bl21 de3 condon ril  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85

    Structured Review

    Thermo Fisher bl21 de3 condon ril
    Bl21 De3 Condon Ril, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 condon ril/product/Thermo Fisher
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 condon ril - by Bioz Stars, 2020-04
    85/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Atomic Structure of the Nuclear Pore Complex targeting domain of a Nup116 homologue from the yeast, Candida glabrata
    Article Snippet: Paragraph title: Cloning, expression, and purification of CgNup116(882-1034) ... The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for expression.

    Article Title: Structures of PHR domains from Mus musculus Phr1 (Mycbp2) explain the loss of function mutation (Gly1092- > Glu) of the C. elegans ortholog RPM-1
    Article Snippet: The desired constructs (residues 1213-1390, 1213-1402, 1229-1390, and 1229-1402 of MmPHR1 and 1716-1883, 1716-1898, 1723-1883, and 1723-1898 of MmPHR2) were PCR amplified using appropriate primers and subsequently TOPO® (Invitrogen, USA) cloned into pSGX3, a derivative of pET26 b(+), giving rise to recombinant proteins with non-cleavable C-terminal hexa histidine tags. .. Plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Mass Spectrometry Guided In Situ Proteolysis to Obtain Crystals for X-ray Structure Determination
    Article Snippet: Paragraph title: Cloning, Expression, and Purification of Proteins ... The resulting plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structure of the C-terminal domain of Saccharomyces cerevisiae Nup133, a component of the Nuclear Pore Complex
    Article Snippet: Paragraph title: Cloning, expression, and purification of ScNup133(944-1157) ... Plasmids were transformed into BL21 (DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structure of a putative BenF-like porin from Pseudomonas fluorescens Pf-5 at 2.6 ? resolution
    Article Snippet: Paragraph title: Cloning and expression of PflBenF ... Plasmids were transfected into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structures of the autoproteolytic domain from the Saccharomyces cerevisiae nuclear pore complex component, Nup145
    Article Snippet: Paragraph title: Cloning, expression, and purification of Nup145N(443–605) ... The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Transfection:

    Article Title: Structure of a putative BenF-like porin from Pseudomonas fluorescens Pf-5 at 2.6 ? resolution
    Article Snippet: .. Plasmids were transfected into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. Expression was carried out at 22 °C in 4L of Terrific Broth supplemented with kanamycin (50 μg/ml) and chloramphenicol (35 μg/ml).

    Amplification:

    Article Title: Atomic Structure of the Nuclear Pore Complex targeting domain of a Nup116 homologue from the yeast, Candida glabrata
    Article Snippet: The desired truncation (encoding residues 882-1034) was PCR amplified using GATGGCATTGATGATCTAGAATTTG and CTAATGCATGATCAACAGTGAAGCAG as forward and reverse primers, respectively. .. The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for expression.

    Article Title: Structures of PHR domains from Mus musculus Phr1 (Mycbp2) explain the loss of function mutation (Gly1092- > Glu) of the C. elegans ortholog RPM-1
    Article Snippet: The desired constructs (residues 1213-1390, 1213-1402, 1229-1390, and 1229-1402 of MmPHR1 and 1716-1883, 1716-1898, 1723-1883, and 1723-1898 of MmPHR2) were PCR amplified using appropriate primers and subsequently TOPO® (Invitrogen, USA) cloned into pSGX3, a derivative of pET26 b(+), giving rise to recombinant proteins with non-cleavable C-terminal hexa histidine tags. .. Plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Mass Spectrometry Guided In Situ Proteolysis to Obtain Crystals for X-ray Structure Determination
    Article Snippet: The desired amino acid boundaries were PCR amplified and the purified PCR products were subsequently TOPO® (Invitrogen, USA) cloned into pSGX3, a derivative of pET26b(+), that expresses protein with a non-cleavable C-terminal hexa histidine tag. .. The resulting plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structure of the C-terminal domain of Saccharomyces cerevisiae Nup133, a component of the Nuclear Pore Complex
    Article Snippet: The desired construct was PCR amplified using the forward, AAGTACGGTCATGTAGCATGGA and, reverse, CGTATTCTACAGTGTTGGTTTCATAG, primers and subsequently TOPO® (Invitrogen, USA) cloned into pSGX3, a derivative of pET26 b(+) giving rise to proteins with a non-cleavable C-terminal hexa histidine tag. .. Plasmids were transformed into BL21 (DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structures of the autoproteolytic domain from the Saccharomyces cerevisiae nuclear pore complex component, Nup145
    Article Snippet: The desired truncation (encoding residues 443–605) was PCR amplified using AATAAACAAGACGGCGAAAATAC and CAAAATGATTGACTTTGAAAGTCC as forward and reverse primers, respectively. .. The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Synthesized:

