bl21 de3 competent cells  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BL21 DE3 Electrocompetent Cells
    Description:
    The BL21 DE3 Electrocompetent Cells are the first to offer high efficiency cloning and high level protein expression in the same cell Cloning efficiencies are increased 25 1 000 fold relative to other preparations of BL21 cells which is essential for construction of complex expression libraries
    Catalog Number:
    cmc0016
    Price:
    None
    Buy from Supplier


    Structured Review

    Millipore bl21 de3 competent cells
    BL21 DE3 Electrocompetent Cells
    The BL21 DE3 Electrocompetent Cells are the first to offer high efficiency cloning and high level protein expression in the same cell Cloning efficiencies are increased 25 1 000 fold relative to other preparations of BL21 cells which is essential for construction of complex expression libraries
    https://www.bioz.com/result/bl21 de3 competent cells/product/Millipore
    Average 99 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 competent cells - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion
    Article Snippet: Two DNA fragments encoding the N-terminal regions of mouse ABCG5 (residues 2–375) and ABCG8 (residues 2–400) were PCR-amplified from the ABCG5 and ABCG8 cDNAs and cloned into the pET30a(+) vector (Novagen). .. The constructs were used to transform BL21 (DE3) competent cells (Novagen), and the peptides expressed were purified by using the QIAexpressionist procedure with nickel-nitrilotriacetic acid columns in 8 M urea (Qiagen, Valencia, CA).

    Article Title: Genetic and Biochemical Characterization of a 2,4,6-Trichlorophenol Degradation Pathway in Ralstonia eutropha JMP134
    Article Snippet: DNA sequencing of pTcpA was performed to confirm the cloned tcpA gene did not have any point mutation resulted from PCR amplification. .. Electrocompetent E. coli BL21(DE3) cells (Novagen) were transformed by pTcpA.

    Article Title: Vaccine Induced Antibodies to the First Variable Loop of Human Immunodeficiency Virus Type 1 gp120, Mediate Antibody-Dependent Virus Inhibition in Macaques
    Article Snippet: .. BL21 (DE3) competent cells (EMD Biosciences) were transformed with pET26 HIV89.6 tev and the tev sequence of clones were confirmed by DNA sequence analysis. ..

    Article Title: Osteoinductive LIM Mineralization Protein-1 Suppresses Activation of NF-?B and Selectively Regulates MAPK Pathways in Pre-osteoclasts
    Article Snippet: .. BL21 (DE3) competent cells (Novagen, Madison, WI) were transformed with plasmid by standard methods, and the correct clones were confirmed by restriction analysis followed by DNA sequencing. .. The recombinant LMP-1 and LMP-2 proteins were purified by size exclusion chromatography followed by metal affinity chromatography.

    Centrifugation:

    Article Title: Vaccine Induced Antibodies to the First Variable Loop of Human Immunodeficiency Virus Type 1 gp120, Mediate Antibody-Dependent Virus Inhibition in Macaques
    Article Snippet: BL21 (DE3) competent cells (EMD Biosciences) were transformed with pET26 HIV89.6 tev and the tev sequence of clones were confirmed by DNA sequence analysis. .. Cells were harvested by centrifugation and lysed in 40 ml of a PBS-based buffer containing 0.5 M sodium chloride, 10 mM ascorbic acid, 50 mM mannitol, 2.5 % glycerol, 0.5 % Triton-X-100, protease inhibitor cocktail, 50 μg/ml lysozyme, 1 μl/ml benzonase nuclease (EMD Biosciences), and 5 mM DTT.

    Amplification:

    Article Title: Genetic and Biochemical Characterization of a 2,4,6-Trichlorophenol Degradation Pathway in Ralstonia eutropha JMP134
    Article Snippet: DNA sequencing of pTcpA was performed to confirm the cloned tcpA gene did not have any point mutation resulted from PCR amplification. .. Electrocompetent E. coli BL21(DE3) cells (Novagen) were transformed by pTcpA.

