bl21 de3 rosetta  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Millipore bl21 de3 rosetta
    Optimization of conditions for the overexpression of ELIC 1a . A cartoon representation of ELIC highlighting the membrane spanning pore forming domain (red helices), the extracellular domain (yellow B-sheets), and the boundaries of the cell membrane in relation to the channel structure. 1b . Upper panel, a western blot analysis of the expression levels of the ELIC channel made in the E. coli strains: C41, C43, <t>BL21</t> Gold, BL21 Codon (+) and BL21 <t>Rosetta</t> in the following growth media: Terrific Broth (TB, yellow), Auto-Induction medium (AI, blue) and LB medium (red). Lower panel, normalized ELIC band density from the western blot (Penta-histidine antibody) were plotted against E. coli strains grouped by growth media. 1c. The effect of the cell culture volume on ELIC expression levels and final culture biomass was studied for the three most promising E. coli strains: BL21 Gold, BL21 Codon (+) and BL21 Rosetta. 1d. The effect of Zn 2+ and Mg 2+ as channel negative modifiers or the competitive antagonist ACh on ELIC expression levels is represented as a bar plot.
    Bl21 De3 Rosetta, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 rosetta/product/Millipore
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 rosetta - by Bioz Stars, 2020-04
    94/100 stars

    Images

    1) Product Images from "A cost-effective protocol for the over-expression and purification of fully-functional and more stable Erwinia chrisanthemi ligand-gated ion channel"

    Article Title: A cost-effective protocol for the over-expression and purification of fully-functional and more stable Erwinia chrisanthemi ligand-gated ion channel

    Journal: Protein expression and purification

    doi: 10.1016/j.pep.2017.03.006

    Optimization of conditions for the overexpression of ELIC 1a . A cartoon representation of ELIC highlighting the membrane spanning pore forming domain (red helices), the extracellular domain (yellow B-sheets), and the boundaries of the cell membrane in relation to the channel structure. 1b . Upper panel, a western blot analysis of the expression levels of the ELIC channel made in the E. coli strains: C41, C43, BL21 Gold, BL21 Codon (+) and BL21 Rosetta in the following growth media: Terrific Broth (TB, yellow), Auto-Induction medium (AI, blue) and LB medium (red). Lower panel, normalized ELIC band density from the western blot (Penta-histidine antibody) were plotted against E. coli strains grouped by growth media. 1c. The effect of the cell culture volume on ELIC expression levels and final culture biomass was studied for the three most promising E. coli strains: BL21 Gold, BL21 Codon (+) and BL21 Rosetta. 1d. The effect of Zn 2+ and Mg 2+ as channel negative modifiers or the competitive antagonist ACh on ELIC expression levels is represented as a bar plot.
    Figure Legend Snippet: Optimization of conditions for the overexpression of ELIC 1a . A cartoon representation of ELIC highlighting the membrane spanning pore forming domain (red helices), the extracellular domain (yellow B-sheets), and the boundaries of the cell membrane in relation to the channel structure. 1b . Upper panel, a western blot analysis of the expression levels of the ELIC channel made in the E. coli strains: C41, C43, BL21 Gold, BL21 Codon (+) and BL21 Rosetta in the following growth media: Terrific Broth (TB, yellow), Auto-Induction medium (AI, blue) and LB medium (red). Lower panel, normalized ELIC band density from the western blot (Penta-histidine antibody) were plotted against E. coli strains grouped by growth media. 1c. The effect of the cell culture volume on ELIC expression levels and final culture biomass was studied for the three most promising E. coli strains: BL21 Gold, BL21 Codon (+) and BL21 Rosetta. 1d. The effect of Zn 2+ and Mg 2+ as channel negative modifiers or the competitive antagonist ACh on ELIC expression levels is represented as a bar plot.

    Techniques Used: Over Expression, Western Blot, Expressing, Cell Culture

    Related Articles

    Clone Assay:

    Article Title: CONSTANS Imparts DNA Sequence Specificity to the Histone Fold NF-YB/NF-YC Dimer [OPEN]
    Article Snippet: At- NF-YC9 cDNA, encoding amino acids 62 to 158 with a 5′ ATG , a 3′ stop codon, and mutant At-NF-YC9 with residue Phe-151 mutated to Arg (NF-YC9F151R) were obtained by gene synthesis and cloned in pmcnYC ( ). .. CO-6His and co7-6His were expressed in BL21(DE3)Rosetta by IPTG induction (0.4 mM IPTG for 4 h at 25°C) and purified by ion metal affinity chromatography (HisSelect; Sigma-Aldrich) in buffer A (10 mM Tris-HCl, pH 8.0, 400 mM NaCl, 2 mM MgCl2 , and 5 mM imidazole).

    Article Title: Molecular and immunological characterization of allergens from the entomopathogenic fungus Beauveria bassiana
    Article Snippet: .. E. coli stains TOPO Top10 (Invitrogen, CA) and BL21 Rosetta (DE3), harboring the pRARE plasmid (Novagen, Darmstadt, Germany) were used for routine cloning and protein expression, respectively. ..

    Article Title: Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex
    Article Snippet: Various constructs of mouse and human AHR and ARNT encompassing the bHLH and PAS-A domains were cloned in pQlink vector harboring an N-terminal His8 -tag and a TEV cleavage site using standard PCR-based molecular cloning procedures. .. AHR and ARNT were expressed in BL21 (DE3) Rosetta (Novagen) after assembly of their expression cassettes into the same pQlink vector.

