bl21 de3 competent cells  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    One Shot BL21 DE3 Chemically Competent E coli
    Description:
    One Shot BL21 DE3 Chemically Competent E coli are ideal for use with bacteriophage T7 promoter based expression systems e g pRSET pCR T7 and pET BL21 DE3 cells carry the lambda DE3 lysogen Recombinant proteins that are nontoxic to E coli are generally expressed at higher levels in BL21 DE3 cells than in BL21 DE3 pLysS or BL21 DE3 pLysE However the basal expression levels of heterologous genes are significantly higher in BL21 DE3 than in BL21 DE3 pLysS or BL21 DE3 pLysE About BL21 strainsBL21 strains are descended from the E coli B strain and have been specifically constructed for high level expression of recombinant proteins These strains have two important attributes that make them ideal for protein expression key genetic markers and inducibility of protein expression The most important genetic markers help recombinant RNA and or protein accumulate to high levels without degradation Inducibility helps to minimize the toxic effects of some recombinant proteins
    Catalog Number:
    c600003
    Price:
    None
    Applications:
    Bacterial Expression|Competent Cells for Bacterial Expression|Protein Biology|Protein Expression
    Category:
    Competent Cells Strains
    Buy from Supplier


    Structured Review

    Thermo Fisher bl21 de3 competent cells
    One Shot BL21 DE3 Chemically Competent E coli are ideal for use with bacteriophage T7 promoter based expression systems e g pRSET pCR T7 and pET BL21 DE3 cells carry the lambda DE3 lysogen Recombinant proteins that are nontoxic to E coli are generally expressed at higher levels in BL21 DE3 cells than in BL21 DE3 pLysS or BL21 DE3 pLysE However the basal expression levels of heterologous genes are significantly higher in BL21 DE3 than in BL21 DE3 pLysS or BL21 DE3 pLysE About BL21 strainsBL21 strains are descended from the E coli B strain and have been specifically constructed for high level expression of recombinant proteins These strains have two important attributes that make them ideal for protein expression key genetic markers and inducibility of protein expression The most important genetic markers help recombinant RNA and or protein accumulate to high levels without degradation Inducibility helps to minimize the toxic effects of some recombinant proteins
    https://www.bioz.com/result/bl21 de3 competent cells/product/Thermo Fisher
    Average 99 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 competent cells - by Bioz Stars, 2020-09
    99/100 stars

    Images

    Related Articles

    Transduction:

    Article Title: Protein prenylation restrains innate immunity by inhibiting Rac1 effector interactions
    Article Snippet: .. Generating RhoGDI1-knockout macrophages Recombinant CAS9 was purified from BL21 Escherichia coli (C600003, ThermoFisher Scientific) transduced with a plasmid encoding Streptococcus pyogenes CAS9 (gift from Niels Geijsen, Addgene plasmid #62731). .. Synthesized crRNA:tracrRNA (Integrated DNA Technologies) targeting mouse Arghdia exon 2 (sg1: CAGAUAGCUGCAGAGAAUG, sg2: CUGCGCAAGCUGCUCAGCAG; retrieved from benchling.com ) were preincubated with CAS9 in PBS for 10 min to create readily transfectable ribonucleic proteins (RNP).

    Clone Assay:

    Article Title: Paracoccidioides HSP90 can be found in the cell surface and is a target for antibodies with therapeutic potential
    Article Snippet: .. Cell lines, fungal strains and growth conditions Escherichia coli strain DH5α was used for intermediate cloning steps and BL21 DE3, for protein expression. .. The human monocyte cell line THP-1 was cultured in Roswell Park Memorial Institute (RPMI) 1640 medium, and the Human embryonic kidney (HEK293) cells (Gibco) in Freestyle F17 expression medium (Gibco).

    In Vitro:

    Article Title: Regulation of folate and methionine metabolism by multisite phosphorylation of human methylenetetrahydrofolate reductase
    Article Snippet: .. DYRK1A protein purification and In vitro kinase assay For DYRK1A protein expression, One-shot E.coli BL21(DE3) (Invitrogen) was transformed with DYRK1A-pNIC28 vector (Addgene, Cat# 38913). .. The bacteria were grown at 37 °C in 2xYT medium containing 100 μg/ml Carbenicillin until A600nm reached ~0.6, cooled down to room temperature, followed by 0.5 mM IPTG induction of protein expression at room temperature for 16 hours.