    Article Title: Structures of PHR domains from Mus musculus Phr1 (Mycbp2) explain the loss of function mutation (Gly1092- > Glu) of the C. elegans ortholog RPM-1
    Article Snippet: The DNA template required production of MmPHR1 encoding residues 1213-1402 was designed for codon-optimal expression in E. coli and synthesized (DNA 2.0 Inc., CA, USA). .. Plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Mutagenesis:

    Article Title: Structures of PHR domains from Mus musculus Phr1 (Mycbp2) explain the loss of function mutation (Gly1092- > Glu) of the C. elegans ortholog RPM-1
    Article Snippet: Paragraph title: Structure of the PHR domain explains the loss of function mutation in RPM-1 ... Plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Construct:

    Article Title: Structures of PHR domains from Mus musculus Phr1 (Mycbp2) explain the loss of function mutation (Gly1092- > Glu) of the C. elegans ortholog RPM-1
    Article Snippet: The desired constructs (residues 1213-1390, 1213-1402, 1229-1390, and 1229-1402 of MmPHR1 and 1716-1883, 1716-1898, 1723-1883, and 1723-1898 of MmPHR2) were PCR amplified using appropriate primers and subsequently TOPO® (Invitrogen, USA) cloned into pSGX3, a derivative of pET26 b(+), giving rise to recombinant proteins with non-cleavable C-terminal hexa histidine tags. .. Plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structure of the C-terminal domain of Saccharomyces cerevisiae Nup133, a component of the Nuclear Pore Complex
    Article Snippet: The desired construct was PCR amplified using the forward, AAGTACGGTCATGTAGCATGGA and, reverse, CGTATTCTACAGTGTTGGTTTCATAG, primers and subsequently TOPO® (Invitrogen, USA) cloned into pSGX3, a derivative of pET26 b(+) giving rise to proteins with a non-cleavable C-terminal hexa histidine tag. .. Plasmids were transformed into BL21 (DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Purification:

    Article Title: Atomic Structure of the Nuclear Pore Complex targeting domain of a Nup116 homologue from the yeast, Candida glabrata
    Article Snippet: Paragraph title: Cloning, expression, and purification of CgNup116(882-1034) ... The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for expression.

    Article Title: Structures of PHR domains from Mus musculus Phr1 (Mycbp2) explain the loss of function mutation (Gly1092- > Glu) of the C. elegans ortholog RPM-1
    Article Snippet: Plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. For purification, the E. coli cell pellet was resuspended in 30mL of cold buffer, containing 20mM Tris HCl pH 8.0, 500mM NaCl, 25mM Imidazole, and 0.1% (w/v) Tween20, and cells were lysed with a sonication robot.