    Article Title: A cost-effective protocol for the over-expression and purification of fully-functional and more stable Erwinia chrisanthemi ligand-gated ion channel
    Article Snippet: MBP-ELIC cloned into the pET28 vector was generously provided by Claudio Grosman (University of Illinois at Urbana-Champaign). .. E. coli strains: BL21 DE3 Gold, BL21 DE3 Codon (+), BL21 DE3 Rosetta (Novagen), C41, and C43 (Lucigen) were tested for their ability to express the MBP-ELIC fusion protein in sufficient quantity and quality.

    Article Title: A Forward Genetic Screen Reveals that Calcium-dependent Protein Kinase 3 Regulates Egress in Toxoplasma
    Article Snippet: Paragraph title: Cloning and expression of recombinant TgCDPK3recombinant TgCDPK3 ... The proteins were expressed in BL21-Rosetta (DE3)pLysS cells (EMD Chemicals) at 18°C and purified using Ni-NTA agarose according to the manufacturer's protocol.

    Centrifugation:

    Article Title: Activation of an Endoribonuclease by Non-intein Protein Splicing *Activation of an Endoribonuclease by Non-intein Protein Splicing * ♦
    Article Snippet: The empty pGex plasmid, GST-RB47 ID, CTD and antigen plasmids were expressed in E. coli Top 10 cells (Invitrogen), while pGex GST-RB47 was expressed in BL21 Rosetta (Novagen) cells to improve expression. .. Expression was induced with 0.5 m m IPTG for 2 h at 20 °C and cells were collected by centrifugation.

    Amplification:

    Article Title: CONSTANS Imparts DNA Sequence Specificity to the Histone Fold NF-YB/NF-YC Dimer [OPEN]
    Article Snippet: The cDNA encoding the CCT domain of CO (amino acids 290–352), with the addition of a 5′ ATG , was obtained by PCR amplification; the cDNA encoding CO CCT amino acids 290 to 352 with the R340Q mutation , At-NF-YA2 (amino acids 134–207), and At-NF-YA6 (amino acids 170–237) was obtained by gene synthesis (Eurofins Genomics) and cloned into pmcnEA/tH ( ) by restriction-end ligation to obtain C-terminal 6His-tag fusions ( ). .. CO-6His and co7-6His were expressed in BL21(DE3)Rosetta by IPTG induction (0.4 mM IPTG for 4 h at 25°C) and purified by ion metal affinity chromatography (HisSelect; Sigma-Aldrich) in buffer A (10 mM Tris-HCl, pH 8.0, 400 mM NaCl, 2 mM MgCl2 , and 5 mM imidazole).

    Article Title: A Forward Genetic Screen Reveals that Calcium-dependent Protein Kinase 3 Regulates Egress in Toxoplasma
    Article Snippet: Cloning and expression of recombinant TgCDPK3recombinant TgCDPK3 Recombinant TgCDPK3 was amplified with Phusion polymerase (New England Biolabs) from the previously published codon optimized expression construct , and cloned into the pET28a vector (Novagen) using the Cold-Fusion enzyme kit (Biocat) with the primers 5′-agcggcctggtgccgcgcggcagcggctgcgtgcacagcaaaaatccgc-3′ and 5′-tggtggtggtggtgctcgagtcagtgtttgacttttacatcatcgcaaattt -3′ to generate a N-HIS-tagged TgCDPK3. .. The proteins were expressed in BL21-Rosetta (DE3)pLysS cells (EMD Chemicals) at 18°C and purified using Ni-NTA agarose according to the manufacturer's protocol.

    Filtration:

    Article Title: Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex
    Article Snippet: AHR and ARNT were expressed in BL21 (DE3) Rosetta (Novagen) after assembly of their expression cassettes into the same pQlink vector. .. For assembly of the AHR–ARNT–DRE complexes, recombinant AHR–ARNT heterodimers were mixed with DRE oligonucleotides in 1:1.1–1.2 molar ratio and purified by gel filtration chromatography (Superdex 200, GE Healthcare).

    Construct:

    Article Title: Tropomyosin-Binding Properties Modulate Competition Between Tropomodulin Isoforms
    Article Snippet: .. Tmod3 constructs (WT, truncated and mutants) were overexpressed in BL21 Rosetta™ 2(DE3)plysS Singles™ cells (Novagen) using LB media with 1% glucose, 0.1 mg/mL carbenicillin and 0.034 mg/mL chloramphenicol that was supplemented with 0.1 mM IPTG for induction at OD600 = 0.6. .. The cells were grown for 5 hours after induction and pelleted at 8,000 RPM (Beckman-Coulter JA-10 Rotor), 4°C, 8 minutes.

    Article Title: Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex
    Article Snippet: Various constructs of mouse and human AHR and ARNT encompassing the bHLH and PAS-A domains were cloned in pQlink vector harboring an N-terminal His8 -tag and a TEV cleavage site using standard PCR-based molecular cloning procedures. .. AHR and ARNT were expressed in BL21 (DE3) Rosetta (Novagen) after assembly of their expression cassettes into the same pQlink vector.

    Article Title: A cost-effective protocol for the over-expression and purification of fully-functional and more stable Erwinia chrisanthemi ligand-gated ion channel
    Article Snippet: This construct was generated using the following scheme: 6×His tag − MBP − 6×His tag − Tobacco Etch Virus cut site – ELIC. .. E. coli strains: BL21 DE3 Gold, BL21 DE3 Codon (+), BL21 DE3 Rosetta (Novagen), C41, and C43 (Lucigen) were tested for their ability to express the MBP-ELIC fusion protein in sufficient quantity and quality.