    Cell Culture:

    Article Title: Toxicity of Recombinant Necrosis and Ethylene-Inducing Proteins (NLPs) from Neofusicoccum parvum
    Article Snippet: .. Recombinant plasmids were extracted from positive transformants and confirmed by sequencing and propagated in BL21 (DE3) One Shot® Chemically Competent E. coli (Invitrogen, Carlsbad, CA, USA) cultured in LB broth supplemented with 50 µg/mL kanamycin. .. Protein expression was induced with 1 mM isopropyl-1-thio-b-D-galactopyranoside (IPTG), producing proteins with his-tags.

    Purification:

    Article Title: Functional recruitment of dynamin requires multimeric interactions for efficient endocytosis
    Article Snippet: .. The biotinylated SUMO-amphSH3 fusion was produced in BL21 (DE3) (source ThermoFisher Scientific, C600003) E. coli cells in presence of a plasmid encoding for BirA in a pACYC-Duet-1 vector and biotin (50 µM) by auto-induction at 16 °C and purified as above. .. Proteins were stored at −80 °C in SPR running buffer until use.

    Article Title: Protein prenylation restrains innate immunity by inhibiting Rac1 effector interactions
    Article Snippet: .. Generating RhoGDI1-knockout macrophages Recombinant CAS9 was purified from BL21 Escherichia coli (C600003, ThermoFisher Scientific) transduced with a plasmid encoding Streptococcus pyogenes CAS9 (gift from Niels Geijsen, Addgene plasmid #62731). .. Synthesized crRNA:tracrRNA (Integrated DNA Technologies) targeting mouse Arghdia exon 2 (sg1: CAGAUAGCUGCAGAGAAUG, sg2: CUGCGCAAGCUGCUCAGCAG; retrieved from benchling.com ) were preincubated with CAS9 in PBS for 10 min to create readily transfectable ribonucleic proteins (RNP).

    Protein Purification:

    Article Title: Regulation of folate and methionine metabolism by multisite phosphorylation of human methylenetetrahydrofolate reductase
    Article Snippet: .. DYRK1A protein purification and In vitro kinase assay For DYRK1A protein expression, One-shot E.coli BL21(DE3) (Invitrogen) was transformed with DYRK1A-pNIC28 vector (Addgene, Cat# 38913). .. The bacteria were grown at 37 °C in 2xYT medium containing 100 μg/ml Carbenicillin until A600nm reached ~0.6, cooled down to room temperature, followed by 0.5 mM IPTG induction of protein expression at room temperature for 16 hours.

    Construct:

    Article Title: Activation of nuclear factor ?B in colonic mucosa from patients with collagenous and ulcerative colitis
    Article Snippet: .. Fusion protein was made by transforming One Shot BL21(DE3) cells (Invitrogen, Paisley, UK) with each construct and an overnight culture in 5 ml of LB broth medium with 100 μg/ml ampicillin was performed. .. Next day, 1 ml of each overnight culture was inoculated into 100 ml LB broth medium with 100 μg/ml ampicillin and allowed to grow to an OD600 of 0.6–0.8, before protein expression was induced by adding isopropylthio-b- d -galactoside to a final concentration of 0.4 mM.

    Expressing:

    Article Title: Regulation of folate and methionine metabolism by multisite phosphorylation of human methylenetetrahydrofolate reductase
    Article Snippet: .. DYRK1A protein purification and In vitro kinase assay For DYRK1A protein expression, One-shot E.coli BL21(DE3) (Invitrogen) was transformed with DYRK1A-pNIC28 vector (Addgene, Cat# 38913). .. The bacteria were grown at 37 °C in 2xYT medium containing 100 μg/ml Carbenicillin until A600nm reached ~0.6, cooled down to room temperature, followed by 0.5 mM IPTG induction of protein expression at room temperature for 16 hours.