    Article Title: Vaccine Induced Antibodies to the First Variable Loop of Human Immunodeficiency Virus Type 1 gp120, Mediate Antibody-Dependent Virus Inhibition in Macaques
    Article Snippet: The HIV89.6 tev gene was amplified from the pPCR-Script Amp SK vector containing the synthetic HIV89.6 tev gene using the following primers: HIV89.6 tev 5’ Nde (acttag catatg gaacctgtgaaccctagcctgga) containing the Nde I site and HIV89.6 tev 3’ Xho (ctaagt ctcgag ttactccttggtgccaggttc) containing the Xho I site. .. BL21 (DE3) competent cells (EMD Biosciences) were transformed with pET26 HIV89.6 tev and the tev sequence of clones were confirmed by DNA sequence analysis.

    Filtration:

    Article Title:
    Article Snippet: .. Unlabeled and uniformly 15 N-labeled human gal-1 was expressed in BL21(DE3)-competent cells (Novagen; Millipore, Billerica, MA), grown in standard enriched media or in minimal media with 15 N-ammonium chloride for 15 N labeling, purified over a B lactose affinity column, and further fractionated on a gel filtration column, as described previously by . .. Typically, 200 mg (unlabeled) or 44 mg (15 N-enriched) of purified protein were obtained from 1 l of cell culture.

    Synthesized:

    Article Title: Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr97 → Ile and Pro101 → Ser in 5-Enolpyruvylshikimate-3-phosphate Synthase from Escherichia coli
    Article Snippet: S3P was synthesized and purified as described previously ( ). .. The single mutant T97I and double mutant TIPS EPSPS enzymes were overexpressed in BL21(DE3)-competent cells (Novagen) and purified as previously described ( ).

    Article Title: Epigenetic inactivation of inhibitor of differentiation 4 (Id4) correlates with prostate cancer
    Article Snippet: GST-Id4 purification Glutathione S-transferase (pReceiver-B04) fused in frame to protein coding region of human Id4 (GST-Id4) plasmid was custom synthesized by Genecopoeia. .. Plasmid was transformed into BL21 (DE3) competent cells (Novagen, Darmstadt, Germany).

    Construct:

    Article Title: Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion
    Article Snippet: .. The constructs were used to transform BL21 (DE3) competent cells (Novagen), and the peptides expressed were purified by using the QIAexpressionist procedure with nickel-nitrilotriacetic acid columns in 8 M urea (Qiagen, Valencia, CA). .. Hepatic triglyceride levels were measured by using Infinity triglycerides reagent (catalog no. 343-500P; Sigma–Aldrich).

    Article Title: Osteoinductive LIM Mineralization Protein-1 Suppresses Activation of NF-?B and Selectively Regulates MAPK Pathways in Pre-osteoclasts
    Article Snippet: To facilitate cellular entry of LMP-1, we prepared a cDNA construct containing an N-terminal HIV-TAT derived cationic peptide tag. .. BL21 (DE3) competent cells (Novagen, Madison, WI) were transformed with plasmid by standard methods, and the correct clones were confirmed by restriction analysis followed by DNA sequencing.

    Incubation:

    Article Title: Structural Tuning of the Fluorescent Protein iLOV for Improved Photostability *
    Article Snippet: .. Ligation reactions were transformed into electrocompetent BL21(DE3) E. coli (Novagen), plated on LB-agar containing 100 μg/ml ampicillin (Sigma) and 100 μ m isopropyl β- d -1-thiogalactopyranoside (Roche Applied Science), and incubated in darkness at 30 °C for 24 h, as described ( ). .. LOV-associated fluorescence was visualized with a Blak-Ray lamp (UVP, LLC).

    Activity Assay:

    Article Title:
    Article Snippet: Unlabeled and uniformly 15 N-labeled human gal-1 was expressed in BL21(DE3)-competent cells (Novagen; Millipore, Billerica, MA), grown in standard enriched media or in minimal media with 15 N-ammonium chloride for 15 N labeling, purified over a B lactose affinity column, and further fractionated on a gel filtration column, as described previously by . .. Functional activity of the purified protein was assessed by a T cell death assay.

    Expressing:

    Article Title: Genetic and Biochemical Characterization of a 2,4,6-Trichlorophenol Degradation Pathway in Ralstonia eutropha JMP134
    Article Snippet: Paragraph title: Expression of tcpA in E. coli and purification of recombinant TcpA. ... Electrocompetent E. coli BL21(DE3) cells (Novagen) were transformed by pTcpA.