    Article Title: A Forward Genetic Screen Reveals that Calcium-dependent Protein Kinase 3 Regulates Egress in Toxoplasma
    Article Snippet: Cloning and expression of recombinant TgCDPK3recombinant TgCDPK3 Recombinant TgCDPK3 was amplified with Phusion polymerase (New England Biolabs) from the previously published codon optimized expression construct , and cloned into the pET28a vector (Novagen) using the Cold-Fusion enzyme kit (Biocat) with the primers 5′-agcggcctggtgccgcgcggcagcggctgcgtgcacagcaaaaatccgc-3′ and 5′-tggtggtggtggtgctcgagtcagtgtttgacttttacatcatcgcaaattt -3′ to generate a N-HIS-tagged TgCDPK3. .. The proteins were expressed in BL21-Rosetta (DE3)pLysS cells (EMD Chemicals) at 18°C and purified using Ni-NTA agarose according to the manufacturer's protocol.

    Incubation:

    Article Title: Peroxisome protein import recapitulated in Xenopus egg extracts
    Article Snippet: All recombinant proteins were expressed in BL21 (DE3) Rosetta (Novagen) E. coli strains (EMD Millipore). .. Then 0.5 mM isopropyl β-D-1-thiogalactopyranoside was added to the culture, the temperature was reduced to 18°C, and incubation was continued for an additional 16 h. Harvested bacteria were lysed using a microfluidizer.

    Article Title: Peroxisome protein import recapitulated in Xenopus egg extracts
    Article Snippet: Protein expression and purification All recombinant proteins were expressed in BL21 (DE3) Rosetta (Novagen) E. coli strains (EMD Millipore). .. Then 0.5 mM isopropyl β-D-1-thiogalactopyranoside was added to the culture, the temperature was reduced to 18°C, and incubation was continued for an additional 16 h. Harvested bacteria were lysed using a microfluidizer.

    Article Title: Single-stranded DNA Scanning and Deamination by APOBEC3G Cytidine Deaminase at Single Molecule Resolution *
    Article Snippet: The resulting vector (pPFUe-I48C) was transformed into BL21 Rosetta(DE3) pLysS (Novagen). .. After sonication on ice (10 × 15-s pulses), 20 units of DNase I and 10 μg/ml RNase A were added, and cells were incubated at 37 °C for 30 min and then boiled for 15 min.

    Expressing:

    Article Title: Tropomyosin-Binding Properties Modulate Competition Between Tropomodulin Isoforms
    Article Snippet: Paragraph title: Protein Expression and Purification ... Tmod3 constructs (WT, truncated and mutants) were overexpressed in BL21 Rosetta™ 2(DE3)plysS Singles™ cells (Novagen) using LB media with 1% glucose, 0.1 mg/mL carbenicillin and 0.034 mg/mL chloramphenicol that was supplemented with 0.1 mM IPTG for induction at OD600 = 0.6.

    Article Title: Peroxisome protein import recapitulated in Xenopus egg extracts
    Article Snippet: Paragraph title: Protein expression and purification ... All recombinant proteins were expressed in BL21 (DE3) Rosetta (Novagen) E. coli strains (EMD Millipore).

    Article Title: Molecular and immunological characterization of allergens from the entomopathogenic fungus Beauveria bassiana
    Article Snippet: .. E. coli stains TOPO Top10 (Invitrogen, CA) and BL21 Rosetta (DE3), harboring the pRARE plasmid (Novagen, Darmstadt, Germany) were used for routine cloning and protein expression, respectively. ..

    Article Title: Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex
    Article Snippet: .. AHR and ARNT were expressed in BL21 (DE3) Rosetta (Novagen) after assembly of their expression cassettes into the same pQlink vector. .. Bacteria was lysed in a buffer containing 25 mM Tris, 500 mM NaCl, 5 mM MgCl2 , 300 mM KCl, 5 mM ATP, 0.5% Triton X-100, and the AHR–ARNT heterodimer was purified over Ni-NTA resin.

    Article Title: Peroxisome protein import recapitulated in Xenopus egg extracts
    Article Snippet: .. Protein expression and purification All recombinant proteins were expressed in BL21 (DE3) Rosetta (Novagen) E. coli strains (EMD Millipore). ..

    Article Title: A Forward Genetic Screen Reveals that Calcium-dependent Protein Kinase 3 Regulates Egress in Toxoplasma
    Article Snippet: Paragraph title: Cloning and expression of recombinant TgCDPK3recombinant TgCDPK3 ... The proteins were expressed in BL21-Rosetta (DE3)pLysS cells (EMD Chemicals) at 18°C and purified using Ni-NTA agarose according to the manufacturer's protocol.

    Article Title: Single-stranded DNA Scanning and Deamination by APOBEC3G Cytidine Deaminase at Single Molecule Resolution *
    Article Snippet: Paragraph title: Pfu DNA Polymerase Expression, Purification, and Labeling ... The resulting vector (pPFUe-I48C) was transformed into BL21 Rosetta(DE3) pLysS (Novagen).

    Article Title: Activation of an Endoribonuclease by Non-intein Protein Splicing *Activation of an Endoribonuclease by Non-intein Protein Splicing * ♦
    Article Snippet: .. The empty pGex plasmid, GST-RB47 ID, CTD and antigen plasmids were expressed in E. coli Top 10 cells (Invitrogen), while pGex GST-RB47 was expressed in BL21 Rosetta (Novagen) cells to improve expression. .. Expression was induced with 0.5 m m IPTG for 2 h at 20 °C and cells were collected by centrifugation.