    Article Title: Paracoccidioides HSP90 can be found in the cell surface and is a target for antibodies with therapeutic potential
    Article Snippet: .. Cell lines, fungal strains and growth conditions Escherichia coli strain DH5α was used for intermediate cloning steps and BL21 DE3, for protein expression. .. The human monocyte cell line THP-1 was cultured in Roswell Park Memorial Institute (RPMI) 1640 medium, and the Human embryonic kidney (HEK293) cells (Gibco) in Freestyle F17 expression medium (Gibco).

    Sequencing:

    Article Title: Toxicity of Recombinant Necrosis and Ethylene-Inducing Proteins (NLPs) from Neofusicoccum parvum
    Article Snippet: .. Recombinant plasmids were extracted from positive transformants and confirmed by sequencing and propagated in BL21 (DE3) One Shot® Chemically Competent E. coli (Invitrogen, Carlsbad, CA, USA) cultured in LB broth supplemented with 50 µg/mL kanamycin. .. Protein expression was induced with 1 mM isopropyl-1-thio-b-D-galactopyranoside (IPTG), producing proteins with his-tags.

    Produced:

    Article Title: Functional recruitment of dynamin requires multimeric interactions for efficient endocytosis
    Article Snippet: .. The biotinylated SUMO-amphSH3 fusion was produced in BL21 (DE3) (source ThermoFisher Scientific, C600003) E. coli cells in presence of a plasmid encoding for BirA in a pACYC-Duet-1 vector and biotin (50 µM) by auto-induction at 16 °C and purified as above. .. Proteins were stored at −80 °C in SPR running buffer until use.

    Kinase Assay:

    Article Title: Regulation of folate and methionine metabolism by multisite phosphorylation of human methylenetetrahydrofolate reductase
    Article Snippet: .. DYRK1A protein purification and In vitro kinase assay For DYRK1A protein expression, One-shot E.coli BL21(DE3) (Invitrogen) was transformed with DYRK1A-pNIC28 vector (Addgene, Cat# 38913). .. The bacteria were grown at 37 °C in 2xYT medium containing 100 μg/ml Carbenicillin until A600nm reached ~0.6, cooled down to room temperature, followed by 0.5 mM IPTG induction of protein expression at room temperature for 16 hours.

    Recombinant:

    Article Title: Functional Assessment of Residues in the Amino- and Carboxyl-Termini of Crustacean Hyperglycemic Hormone (CHH) in the Mud Crab Scylla olivacea Using Point-Mutated Peptides
    Article Snippet: .. Briefly, the recombinant plasmids, Sco-CHH-Gly/pET-22b(+), and I2A, F3A, D4A, D12A, R13A, Q51A, E54A, D60A, I69A, V72A Sco-CHH-Gly/pET-22b(+), were used to transform competent One Shot BL21(DE3) E . coli cells (Invitrogen). .. The transformed cells were grown in ampicillin-containing (100 μg/ml) LB medium and induced by 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG); 4 h after induction, cells were harvested, disrupted, and centrifuged using established protocols as previously described [ ].

    Article Title: Toxicity of Recombinant Necrosis and Ethylene-Inducing Proteins (NLPs) from Neofusicoccum parvum
    Article Snippet: .. Recombinant plasmids were extracted from positive transformants and confirmed by sequencing and propagated in BL21 (DE3) One Shot® Chemically Competent E. coli (Invitrogen, Carlsbad, CA, USA) cultured in LB broth supplemented with 50 µg/mL kanamycin. .. Protein expression was induced with 1 mM isopropyl-1-thio-b-D-galactopyranoside (IPTG), producing proteins with his-tags.