    Article Title: Vaccine Induced Antibodies to the First Variable Loop of Human Immunodeficiency Virus Type 1 gp120, Mediate Antibody-Dependent Virus Inhibition in Macaques
    Article Snippet: The resulting pET26 HIV89.6 tev plasmid is kanamycin resistant, and the expression of tev is under control of the IPTG-inducible T7 lac promoter. .. BL21 (DE3) competent cells (EMD Biosciences) were transformed with pET26 HIV89.6 tev and the tev sequence of clones were confirmed by DNA sequence analysis.

    Article Title: Epigenetic inactivation of inhibitor of differentiation 4 (Id4) correlates with prostate cancer
    Article Snippet: Plasmid was transformed into BL21 (DE3) competent cells (Novagen, Darmstadt, Germany). .. Protein expression in freshly grown cultures at 37°C was induced by 1 mM IPTG at 30°C.

    Modification:

    Article Title: Phosphoproteomic Analysis Reveals the Effects of PilF Phosphorylation on Type IV Pilus and Biofilm Formation in Thermus thermophilus HB27 *
    Article Snippet: Wild-type PilF and its mutant versions were expressed in the host strain T. thermophilus HB27, grown under aerobic conditions at 70 °C in Thermus modified (TM) medium ( ). .. E. coli DH5α and BL21 (DE3) competent cells (Novagen, Madison, WI) were used as hosts for genetic manipulations of plasmids and for the overexpression of proteins, respectively.

    Transformation Assay:

    Article Title: Genetic and Biochemical Characterization of a 2,4,6-Trichlorophenol Degradation Pathway in Ralstonia eutropha JMP134
    Article Snippet: .. Electrocompetent E. coli BL21(DE3) cells (Novagen) were transformed by pTcpA. ..

    Article Title: Vaccine Induced Antibodies to the First Variable Loop of Human Immunodeficiency Virus Type 1 gp120, Mediate Antibody-Dependent Virus Inhibition in Macaques
    Article Snippet: .. BL21 (DE3) competent cells (EMD Biosciences) were transformed with pET26 HIV89.6 tev and the tev sequence of clones were confirmed by DNA sequence analysis. ..

    Article Title: Epigenetic inactivation of inhibitor of differentiation 4 (Id4) correlates with prostate cancer
    Article Snippet: .. Plasmid was transformed into BL21 (DE3) competent cells (Novagen, Darmstadt, Germany). .. Protein expression in freshly grown cultures at 37°C was induced by 1 mM IPTG at 30°C.

    Article Title: Osteoinductive LIM Mineralization Protein-1 Suppresses Activation of NF-?B and Selectively Regulates MAPK Pathways in Pre-osteoclasts
    Article Snippet: .. BL21 (DE3) competent cells (Novagen, Madison, WI) were transformed with plasmid by standard methods, and the correct clones were confirmed by restriction analysis followed by DNA sequencing. .. The recombinant LMP-1 and LMP-2 proteins were purified by size exclusion chromatography followed by metal affinity chromatography.

    Article Title: Structural Tuning of the Fluorescent Protein iLOV for Improved Photostability *
    Article Snippet: .. Ligation reactions were transformed into electrocompetent BL21(DE3) E. coli (Novagen), plated on LB-agar containing 100 μg/ml ampicillin (Sigma) and 100 μ m isopropyl β- d -1-thiogalactopyranoside (Roche Applied Science), and incubated in darkness at 30 °C for 24 h, as described ( ). .. LOV-associated fluorescence was visualized with a Blak-Ray lamp (UVP, LLC).

    Over Expression:

    Article Title: Phosphoproteomic Analysis Reveals the Effects of PilF Phosphorylation on Type IV Pilus and Biofilm Formation in Thermus thermophilus HB27 *
    Article Snippet: .. E. coli DH5α and BL21 (DE3) competent cells (Novagen, Madison, WI) were used as hosts for genetic manipulations of plasmids and for the overexpression of proteins, respectively. ..

    Derivative Assay:

    Article Title: Osteoinductive LIM Mineralization Protein-1 Suppresses Activation of NF-?B and Selectively Regulates MAPK Pathways in Pre-osteoclasts
    Article Snippet: To facilitate cellular entry of LMP-1, we prepared a cDNA construct containing an N-terminal HIV-TAT derived cationic peptide tag. .. BL21 (DE3) competent cells (Novagen, Madison, WI) were transformed with plasmid by standard methods, and the correct clones were confirmed by restriction analysis followed by DNA sequencing.