    Article Title: Mass Spectrometry Guided In Situ Proteolysis to Obtain Crystals for X-ray Structure Determination
    Article Snippet: Paragraph title: Cloning, Expression, and Purification of Proteins ... The resulting plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structure of the C-terminal domain of Saccharomyces cerevisiae Nup133, a component of the Nuclear Pore Complex
    Article Snippet: Paragraph title: Cloning, expression, and purification of ScNup133(944-1157) ... Plasmids were transformed into BL21 (DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structure of a putative BenF-like porin from Pseudomonas fluorescens Pf-5 at 2.6 ? resolution
    Article Snippet: The purified PCR product was subsequently TOPO® (Invitrogen, USA) cloned into pSGX3, a derivative of pET26b(+), giving rise to a fusion protein with a non-cleavable C-terminal hexa-histidine tag. .. Plasmids were transfected into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structures of the autoproteolytic domain from the Saccharomyces cerevisiae nuclear pore complex component, Nup145
    Article Snippet: Paragraph title: Cloning, expression, and purification of Nup145N(443–605) ... The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Polymerase Chain Reaction:

    Article Title: Atomic Structure of the Nuclear Pore Complex targeting domain of a Nup116 homologue from the yeast, Candida glabrata
    Article Snippet: The purified PCR product was TOPO® (Invitrogen, USA) cloned into pSGX3, a derivative of pET26b(+), yielding a protein with a non-cleavable C-terminal hexa-histidine tag. .. The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for expression.

    Article Title: Structures of PHR domains from Mus musculus Phr1 (Mycbp2) explain the loss of function mutation (Gly1092- > Glu) of the C. elegans ortholog RPM-1
    Article Snippet: The desired constructs (residues 1213-1390, 1213-1402, 1229-1390, and 1229-1402 of MmPHR1 and 1716-1883, 1716-1898, 1723-1883, and 1723-1898 of MmPHR2) were PCR amplified using appropriate primers and subsequently TOPO® (Invitrogen, USA) cloned into pSGX3, a derivative of pET26 b(+), giving rise to recombinant proteins with non-cleavable C-terminal hexa histidine tags. .. Plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Mass Spectrometry Guided In Situ Proteolysis to Obtain Crystals for X-ray Structure Determination
    Article Snippet: The desired amino acid boundaries were PCR amplified and the purified PCR products were subsequently TOPO® (Invitrogen, USA) cloned into pSGX3, a derivative of pET26b(+), that expresses protein with a non-cleavable C-terminal hexa histidine tag. .. The resulting plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structure of the C-terminal domain of Saccharomyces cerevisiae Nup133, a component of the Nuclear Pore Complex
    Article Snippet: The desired construct was PCR amplified using the forward, AAGTACGGTCATGTAGCATGGA and, reverse, CGTATTCTACAGTGTTGGTTTCATAG, primers and subsequently TOPO® (Invitrogen, USA) cloned into pSGX3, a derivative of pET26 b(+) giving rise to proteins with a non-cleavable C-terminal hexa histidine tag. .. Plasmids were transformed into BL21 (DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structure of a putative BenF-like porin from Pseudomonas fluorescens Pf-5 at 2.6 ? resolution
    Article Snippet: The purified PCR product was subsequently TOPO® (Invitrogen, USA) cloned into pSGX3, a derivative of pET26b(+), giving rise to a fusion protein with a non-cleavable C-terminal hexa-histidine tag. .. Plasmids were transfected into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structures of the autoproteolytic domain from the Saccharomyces cerevisiae nuclear pore complex component, Nup145
    Article Snippet: The purified PCR product was subsequently TOPO®(Invitrogen, USA) cloned into pSGX3, a derivative of pET26b(+), giving rise to a protein with a non-cleavable C-terminal hexa-histidine tag. .. The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Labeling:

    Article Title: Structure of the C-terminal domain of Saccharomyces cerevisiae Nup133, a component of the Nuclear Pore Complex
    Article Snippet: Plasmids were transformed into BL21 (DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. Expression of selenomethionine labeled proteins was carried out in 3L of HY media at 22 °C with 50 μg/ml of kanamycin and 35 μg/ml of chloramphenicol.

    Expressing:

    Article Title: Atomic Structure of the Nuclear Pore Complex targeting domain of a Nup116 homologue from the yeast, Candida glabrata
    Article Snippet: .. The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for expression. ..