    Modification:

    Article Title: Identification of a Small Molecule That Modifies MglA/SspA Interaction and Impairs Intramacrophage Survival of Francisella tularensis
    Article Snippet: F. novicida U112 and Fn-ΔsspA were routinely cultured at 37°C with aeration, in modified tryptic soy broth (TSB) (Difco Laboratories, Detroit, MI) containing 135 µg/ml ferric pyrophosphate and 0.1% cysteine hydrochloride. .. E. coli strain BL21-Star(DE3) (Invitrogen) was used to expressed individual Ft-MglA and Ft-SspA His-tagged fusion proteins for purification, and BL21-Rosetta(DE3) (Novagen, Gibbstown, NJ) was used when Ft-MglA and Ft-SspA were co-expressed.

    Transformation Assay:

    Article Title: Native capillary isoelectric focusing for the separation of protein complex isoforms and subcomplexes
    Article Snippet: .. Dam1 complex polycistronic vector was transformed into BL21 Rosetta (Novagen, Madison, WI). ..

    Article Title: Single-stranded DNA Scanning and Deamination by APOBEC3G Cytidine Deaminase at Single Molecule Resolution *
    Article Snippet: .. The resulting vector (pPFUe-I48C) was transformed into BL21 Rosetta(DE3) pLysS (Novagen). ..

    Chromatography:

    Article Title: Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex
    Article Snippet: AHR and ARNT were expressed in BL21 (DE3) Rosetta (Novagen) after assembly of their expression cassettes into the same pQlink vector. .. Upon removal of the His8 -tag, the complexes were further purified by cation exchange chromatography (GE Healthcare).

    Ligation:

    Article Title: CONSTANS Imparts DNA Sequence Specificity to the Histone Fold NF-YB/NF-YC Dimer [OPEN]
    Article Snippet: The cDNA encoding the CCT domain of CO (amino acids 290–352), with the addition of a 5′ ATG , was obtained by PCR amplification; the cDNA encoding CO CCT amino acids 290 to 352 with the R340Q mutation , At-NF-YA2 (amino acids 134–207), and At-NF-YA6 (amino acids 170–237) was obtained by gene synthesis (Eurofins Genomics) and cloned into pmcnEA/tH ( ) by restriction-end ligation to obtain C-terminal 6His-tag fusions ( ). .. CO-6His and co7-6His were expressed in BL21(DE3)Rosetta by IPTG induction (0.4 mM IPTG for 4 h at 25°C) and purified by ion metal affinity chromatography (HisSelect; Sigma-Aldrich) in buffer A (10 mM Tris-HCl, pH 8.0, 400 mM NaCl, 2 mM MgCl2 , and 5 mM imidazole).

    Protease Inhibitor:

    Article Title: Single-stranded DNA Scanning and Deamination by APOBEC3G Cytidine Deaminase at Single Molecule Resolution *
    Article Snippet: The resulting vector (pPFUe-I48C) was transformed into BL21 Rosetta(DE3) pLysS (Novagen). .. Isopropyl-1-thio-β- d -galactopyranoside was added (1 m m final concentration), and cells were grown at room temperature (∼25 °C) overnight and then centrifuged at 4 °C (4,000 rpm for 15 min) and resuspended in 25 m m HEPES, pH 7.8, 500 m m NaCl, 5 m m imidazole, 1 m m phenylmethanesulfonyl fluoride, protease inhibitor mixture, 50 mg/ml lysozyme.

    Cell Culture:

    Article Title: Identification of a Small Molecule That Modifies MglA/SspA Interaction and Impairs Intramacrophage Survival of Francisella tularensis
    Article Snippet: F. novicida U112 and Fn-ΔsspA were routinely cultured at 37°C with aeration, in modified tryptic soy broth (TSB) (Difco Laboratories, Detroit, MI) containing 135 µg/ml ferric pyrophosphate and 0.1% cysteine hydrochloride. .. E. coli strain BL21-Star(DE3) (Invitrogen) was used to expressed individual Ft-MglA and Ft-SspA His-tagged fusion proteins for purification, and BL21-Rosetta(DE3) (Novagen, Gibbstown, NJ) was used when Ft-MglA and Ft-SspA were co-expressed.

    Generated:

    Article Title: Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex
    Article Snippet: AHR mutants were generated by using site-directed mutagenesis. .. AHR and ARNT were expressed in BL21 (DE3) Rosetta (Novagen) after assembly of their expression cassettes into the same pQlink vector.

    Article Title: A cost-effective protocol for the over-expression and purification of fully-functional and more stable Erwinia chrisanthemi ligand-gated ion channel
    Article Snippet: This construct was generated using the following scheme: 6×His tag − MBP − 6×His tag − Tobacco Etch Virus cut site – ELIC. .. E. coli strains: BL21 DE3 Gold, BL21 DE3 Codon (+), BL21 DE3 Rosetta (Novagen), C41, and C43 (Lucigen) were tested for their ability to express the MBP-ELIC fusion protein in sufficient quantity and quality.

    Polymerase Chain Reaction:

    Article Title: CONSTANS Imparts DNA Sequence Specificity to the Histone Fold NF-YB/NF-YC Dimer [OPEN]
    Article Snippet: The cDNA encoding the CCT domain of CO (amino acids 290–352), with the addition of a 5′ ATG , was obtained by PCR amplification; the cDNA encoding CO CCT amino acids 290 to 352 with the R340Q mutation , At-NF-YA2 (amino acids 134–207), and At-NF-YA6 (amino acids 170–237) was obtained by gene synthesis (Eurofins Genomics) and cloned into pmcnEA/tH ( ) by restriction-end ligation to obtain C-terminal 6His-tag fusions ( ). .. CO-6His and co7-6His were expressed in BL21(DE3)Rosetta by IPTG induction (0.4 mM IPTG for 4 h at 25°C) and purified by ion metal affinity chromatography (HisSelect; Sigma-Aldrich) in buffer A (10 mM Tris-HCl, pH 8.0, 400 mM NaCl, 2 mM MgCl2 , and 5 mM imidazole).