    Chromatography:

    Article Title: Vaccine Induced Antibodies to the First Variable Loop of Human Immunodeficiency Virus Type 1 gp120, Mediate Antibody-Dependent Virus Inhibition in Macaques
    Article Snippet: The HIV89.6 Tev protein was produced in E. coli and purified using immunoaffinity chromatography. .. BL21 (DE3) competent cells (EMD Biosciences) were transformed with pET26 HIV89.6 tev and the tev sequence of clones were confirmed by DNA sequence analysis.

    Ligation:

    Article Title: Structural Tuning of the Fluorescent Protein iLOV for Improved Photostability *
    Article Snippet: .. Ligation reactions were transformed into electrocompetent BL21(DE3) E. coli (Novagen), plated on LB-agar containing 100 μg/ml ampicillin (Sigma) and 100 μ m isopropyl β- d -1-thiogalactopyranoside (Roche Applied Science), and incubated in darkness at 30 °C for 24 h, as described ( ). .. LOV-associated fluorescence was visualized with a Blak-Ray lamp (UVP, LLC).

    Protease Inhibitor:

    Article Title: Colocalization and Sequential Enzyme Activity in Aqueous Biphasic Systems: Experiments and Modeling
    Article Snippet: Rosetta 2(DE3)pLysS competent Escherichia coli cells and BL21 (DE3) competent E. coli cells were from Novagen (Madison, WI). .. Complete EDTA-free protease inhibitor cocktail tablets were purchased from Roche (Indianapolis, IN).

    Article Title: Vaccine Induced Antibodies to the First Variable Loop of Human Immunodeficiency Virus Type 1 gp120, Mediate Antibody-Dependent Virus Inhibition in Macaques
    Article Snippet: BL21 (DE3) competent cells (EMD Biosciences) were transformed with pET26 HIV89.6 tev and the tev sequence of clones were confirmed by DNA sequence analysis. .. Cells were harvested by centrifugation and lysed in 40 ml of a PBS-based buffer containing 0.5 M sodium chloride, 10 mM ascorbic acid, 50 mM mannitol, 2.5 % glycerol, 0.5 % Triton-X-100, protease inhibitor cocktail, 50 μg/ml lysozyme, 1 μl/ml benzonase nuclease (EMD Biosciences), and 5 mM DTT.

    Cell Culture:

    Article Title:
    Article Snippet: Unlabeled and uniformly 15 N-labeled human gal-1 was expressed in BL21(DE3)-competent cells (Novagen; Millipore, Billerica, MA), grown in standard enriched media or in minimal media with 15 N-ammonium chloride for 15 N labeling, purified over a B lactose affinity column, and further fractionated on a gel filtration column, as described previously by . .. Typically, 200 mg (unlabeled) or 44 mg (15 N-enriched) of purified protein were obtained from 1 l of cell culture.

    DNA Sequencing:

    Article Title: Genetic and Biochemical Characterization of a 2,4,6-Trichlorophenol Degradation Pathway in Ralstonia eutropha JMP134
    Article Snippet: DNA sequencing of pTcpA was performed to confirm the cloned tcpA gene did not have any point mutation resulted from PCR amplification. .. Electrocompetent E. coli BL21(DE3) cells (Novagen) were transformed by pTcpA.

    Article Title: Osteoinductive LIM Mineralization Protein-1 Suppresses Activation of NF-?B and Selectively Regulates MAPK Pathways in Pre-osteoclasts
    Article Snippet: .. BL21 (DE3) competent cells (Novagen, Madison, WI) were transformed with plasmid by standard methods, and the correct clones were confirmed by restriction analysis followed by DNA sequencing. .. The recombinant LMP-1 and LMP-2 proteins were purified by size exclusion chromatography followed by metal affinity chromatography.

    Protein Concentration:

    Article Title: Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr97 → Ile and Pro101 → Ser in 5-Enolpyruvylshikimate-3-phosphate Synthase from Escherichia coli
    Article Snippet: The single mutant T97I and double mutant TIPS EPSPS enzymes were overexpressed in BL21(DE3)-competent cells (Novagen) and purified as previously described ( ). .. Protein concentration was determined using Coomassie reagent (Pierce) with bovine serum albumin as a standard.