    Article Title: Structures of PHR domains from Mus musculus Phr1 (Mycbp2) explain the loss of function mutation (Gly1092- > Glu) of the C. elegans ortholog RPM-1
    Article Snippet: The DNA template required production of MmPHR1 encoding residues 1213-1402 was designed for codon-optimal expression in E. coli and synthesized (DNA 2.0 Inc., CA, USA). .. Plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Mass Spectrometry Guided In Situ Proteolysis to Obtain Crystals for X-ray Structure Determination
    Article Snippet: Paragraph title: Cloning, Expression, and Purification of Proteins ... The resulting plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structure of the C-terminal domain of Saccharomyces cerevisiae Nup133, a component of the Nuclear Pore Complex
    Article Snippet: Paragraph title: Cloning, expression, and purification of ScNup133(944-1157) ... Plasmids were transformed into BL21 (DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structure of a putative BenF-like porin from Pseudomonas fluorescens Pf-5 at 2.6 ? resolution
    Article Snippet: Paragraph title: Cloning and expression of PflBenF ... Plasmids were transfected into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Article Title: Structures of the autoproteolytic domain from the Saccharomyces cerevisiae nuclear pore complex component, Nup145
    Article Snippet: Paragraph title: Cloning, expression, and purification of Nup145N(443–605) ... The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Sequencing:

    Article Title: Structures of PHR domains from Mus musculus Phr1 (Mycbp2) explain the loss of function mutation (Gly1092- > Glu) of the C. elegans ortholog RPM-1
    Article Snippet: Sequence numbering is based on Genbank (geneID: 105689). .. Plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Sonication:

    Article Title: Atomic Structure of the Nuclear Pore Complex targeting domain of a Nup116 homologue from the yeast, Candida glabrata
    Article Snippet: The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for expression. .. For purification, the E. coli cell pellet was resuspended in 30mL of cold buffer containing 20mM Tris HCl p H 8.0, 500mM NaCl, 25mM imidazole, and 0.1% (v/v) Tween20 and the cells were lysed by sonication.

    Article Title: Structures of PHR domains from Mus musculus Phr1 (Mycbp2) explain the loss of function mutation (Gly1092- > Glu) of the C. elegans ortholog RPM-1
    Article Snippet: Plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. For purification, the E. coli cell pellet was resuspended in 30mL of cold buffer, containing 20mM Tris HCl pH 8.0, 500mM NaCl, 25mM Imidazole, and 0.1% (w/v) Tween20, and cells were lysed with a sonication robot.

    Article Title: Mass Spectrometry Guided In Situ Proteolysis to Obtain Crystals for X-ray Structure Determination
    Article Snippet: The resulting plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. For purification, the E. coli cell pellets were resuspended in cold buffer (20mM Tris HCl pH 8.0, 500mM NaCl, 25mM imidazole, and 0.1% (v/v) Tween20) and were lysed via sonication.

    Article Title: Structure of the C-terminal domain of Saccharomyces cerevisiae Nup133, a component of the Nuclear Pore Complex
    Article Snippet: Plasmids were transformed into BL21 (DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. For purification, the E. coli cell pellet was resuspended in 30mL of cold buffer containing 20mM Tris HCl pH 8.0, 500mM NaCl, 25mM Imidazole and 0.1% Tween20 and cells were lysed by sonication.

    Article Title: Structures of the autoproteolytic domain from the Saccharomyces cerevisiae nuclear pore complex component, Nup145
    Article Snippet: The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. For purification, the E. coli cell pellet was resuspended in 30mL of cold buffer containing 20 mM Tris HCl pH 8.0, 500 mM NaCl, 25 mM imidazole, and 0.1% (v/v) Tween20 and cells were lysed via sonication.

    Transformation Assay:

    Article Title: Atomic Structure of the Nuclear Pore Complex targeting domain of a Nup116 homologue from the yeast, Candida glabrata
    Article Snippet: .. The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for expression. ..

    Article Title: Structures of PHR domains from Mus musculus Phr1 (Mycbp2) explain the loss of function mutation (Gly1092- > Glu) of the C. elegans ortholog RPM-1
    Article Snippet: .. Plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. Expression of Se-Met proteins was carried out in 1L of HY media, containing 50μg/ml of kanamycin and 35μg/ml of chloramphenicol, at 22°C with IPTG induction.