    Article Title: Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex
    Article Snippet: Various constructs of mouse and human AHR and ARNT encompassing the bHLH and PAS-A domains were cloned in pQlink vector harboring an N-terminal His8 -tag and a TEV cleavage site using standard PCR-based molecular cloning procedures. .. AHR and ARNT were expressed in BL21 (DE3) Rosetta (Novagen) after assembly of their expression cassettes into the same pQlink vector.

    Sonication:

    Article Title: Tropomyosin-Binding Properties Modulate Competition Between Tropomodulin Isoforms
    Article Snippet: Tmod3 constructs (WT, truncated and mutants) were overexpressed in BL21 Rosetta™ 2(DE3)plysS Singles™ cells (Novagen) using LB media with 1% glucose, 0.1 mg/mL carbenicillin and 0.034 mg/mL chloramphenicol that was supplemented with 0.1 mM IPTG for induction at OD600 = 0.6. .. The pellets were resuspended in 20 mM Tris-HCl pH 7.5, 100 mM NaCl, 1 mM Pefabloc and 1 mM TLCK, sonicated and spun down at 16,000 RPM (Beckman-Coulter JA-17 Rotor), 4°C, 30 minutes.

    Article Title: Single-stranded DNA Scanning and Deamination by APOBEC3G Cytidine Deaminase at Single Molecule Resolution *
    Article Snippet: The resulting vector (pPFUe-I48C) was transformed into BL21 Rosetta(DE3) pLysS (Novagen). .. After sonication on ice (10 × 15-s pulses), 20 units of DNase I and 10 μg/ml RNase A were added, and cells were incubated at 37 °C for 30 min and then boiled for 15 min.

    Article Title: Activation of an Endoribonuclease by Non-intein Protein Splicing *Activation of an Endoribonuclease by Non-intein Protein Splicing * ♦
    Article Snippet: The empty pGex plasmid, GST-RB47 ID, CTD and antigen plasmids were expressed in E. coli Top 10 cells (Invitrogen), while pGex GST-RB47 was expressed in BL21 Rosetta (Novagen) cells to improve expression. .. Frozen cells were thawed and lysed by sonication before centrifugation at 10,000 × g for 10 min to remove insoluble material.

    Recombinant:

    Article Title: Peroxisome protein import recapitulated in Xenopus egg extracts
    Article Snippet: .. All recombinant proteins were expressed in BL21 (DE3) Rosetta (Novagen) E. coli strains (EMD Millipore). ..

    Article Title: Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex
    Article Snippet: AHR and ARNT were expressed in BL21 (DE3) Rosetta (Novagen) after assembly of their expression cassettes into the same pQlink vector. .. For assembly of the AHR–ARNT–DRE complexes, recombinant AHR–ARNT heterodimers were mixed with DRE oligonucleotides in 1:1.1–1.2 molar ratio and purified by gel filtration chromatography (Superdex 200, GE Healthcare).

    Article Title: A cost-effective protocol for the over-expression and purification of fully-functional and more stable Erwinia chrisanthemi ligand-gated ion channel
    Article Snippet: Recombinant Tobacco Etch Virus Protease (rTEV) was purified in-house using previously published protocols[ ]. .. E. coli strains: BL21 DE3 Gold, BL21 DE3 Codon (+), BL21 DE3 Rosetta (Novagen), C41, and C43 (Lucigen) were tested for their ability to express the MBP-ELIC fusion protein in sufficient quantity and quality.

    Article Title: Peroxisome protein import recapitulated in Xenopus egg extracts
    Article Snippet: .. Protein expression and purification All recombinant proteins were expressed in BL21 (DE3) Rosetta (Novagen) E. coli strains (EMD Millipore). ..

    Article Title: A Forward Genetic Screen Reveals that Calcium-dependent Protein Kinase 3 Regulates Egress in Toxoplasma
    Article Snippet: Paragraph title: Cloning and expression of recombinant TgCDPK3recombinant TgCDPK3 ... The proteins were expressed in BL21-Rosetta (DE3)pLysS cells (EMD Chemicals) at 18°C and purified using Ni-NTA agarose according to the manufacturer's protocol.

    Article Title: Activation of an Endoribonuclease by Non-intein Protein Splicing *Activation of an Endoribonuclease by Non-intein Protein Splicing * ♦
    Article Snippet: Paragraph title: Recombinant Protein Expression and Purification ... The empty pGex plasmid, GST-RB47 ID, CTD and antigen plasmids were expressed in E. coli Top 10 cells (Invitrogen), while pGex GST-RB47 was expressed in BL21 Rosetta (Novagen) cells to improve expression.

    Molecular Cloning:

    Article Title: Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex
    Article Snippet: Paragraph title: Molecular Cloning and Protein Preparation. ... AHR and ARNT were expressed in BL21 (DE3) Rosetta (Novagen) after assembly of their expression cassettes into the same pQlink vector.

