct was expressed in BL21 (DE3) Star (Novagen) and purified by Ni-NTA affinity as previously described ( ).

    Variant Assay:

    Article Title: Tick saliva protein Evasin-3 modulates chemotaxis by disrupting CXCL8 interactions with glycosaminoglycans and CXCR2
    Article Snippet: Expression of recombinant proteins The pET23a vector containing human CXCL8 (UniProt: p10145, 6–77) and monomeric variant V27P/E29P CXCL8 and pET30a containing Evasin-3 (UniProt: p0c8e8, 1–66) genes were purchased from GenScript. .. Both proteins were expressed in BL21 (DE3) Star (Novagen).

    Plasmid Preparation:

    Article Title: Community Rates of IgG4 Antibodies to Ascaris Haemoglobin Reflect Changes in Community Egg Loads Following Mass Drug Administration
    Article Snippet: .. Prokaryotic expression and purification of rAsHb The AsHb-containing vector construct was transformed into BL21 Star (DE3) One Shot cells and cells were grown in Luria Broth (Miller) (Sigma, St. Louis, MO, USA) containing 50μg/ml carbenicillin (Sigma). .. Overnight cultures of the transformed bacteria were diluted 1:100 in LB + carbenicillin and grown at 37°C with shaking to an optical density of approximately 0.5–0.8 at 600nm.

    Article Title: Prolonging hypothermic storage (4 C) of bovine embryos with fish antifreeze protein
    Article Snippet: The modified expression vector was named pET20b–dual–nfeAFP11. .. Second, the host strain was changed to E.coli BL21 Star (DE3, Novagen, Madison, WI, USA), which carries a mutated rne131 for increasing mRNA stability.

    Article Title: Different motilities of microtubules driven by kinesin-1 and kinesin-14 motors patterned on nanopillars
    Article Snippet: The kinesin-14 was constructed from Drosophila melanogaster (amino acids 195 to 700) and cloned into the pBirAcm (Avidity) plasmid containing an N-terminal histidine tag and AviTag. .. The construct was expressed in BL21 (DE3) Star (Novagen) and purified by Ni-NTA affinity as previously described ( ).

    Article Title: Tick saliva protein Evasin-3 modulates chemotaxis by disrupting CXCL8 interactions with glycosaminoglycans and CXCR2
    Article Snippet: Expression of recombinant proteins The pET23a vector containing human CXCL8 (UniProt: p10145, 6–77) and monomeric variant V27P/E29P CXCL8 and pET30a containing Evasin-3 (UniProt: p0c8e8, 1–66) genes were purchased from GenScript. .. Both proteins were expressed in BL21 (DE3) Star (Novagen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Millipore e coli bl21 star de3 cells
    E Coli Bl21 Star De3 Cells, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21 star de3 cells/product/Millipore
    Average 91 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 star de3 cells - by Bioz Stars, 2020-03
    91/100 stars
      Buy from Supplier

    Image Search Results