    Polymerase Chain Reaction:

    Article Title: Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion
    Article Snippet: Two DNA fragments encoding the N-terminal regions of mouse ABCG5 (residues 2–375) and ABCG8 (residues 2–400) were PCR-amplified from the ABCG5 and ABCG8 cDNAs and cloned into the pET30a(+) vector (Novagen). .. The constructs were used to transform BL21 (DE3) competent cells (Novagen), and the peptides expressed were purified by using the QIAexpressionist procedure with nickel-nitrilotriacetic acid columns in 8 M urea (Qiagen, Valencia, CA).

    Article Title: Genetic and Biochemical Characterization of a 2,4,6-Trichlorophenol Degradation Pathway in Ralstonia eutropha JMP134
    Article Snippet: DNA sequencing of pTcpA was performed to confirm the cloned tcpA gene did not have any point mutation resulted from PCR amplification. .. Electrocompetent E. coli BL21(DE3) cells (Novagen) were transformed by pTcpA.

    Recombinant:

    Article Title: Genetic and Biochemical Characterization of a 2,4,6-Trichlorophenol Degradation Pathway in Ralstonia eutropha JMP134
    Article Snippet: Paragraph title: Expression of tcpA in E. coli and purification of recombinant TcpA. ... Electrocompetent E. coli BL21(DE3) cells (Novagen) were transformed by pTcpA.

    Article Title: Osteoinductive LIM Mineralization Protein-1 Suppresses Activation of NF-?B and Selectively Regulates MAPK Pathways in Pre-osteoclasts
    Article Snippet: Paragraph title: Preparation of recombinant TAT-LMP-1 and TAT-LMP-2 proteins ... BL21 (DE3) competent cells (Novagen, Madison, WI) were transformed with plasmid by standard methods, and the correct clones were confirmed by restriction analysis followed by DNA sequencing.

    Fluorescence:

    Article Title: Structural Tuning of the Fluorescent Protein iLOV for Improved Photostability *
    Article Snippet: Ligation reactions were transformed into electrocompetent BL21(DE3) E. coli (Novagen), plated on LB-agar containing 100 μg/ml ampicillin (Sigma) and 100 μ m isopropyl β- d -1-thiogalactopyranoside (Roche Applied Science), and incubated in darkness at 30 °C for 24 h, as described ( ). .. LOV-associated fluorescence was visualized with a Blak-Ray lamp (UVP, LLC).

    Mutagenesis:

    Article Title: Genetic and Biochemical Characterization of a 2,4,6-Trichlorophenol Degradation Pathway in Ralstonia eutropha JMP134
    Article Snippet: DNA sequencing of pTcpA was performed to confirm the cloned tcpA gene did not have any point mutation resulted from PCR amplification. .. Electrocompetent E. coli BL21(DE3) cells (Novagen) were transformed by pTcpA.

    Article Title: Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr97 → Ile and Pro101 → Ser in 5-Enolpyruvylshikimate-3-phosphate Synthase from Escherichia coli
    Article Snippet: .. The single mutant T97I and double mutant TIPS EPSPS enzymes were overexpressed in BL21(DE3)-competent cells (Novagen) and purified as previously described ( ). .. After the final purification step, the enzymes were concentrated in 50 m m Tris, 1 m m dithiothreitol, and 1 m m EDTA using Centricon-30 devices (Millipore Corp., Billerica, MA) and stored at –80 °C.

    Article Title: Phosphoproteomic Analysis Reveals the Effects of PilF Phosphorylation on Type IV Pilus and Biofilm Formation in Thermus thermophilus HB27 *
    Article Snippet: Wild-type PilF and its mutant versions were expressed in the host strain T. thermophilus HB27, grown under aerobic conditions at 70 °C in Thermus modified (TM) medium ( ). .. E. coli DH5α and BL21 (DE3) competent cells (Novagen, Madison, WI) were used as hosts for genetic manipulations of plasmids and for the overexpression of proteins, respectively.

    Article Title: Effect of extension of the heparin binding pocket on the structure, stability, and cell proliferation activity of the human acidic fibroblast growth factor
    Article Snippet: 4.1 Materials The Quikchange II XL mutagenesis kit was from Agilent and the DNA plasmid isolation kit was from Qiagen Inc., USA. .. DH5α and BL-21(DE3) competent cells were obtained from Novagen Inc., USA.