    Article Title: Protein prenylation restrains innate immunity by inhibiting Rac1 effector interactions
    Article Snippet: .. Generating RhoGDI1-knockout macrophages Recombinant CAS9 was purified from BL21 Escherichia coli (C600003, ThermoFisher Scientific) transduced with a plasmid encoding Streptococcus pyogenes CAS9 (gift from Niels Geijsen, Addgene plasmid #62731). .. Synthesized crRNA:tracrRNA (Integrated DNA Technologies) targeting mouse Arghdia exon 2 (sg1: CAGAUAGCUGCAGAGAAUG, sg2: CUGCGCAAGCUGCUCAGCAG; retrieved from benchling.com ) were preincubated with CAS9 in PBS for 10 min to create readily transfectable ribonucleic proteins (RNP).

    Transformation Assay:

    Article Title: Regulation of folate and methionine metabolism by multisite phosphorylation of human methylenetetrahydrofolate reductase
    Article Snippet: .. DYRK1A protein purification and In vitro kinase assay For DYRK1A protein expression, One-shot E.coli BL21(DE3) (Invitrogen) was transformed with DYRK1A-pNIC28 vector (Addgene, Cat# 38913). .. The bacteria were grown at 37 °C in 2xYT medium containing 100 μg/ml Carbenicillin until A600nm reached ~0.6, cooled down to room temperature, followed by 0.5 mM IPTG induction of protein expression at room temperature for 16 hours.

    Plasmid Preparation:

    Article Title: Regulation of folate and methionine metabolism by multisite phosphorylation of human methylenetetrahydrofolate reductase
    Article Snippet: .. DYRK1A protein purification and In vitro kinase assay For DYRK1A protein expression, One-shot E.coli BL21(DE3) (Invitrogen) was transformed with DYRK1A-pNIC28 vector (Addgene, Cat# 38913). .. The bacteria were grown at 37 °C in 2xYT medium containing 100 μg/ml Carbenicillin until A600nm reached ~0.6, cooled down to room temperature, followed by 0.5 mM IPTG induction of protein expression at room temperature for 16 hours.

    Article Title: Functional recruitment of dynamin requires multimeric interactions for efficient endocytosis
    Article Snippet: .. The biotinylated SUMO-amphSH3 fusion was produced in BL21 (DE3) (source ThermoFisher Scientific, C600003) E. coli cells in presence of a plasmid encoding for BirA in a pACYC-Duet-1 vector and biotin (50 µM) by auto-induction at 16 °C and purified as above. .. Proteins were stored at −80 °C in SPR running buffer until use.

    Article Title: Protein prenylation restrains innate immunity by inhibiting Rac1 effector interactions
    Article Snippet: .. Generating RhoGDI1-knockout macrophages Recombinant CAS9 was purified from BL21 Escherichia coli (C600003, ThermoFisher Scientific) transduced with a plasmid encoding Streptococcus pyogenes CAS9 (gift from Niels Geijsen, Addgene plasmid #62731). .. Synthesized crRNA:tracrRNA (Integrated DNA Technologies) targeting mouse Arghdia exon 2 (sg1: CAGAUAGCUGCAGAGAAUG, sg2: CUGCGCAAGCUGCUCAGCAG; retrieved from benchling.com ) were preincubated with CAS9 in PBS for 10 min to create readily transfectable ribonucleic proteins (RNP).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 84
    Thermo Fisher purification competent bl21 star de3 e coli cells
    Purification Competent Bl21 Star De3 E Coli Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/purification competent bl21 star de3 e coli cells/product/Thermo Fisher
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    purification competent bl21 star de3 e coli cells - by Bioz Stars, 2020-09
    84/100 stars
      Buy from Supplier

    94
    Thermo Fisher bl21
    Bl21, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 437 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21/product/Thermo Fisher
    Average 94 stars, based on 437 article reviews
    Price from $9.99 to $1999.99
    bl21 - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    86
    Thermo Fisher electro competent e coli bl21 star de3 cells
    Electro Competent E Coli Bl21 Star De3 Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/electro competent e coli bl21 star de3 cells/product/Thermo Fisher
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    electro competent e coli bl21 star de3 cells - by Bioz Stars, 2020-09
    86/100 stars
      Buy from Supplier

    91
    Thermo Fisher bl21 de3 star competent e coli cells
    Bl21 De3 Star Competent E Coli Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 star competent e coli cells/product/Thermo Fisher
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 star competent e coli cells - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    Image Search Results