    Article Title: Mass Spectrometry Guided In Situ Proteolysis to Obtain Crystals for X-ray Structure Determination
    Article Snippet: .. The resulting plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. Se-Met protein production was carried out at 22°C in 1L of High Yield (HY) media (Orion Enterprises, Inc, Northbrook, IL) containing 50μg/mL of kanamycin and 35μg/mL of chloramphenicol.

    Article Title: Structure of the C-terminal domain of Saccharomyces cerevisiae Nup133, a component of the Nuclear Pore Complex
    Article Snippet: .. Plasmids were transformed into BL21 (DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. Expression of selenomethionine labeled proteins was carried out in 3L of HY media at 22 °C with 50 μg/ml of kanamycin and 35 μg/ml of chloramphenicol.

    Article Title: Structures of the autoproteolytic domain from the Saccharomyces cerevisiae nuclear pore complex component, Nup145
    Article Snippet: .. The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. ..

    Recombinant:

    Article Title: Structures of PHR domains from Mus musculus Phr1 (Mycbp2) explain the loss of function mutation (Gly1092- > Glu) of the C. elegans ortholog RPM-1
    Article Snippet: The desired constructs (residues 1213-1390, 1213-1402, 1229-1390, and 1229-1402 of MmPHR1 and 1716-1883, 1716-1898, 1723-1883, and 1723-1898 of MmPHR2) were PCR amplified using appropriate primers and subsequently TOPO® (Invitrogen, USA) cloned into pSGX3, a derivative of pET26 b(+), giving rise to recombinant proteins with non-cleavable C-terminal hexa histidine tags. .. Plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression.

    Over Expression:

    Article Title: Structures of PHR domains from Mus musculus Phr1 (Mycbp2) explain the loss of function mutation (Gly1092- > Glu) of the C. elegans ortholog RPM-1
    Article Snippet: .. Plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. Expression of Se-Met proteins was carried out in 1L of HY media, containing 50μg/ml of kanamycin and 35μg/ml of chloramphenicol, at 22°C with IPTG induction.

    Article Title: Mass Spectrometry Guided In Situ Proteolysis to Obtain Crystals for X-ray Structure Determination
    Article Snippet: .. The resulting plasmids were transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. Se-Met protein production was carried out at 22°C in 1L of High Yield (HY) media (Orion Enterprises, Inc, Northbrook, IL) containing 50μg/mL of kanamycin and 35μg/mL of chloramphenicol.

    Article Title: Structure of the C-terminal domain of Saccharomyces cerevisiae Nup133, a component of the Nuclear Pore Complex
    Article Snippet: .. Plasmids were transformed into BL21 (DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. Expression of selenomethionine labeled proteins was carried out in 3L of HY media at 22 °C with 50 μg/ml of kanamycin and 35 μg/ml of chloramphenicol.

    Article Title: Structure of a putative BenF-like porin from Pseudomonas fluorescens Pf-5 at 2.6 ? resolution
    Article Snippet: .. Plasmids were transfected into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. .. Expression was carried out at 22 °C in 4L of Terrific Broth supplemented with kanamycin (50 μg/ml) and chloramphenicol (35 μg/ml).

    Article Title: Structures of the autoproteolytic domain from the Saccharomyces cerevisiae nuclear pore complex component, Nup145
    Article Snippet: .. The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. ..

    Plasmid Preparation:

    Article Title: Atomic Structure of the Nuclear Pore Complex targeting domain of a Nup116 homologue from the yeast, Candida glabrata
    Article Snippet: .. The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for expression. ..

    Article Title: Structures of the autoproteolytic domain from the Saccharomyces cerevisiae nuclear pore complex component, Nup145
    Article Snippet: .. The resulting plasmid was transformed into BL21(DE3)-Condon+RIL (Invitrogen, USA) cells for overexpression. ..