    Article Title: Structural Tuning of the Fluorescent Protein iLOV for Improved Photostability *
    Article Snippet: Paragraph title: Mutagenesis and Screening ... Ligation reactions were transformed into electrocompetent BL21(DE3) E. coli (Novagen), plated on LB-agar containing 100 μg/ml ampicillin (Sigma) and 100 μ m isopropyl β- d -1-thiogalactopyranoside (Roche Applied Science), and incubated in darkness at 30 °C for 24 h, as described ( ).

    Isolation:

    Article Title: Effect of extension of the heparin binding pocket on the structure, stability, and cell proliferation activity of the human acidic fibroblast growth factor
    Article Snippet: 4.1 Materials The Quikchange II XL mutagenesis kit was from Agilent and the DNA plasmid isolation kit was from Qiagen Inc., USA. .. DH5α and BL-21(DE3) competent cells were obtained from Novagen Inc., USA.

    Size-exclusion Chromatography:

    Article Title: Osteoinductive LIM Mineralization Protein-1 Suppresses Activation of NF-?B and Selectively Regulates MAPK Pathways in Pre-osteoclasts
    Article Snippet: BL21 (DE3) competent cells (Novagen, Madison, WI) were transformed with plasmid by standard methods, and the correct clones were confirmed by restriction analysis followed by DNA sequencing. .. The recombinant LMP-1 and LMP-2 proteins were purified by size exclusion chromatography followed by metal affinity chromatography.

    Labeling:

    Article Title:
    Article Snippet: .. Unlabeled and uniformly 15 N-labeled human gal-1 was expressed in BL21(DE3)-competent cells (Novagen; Millipore, Billerica, MA), grown in standard enriched media or in minimal media with 15 N-ammonium chloride for 15 N labeling, purified over a B lactose affinity column, and further fractionated on a gel filtration column, as described previously by . .. Typically, 200 mg (unlabeled) or 44 mg (15 N-enriched) of purified protein were obtained from 1 l of cell culture.

    Purification:

    Article Title: Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion
    Article Snippet: .. The constructs were used to transform BL21 (DE3) competent cells (Novagen), and the peptides expressed were purified by using the QIAexpressionist procedure with nickel-nitrilotriacetic acid columns in 8 M urea (Qiagen, Valencia, CA). .. Hepatic triglyceride levels were measured by using Infinity triglycerides reagent (catalog no. 343-500P; Sigma–Aldrich).

    Article Title: Genetic and Biochemical Characterization of a 2,4,6-Trichlorophenol Degradation Pathway in Ralstonia eutropha JMP134
    Article Snippet: Paragraph title: Expression of tcpA in E. coli and purification of recombinant TcpA. ... Electrocompetent E. coli BL21(DE3) cells (Novagen) were transformed by pTcpA.

    Article Title: Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr97 → Ile and Pro101 → Ser in 5-Enolpyruvylshikimate-3-phosphate Synthase from Escherichia coli
    Article Snippet: .. The single mutant T97I and double mutant TIPS EPSPS enzymes were overexpressed in BL21(DE3)-competent cells (Novagen) and purified as previously described ( ). .. After the final purification step, the enzymes were concentrated in 50 m m Tris, 1 m m dithiothreitol, and 1 m m EDTA using Centricon-30 devices (Millipore Corp., Billerica, MA) and stored at –80 °C.

    Article Title:
    Article Snippet: .. Unlabeled and uniformly 15 N-labeled human gal-1 was expressed in BL21(DE3)-competent cells (Novagen; Millipore, Billerica, MA), grown in standard enriched media or in minimal media with 15 N-ammonium chloride for 15 N labeling, purified over a B lactose affinity column, and further fractionated on a gel filtration column, as described previously by . .. Typically, 200 mg (unlabeled) or 44 mg (15 N-enriched) of purified protein were obtained from 1 l of cell culture.

    Article Title: Vaccine Induced Antibodies to the First Variable Loop of Human Immunodeficiency Virus Type 1 gp120, Mediate Antibody-Dependent Virus Inhibition in Macaques
    Article Snippet: The HIV89.6 Tev protein was produced in E. coli and purified using immunoaffinity chromatography. .. BL21 (DE3) competent cells (EMD Biosciences) were transformed with pET26 HIV89.6 tev and the tev sequence of clones were confirmed by DNA sequence analysis.

    Article Title: Epigenetic inactivation of inhibitor of differentiation 4 (Id4) correlates with prostate cancer
    Article Snippet: Paragraph title: GST-Id4 purification ... Plasmid was transformed into BL21 (DE3) competent cells (Novagen, Darmstadt, Germany).