    Ion Exchange Chromatography:

    Article Title: Tropomyosin-Binding Properties Modulate Competition Between Tropomodulin Isoforms
    Article Snippet: WT-Tmod2 and Tmod21-346 constructs were overexpressed in E. coli BL21 (DE3) using auto-induction medium according to the method described in ( ) and purified using Ni-NTA agarose and ion-exchange chromatography according to the method described in ( ). .. Tmod3 constructs (WT, truncated and mutants) were overexpressed in BL21 Rosetta™ 2(DE3)plysS Singles™ cells (Novagen) using LB media with 1% glucose, 0.1 mg/mL carbenicillin and 0.034 mg/mL chloramphenicol that was supplemented with 0.1 mM IPTG for induction at OD600 = 0.6.

    Mutagenesis:

    Article Title: CONSTANS Imparts DNA Sequence Specificity to the Histone Fold NF-YB/NF-YC Dimer [OPEN]
    Article Snippet: At- NF-YC9 cDNA, encoding amino acids 62 to 158 with a 5′ ATG , a 3′ stop codon, and mutant At-NF-YC9 with residue Phe-151 mutated to Arg (NF-YC9F151R) were obtained by gene synthesis and cloned in pmcnYC ( ). .. CO-6His and co7-6His were expressed in BL21(DE3)Rosetta by IPTG induction (0.4 mM IPTG for 4 h at 25°C) and purified by ion metal affinity chromatography (HisSelect; Sigma-Aldrich) in buffer A (10 mM Tris-HCl, pH 8.0, 400 mM NaCl, 2 mM MgCl2 , and 5 mM imidazole).

    Article Title: Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex
    Article Snippet: AHR mutants were generated by using site-directed mutagenesis. .. AHR and ARNT were expressed in BL21 (DE3) Rosetta (Novagen) after assembly of their expression cassettes into the same pQlink vector.

    Article Title: A cost-effective protocol for the over-expression and purification of fully-functional and more stable Erwinia chrisanthemi ligand-gated ion channel
    Article Snippet: Mutations were made in-house by site directed mutagenesis. .. E. coli strains: BL21 DE3 Gold, BL21 DE3 Codon (+), BL21 DE3 Rosetta (Novagen), C41, and C43 (Lucigen) were tested for their ability to express the MBP-ELIC fusion protein in sufficient quantity and quality.

    Article Title: A Forward Genetic Screen Reveals that Calcium-dependent Protein Kinase 3 Regulates Egress in Toxoplasma
    Article Snippet: Point mutations were introduced by site -directed mutagenesis according to the Phusion protocol. .. The proteins were expressed in BL21-Rosetta (DE3)pLysS cells (EMD Chemicals) at 18°C and purified using Ni-NTA agarose according to the manufacturer's protocol.

    Isolation:

    Article Title: Peroxisome protein import recapitulated in Xenopus egg extracts
    Article Snippet: All recombinant proteins were expressed in BL21 (DE3) Rosetta (Novagen) E. coli strains (EMD Millipore). .. GST-tagged protein was isolated using glutathione Sepharose 4B resin (GE Healthcare).

    Article Title: Peroxisome protein import recapitulated in Xenopus egg extracts
    Article Snippet: Protein expression and purification All recombinant proteins were expressed in BL21 (DE3) Rosetta (Novagen) E. coli strains (EMD Millipore). .. GST-tagged protein was isolated using glutathione Sepharose 4B resin (GE Healthcare).

    Labeling:

    Article Title: Single-stranded DNA Scanning and Deamination by APOBEC3G Cytidine Deaminase at Single Molecule Resolution *
    Article Snippet: Paragraph title: Pfu DNA Polymerase Expression, Purification, and Labeling ... The resulting vector (pPFUe-I48C) was transformed into BL21 Rosetta(DE3) pLysS (Novagen).

    Purification:

    Article Title: Native capillary isoelectric focusing for the separation of protein complex isoforms and subcomplexes
    Article Snippet: Saccharomyces cerevisiae Dam1 complex was expressed in and purified from E. coli as described previously. .. Dam1 complex polycistronic vector was transformed into BL21 Rosetta (Novagen, Madison, WI).

    Article Title: Tropomyosin-Binding Properties Modulate Competition Between Tropomodulin Isoforms
    Article Snippet: Paragraph title: Protein Expression and Purification ... Tmod3 constructs (WT, truncated and mutants) were overexpressed in BL21 Rosetta™ 2(DE3)plysS Singles™ cells (Novagen) using LB media with 1% glucose, 0.1 mg/mL carbenicillin and 0.034 mg/mL chloramphenicol that was supplemented with 0.1 mM IPTG for induction at OD600 = 0.6.

    Article Title: CONSTANS Imparts DNA Sequence Specificity to the Histone Fold NF-YB/NF-YC Dimer [OPEN]
    Article Snippet: .. CO-6His and co7-6His were expressed in BL21(DE3)Rosetta by IPTG induction (0.4 mM IPTG for 4 h at 25°C) and purified by ion metal affinity chromatography (HisSelect; Sigma-Aldrich) in buffer A (10 mM Tris-HCl, pH 8.0, 400 mM NaCl, 2 mM MgCl2 , and 5 mM imidazole). .. NF-YA2-6His and NF-YA6-6His were produced in BL21(DE3).

    Article Title: Peroxisome protein import recapitulated in Xenopus egg extracts
    Article Snippet: Paragraph title: Protein expression and purification ... All recombinant proteins were expressed in BL21 (DE3) Rosetta (Novagen) E. coli strains (EMD Millipore).