    Article Title: Osteoinductive LIM Mineralization Protein-1 Suppresses Activation of NF-?B and Selectively Regulates MAPK Pathways in Pre-osteoclasts
    Article Snippet: BL21 (DE3) competent cells (Novagen, Madison, WI) were transformed with plasmid by standard methods, and the correct clones were confirmed by restriction analysis followed by DNA sequencing. .. The recombinant LMP-1 and LMP-2 proteins were purified by size exclusion chromatography followed by metal affinity chromatography.

    Protein Purification:

    Article Title: Genetic and Biochemical Characterization of a 2,4,6-Trichlorophenol Degradation Pathway in Ralstonia eutropha JMP134
    Article Snippet: For ease of protein purification, tcpA was cloned into the pET-30-LIC vector to yield plasmid pTcpA. .. Electrocompetent E. coli BL21(DE3) cells (Novagen) were transformed by pTcpA.

    Article Title: Vaccine Induced Antibodies to the First Variable Loop of Human Immunodeficiency Virus Type 1 gp120, Mediate Antibody-Dependent Virus Inhibition in Macaques
    Article Snippet: Paragraph title: HIV89.6 Tev protein purification ... BL21 (DE3) competent cells (EMD Biosciences) were transformed with pET26 HIV89.6 tev and the tev sequence of clones were confirmed by DNA sequence analysis.

    Sequencing:

    Article Title: Vaccine Induced Antibodies to the First Variable Loop of Human Immunodeficiency Virus Type 1 gp120, Mediate Antibody-Dependent Virus Inhibition in Macaques
    Article Snippet: .. BL21 (DE3) competent cells (EMD Biosciences) were transformed with pET26 HIV89.6 tev and the tev sequence of clones were confirmed by DNA sequence analysis. ..

    Positron Emission Tomography:

    Article Title: Genetic and Biochemical Characterization of a 2,4,6-Trichlorophenol Degradation Pathway in Ralstonia eutropha JMP134
    Article Snippet: For ease of protein purification, tcpA was cloned into the pET-30-LIC vector to yield plasmid pTcpA. .. Electrocompetent E. coli BL21(DE3) cells (Novagen) were transformed by pTcpA.

    Article Title: Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr97 → Ile and Pro101 → Ser in 5-Enolpyruvylshikimate-3-phosphate Synthase from Escherichia coli
    Article Snippet: The pET-24d vector (Novagen) containing the open reading frame of EPSPS from E. coli was used as a template for the mutations. .. The single mutant T97I and double mutant TIPS EPSPS enzymes were overexpressed in BL21(DE3)-competent cells (Novagen) and purified as previously described ( ).

    Article Title: Expression, Purification, and Characterization of Mouse Glycine N-acyltransferase in Escherichia coli
    Article Snippet: .. BL 21 (DE3) E.coli cells, Ni-NTA His-Bind® resin , and pET-21a(+) vector were purchased from Novagen. .. BamHI , HindIII , Antarctic Phosphatase, and T4 DNA ligase were purchased from New England Biolabs.

    Affinity Column:

    Article Title:
    Article Snippet: .. Unlabeled and uniformly 15 N-labeled human gal-1 was expressed in BL21(DE3)-competent cells (Novagen; Millipore, Billerica, MA), grown in standard enriched media or in minimal media with 15 N-ammonium chloride for 15 N labeling, purified over a B lactose affinity column, and further fractionated on a gel filtration column, as described previously by . .. Typically, 200 mg (unlabeled) or 44 mg (15 N-enriched) of purified protein were obtained from 1 l of cell culture.

    Plasmid Preparation:

    Article Title: Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion
    Article Snippet: Two DNA fragments encoding the N-terminal regions of mouse ABCG5 (residues 2–375) and ABCG8 (residues 2–400) were PCR-amplified from the ABCG5 and ABCG8 cDNAs and cloned into the pET30a(+) vector (Novagen). .. The constructs were used to transform BL21 (DE3) competent cells (Novagen), and the peptides expressed were purified by using the QIAexpressionist procedure with nickel-nitrilotriacetic acid columns in 8 M urea (Qiagen, Valencia, CA).