    Article Title: Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex
    Article Snippet: AHR and ARNT were expressed in BL21 (DE3) Rosetta (Novagen) after assembly of their expression cassettes into the same pQlink vector. .. Bacteria was lysed in a buffer containing 25 mM Tris, 500 mM NaCl, 5 mM MgCl2 , 300 mM KCl, 5 mM ATP, 0.5% Triton X-100, and the AHR–ARNT heterodimer was purified over Ni-NTA resin.

    Article Title: Identification of a Small Molecule That Modifies MglA/SspA Interaction and Impairs Intramacrophage Survival of Francisella tularensis
    Article Snippet: .. E. coli strain BL21-Star(DE3) (Invitrogen) was used to expressed individual Ft-MglA and Ft-SspA His-tagged fusion proteins for purification, and BL21-Rosetta(DE3) (Novagen, Gibbstown, NJ) was used when Ft-MglA and Ft-SspA were co-expressed. .. The strain to purify E. coli SspA (SspA-ASKA) was obtained from the ASKA library .

    Article Title: A cost-effective protocol for the over-expression and purification of fully-functional and more stable Erwinia chrisanthemi ligand-gated ion channel
    Article Snippet: Recombinant Tobacco Etch Virus Protease (rTEV) was purified in-house using previously published protocols[ ]. .. E. coli strains: BL21 DE3 Gold, BL21 DE3 Codon (+), BL21 DE3 Rosetta (Novagen), C41, and C43 (Lucigen) were tested for their ability to express the MBP-ELIC fusion protein in sufficient quantity and quality.

    Article Title: Peroxisome protein import recapitulated in Xenopus egg extracts
    Article Snippet: .. Protein expression and purification All recombinant proteins were expressed in BL21 (DE3) Rosetta (Novagen) E. coli strains (EMD Millipore). ..

    Article Title: A Forward Genetic Screen Reveals that Calcium-dependent Protein Kinase 3 Regulates Egress in Toxoplasma
    Article Snippet: .. The proteins were expressed in BL21-Rosetta (DE3)pLysS cells (EMD Chemicals) at 18°C and purified using Ni-NTA agarose according to the manufacturer's protocol. .. Kinase activity assays Activity measurements of recombinant kinase were performed using phosphorylation of Syntide-2 and subsequent scintillation counting.

    Article Title: Single-stranded DNA Scanning and Deamination by APOBEC3G Cytidine Deaminase at Single Molecule Resolution *
    Article Snippet: Paragraph title: Pfu DNA Polymerase Expression, Purification, and Labeling ... The resulting vector (pPFUe-I48C) was transformed into BL21 Rosetta(DE3) pLysS (Novagen).

    Article Title: Activation of an Endoribonuclease by Non-intein Protein Splicing *Activation of an Endoribonuclease by Non-intein Protein Splicing * ♦
    Article Snippet: Paragraph title: Recombinant Protein Expression and Purification ... The empty pGex plasmid, GST-RB47 ID, CTD and antigen plasmids were expressed in E. coli Top 10 cells (Invitrogen), while pGex GST-RB47 was expressed in BL21 Rosetta (Novagen) cells to improve expression.

    Protein Purification:

    Article Title: Identification of a Small Molecule That Modifies MglA/SspA Interaction and Impairs Intramacrophage Survival of Francisella tularensis
    Article Snippet: E. coli strains DH5α (Invitrogen, Carlslab, CA), XL1-Blue and JM109 (Stratagene, La Jolla, CA) were used to propagate the plasmids for protein purification, point mutations, and two-hybrid systems, respectively. .. E. coli strain BL21-Star(DE3) (Invitrogen) was used to expressed individual Ft-MglA and Ft-SspA His-tagged fusion proteins for purification, and BL21-Rosetta(DE3) (Novagen, Gibbstown, NJ) was used when Ft-MglA and Ft-SspA were co-expressed.

    Affinity Chromatography:

    Article Title: Native capillary isoelectric focusing for the separation of protein complex isoforms and subcomplexes
    Article Snippet: Dam1 complex polycistronic vector was transformed into BL21 Rosetta (Novagen, Madison, WI). .. The Dam1 complex was purified by affinity chromatography using talon resin, according to the manufacturer’s instructions (BD Biosciences, San Jose, CA).

    Article Title: CONSTANS Imparts DNA Sequence Specificity to the Histone Fold NF-YB/NF-YC Dimer [OPEN]
    Article Snippet: .. CO-6His and co7-6His were expressed in BL21(DE3)Rosetta by IPTG induction (0.4 mM IPTG for 4 h at 25°C) and purified by ion metal affinity chromatography (HisSelect; Sigma-Aldrich) in buffer A (10 mM Tris-HCl, pH 8.0, 400 mM NaCl, 2 mM MgCl2 , and 5 mM imidazole). .. NF-YA2-6His and NF-YA6-6His were produced in BL21(DE3).

    Plasmid Preparation:

    Article Title: Native capillary isoelectric focusing for the separation of protein complex isoforms and subcomplexes
    Article Snippet: .. Dam1 complex polycistronic vector was transformed into BL21 Rosetta (Novagen, Madison, WI). ..

    Article Title: Molecular and immunological characterization of allergens from the entomopathogenic fungus Beauveria bassiana
    Article Snippet: .. E. coli stains TOPO Top10 (Invitrogen, CA) and BL21 Rosetta (DE3), harboring the pRARE plasmid (Novagen, Darmstadt, Germany) were used for routine cloning and protein expression, respectively. ..

    Article Title: Structural hierarchy controlling dimerization and target DNA recognition in the AHR transcriptional complex
    Article Snippet: .. AHR and ARNT were expressed in BL21 (DE3) Rosetta (Novagen) after assembly of their expression cassettes into the same pQlink vector. .. Bacteria was lysed in a buffer containing 25 mM Tris, 500 mM NaCl, 5 mM MgCl2 , 300 mM KCl, 5 mM ATP, 0.5% Triton X-100, and the AHR–ARNT heterodimer was purified over Ni-NTA resin.

    Article Title: A cost-effective protocol for the over-expression and purification of fully-functional and more stable Erwinia chrisanthemi ligand-gated ion channel
    Article Snippet: MBP-ELIC cloned into the pET28 vector was generously provided by Claudio Grosman (University of Illinois at Urbana-Champaign). .. E. coli strains: BL21 DE3 Gold, BL21 DE3 Codon (+), BL21 DE3 Rosetta (Novagen), C41, and C43 (Lucigen) were tested for their ability to express the MBP-ELIC fusion protein in sufficient quantity and quality.

    Article Title: A Forward Genetic Screen Reveals that Calcium-dependent Protein Kinase 3 Regulates Egress in Toxoplasma
    Article Snippet: Cloning and expression of recombinant TgCDPK3recombinant TgCDPK3 Recombinant TgCDPK3 was amplified with Phusion polymerase (New England Biolabs) from the previously published codon optimized expression construct , and cloned into the pET28a vector (Novagen) using the Cold-Fusion enzyme kit (Biocat) with the primers 5′-agcggcctggtgccgcgcggcagcggctgcgtgcacagcaaaaatccgc-3′ and 5′-tggtggtggtggtgctcgagtcagtgtttgacttttacatcatcgcaaattt -3′ to generate a N-HIS-tagged TgCDPK3. .. The proteins were expressed in BL21-Rosetta (DE3)pLysS cells (EMD Chemicals) at 18°C and purified using Ni-NTA agarose according to the manufacturer's protocol.

    Article Title: Single-stranded DNA Scanning and Deamination by APOBEC3G Cytidine Deaminase at Single Molecule Resolution *
    Article Snippet: .. The resulting vector (pPFUe-I48C) was transformed into BL21 Rosetta(DE3) pLysS (Novagen). ..

    Article Title: Activation of an Endoribonuclease by Non-intein Protein Splicing *Activation of an Endoribonuclease by Non-intein Protein Splicing * ♦
    Article Snippet: .. The empty pGex plasmid, GST-RB47 ID, CTD and antigen plasmids were expressed in E. coli Top 10 cells (Invitrogen), while pGex GST-RB47 was expressed in BL21 Rosetta (Novagen) cells to improve expression. .. Expression was induced with 0.5 m m IPTG for 2 h at 20 °C and cells were collected by centrifugation.

    Positron Emission Tomography:

    Article Title: Single-stranded DNA Scanning and Deamination by APOBEC3G Cytidine Deaminase at Single Molecule Resolution *
    Article Snippet: Two rounds of site-directed mutagenesis (QuikChange site-directed mutagenesis kit, Stratagene) of Pfu DNA polymerase expression vector pET-30a-PFU (Dr. Stephen Bell, Cambridge, UK) were performed (D125A, I48C) to make an exo- Pfu suitable for labeling. .. The resulting vector (pPFUe-I48C) was transformed into BL21 Rosetta(DE3) pLysS (Novagen).

    Produced:

    Article Title: CONSTANS Imparts DNA Sequence Specificity to the Histone Fold NF-YB/NF-YC Dimer [OPEN]
    Article Snippet: 6His-NF-YB2 or 6His-NF-YB2E65R/NF-YC3 soluble HFD dimers were produced by coexpression in Escherichia coli BL21(DE3) and purified by ion metal affinity chromatography as described ( ). .. CO-6His and co7-6His were expressed in BL21(DE3)Rosetta by IPTG induction (0.4 mM IPTG for 4 h at 25°C) and purified by ion metal affinity chromatography (HisSelect; Sigma-Aldrich) in buffer A (10 mM Tris-HCl, pH 8.0, 400 mM NaCl, 2 mM MgCl2 , and 5 mM imidazole).

    Concentration Assay:

    Article Title: Single-stranded DNA Scanning and Deamination by APOBEC3G Cytidine Deaminase at Single Molecule Resolution *
    Article Snippet: The resulting vector (pPFUe-I48C) was transformed into BL21 Rosetta(DE3) pLysS (Novagen). .. Isopropyl-1-thio-β- d -galactopyranoside was added (1 m m final concentration), and cells were grown at room temperature (∼25 °C) overnight and then centrifuged at 4 °C (4,000 rpm for 15 min) and resuspended in 25 m m HEPES, pH 7.8, 500 m m NaCl, 5 m m imidazole, 1 m m phenylmethanesulfonyl fluoride, protease inhibitor mixture, 50 mg/ml lysozyme.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore rosetta bl21 de3 e coli cells
    Rosetta Bl21 De3 E Coli Cells, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rosetta bl21 de3 e coli cells/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rosetta bl21 de3 e coli cells - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    Millipore rosetta bl21
    Rosetta Bl21, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rosetta bl21/product/Millipore
    Average 94 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    rosetta bl21 - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    95
    Millipore recombinant expression bl21 rosetta 2 cells
    Recombinant Expression Bl21 Rosetta 2 Cells, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant expression bl21 rosetta 2 cells/product/Millipore
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    recombinant expression bl21 rosetta 2 cells - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    92
    Millipore bl21 de3 plyss rosetta
    Bl21 De3 Plyss Rosetta, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 plyss rosetta/product/Millipore
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 plyss rosetta - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Image Search Results