    Article Title: Colocalization and Sequential Enzyme Activity in Aqueous Biphasic Systems: Experiments and Modeling
    Article Snippet: Human ASL plasmid DNA and human ATIC (AICAR transformylase/IMP cyclohydrolase) plasmid DNA were provided by the Stephen J. Benkovic group at Pennsylvania State University (University Park, PA). .. Rosetta 2(DE3)pLysS competent Escherichia coli cells and BL21 (DE3) competent E. coli cells were from Novagen (Madison, WI).

    Article Title: Genetic and Biochemical Characterization of a 2,4,6-Trichlorophenol Degradation Pathway in Ralstonia eutropha JMP134
    Article Snippet: The PCR product was cut with Nde I and Bam HI and then ligated into the plasmid pET30-LIC previously digested with Nde I and Bam HI, producing plasmid pTcpA. .. Electrocompetent E. coli BL21(DE3) cells (Novagen) were transformed by pTcpA.

    Article Title: Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr97 → Ile and Pro101 → Ser in 5-Enolpyruvylshikimate-3-phosphate Synthase from Escherichia coli
    Article Snippet: The pET-24d vector (Novagen) containing the open reading frame of EPSPS from E. coli was used as a template for the mutations. .. The single mutant T97I and double mutant TIPS EPSPS enzymes were overexpressed in BL21(DE3)-competent cells (Novagen) and purified as previously described ( ).

    Article Title: Vaccine Induced Antibodies to the First Variable Loop of Human Immunodeficiency Virus Type 1 gp120, Mediate Antibody-Dependent Virus Inhibition in Macaques
    Article Snippet: The resulting pET26 HIV89.6 tev plasmid is kanamycin resistant, and the expression of tev is under control of the IPTG-inducible T7 lac promoter. .. BL21 (DE3) competent cells (EMD Biosciences) were transformed with pET26 HIV89.6 tev and the tev sequence of clones were confirmed by DNA sequence analysis.

    Article Title: Phosphoproteomic Analysis Reveals the Effects of PilF Phosphorylation on Type IV Pilus and Biofilm Formation in Thermus thermophilus HB27 *
    Article Snippet: E. coli DH5α and BL21 (DE3) competent cells (Novagen, Madison, WI) were used as hosts for genetic manipulations of plasmids and for the overexpression of proteins, respectively. .. When needed, kanamycin (30 μg/ml) and/or ampicillin (100 μg/ml) was added to TM or LB plates for plasmid selection.

    Article Title: Epigenetic inactivation of inhibitor of differentiation 4 (Id4) correlates with prostate cancer
    Article Snippet: .. Plasmid was transformed into BL21 (DE3) competent cells (Novagen, Darmstadt, Germany). .. Protein expression in freshly grown cultures at 37°C was induced by 1 mM IPTG at 30°C.

    Article Title: Osteoinductive LIM Mineralization Protein-1 Suppresses Activation of NF-?B and Selectively Regulates MAPK Pathways in Pre-osteoclasts
    Article Snippet: .. BL21 (DE3) competent cells (Novagen, Madison, WI) were transformed with plasmid by standard methods, and the correct clones were confirmed by restriction analysis followed by DNA sequencing. .. The recombinant LMP-1 and LMP-2 proteins were purified by size exclusion chromatography followed by metal affinity chromatography.

    Article Title: Effect of extension of the heparin binding pocket on the structure, stability, and cell proliferation activity of the human acidic fibroblast growth factor
    Article Snippet: 4.1 Materials The Quikchange II XL mutagenesis kit was from Agilent and the DNA plasmid isolation kit was from Qiagen Inc., USA. .. DH5α and BL-21(DE3) competent cells were obtained from Novagen Inc., USA.

    Article Title: Expression, Purification, and Characterization of Mouse Glycine N-acyltransferase in Escherichia coli
    Article Snippet: .. BL 21 (DE3) E.coli cells, Ni-NTA His-Bind® resin , and pET-21a(+) vector were purchased from Novagen. .. BamHI , HindIII , Antarctic Phosphatase, and T4 DNA ligase were purchased from New England Biolabs.

    Functional Assay:

    Article Title:
    Article Snippet: Unlabeled and uniformly 15 N-labeled human gal-1 was expressed in BL21(DE3)-competent cells (Novagen; Millipore, Billerica, MA), grown in standard enriched media or in minimal media with 15 N-ammonium chloride for 15 N labeling, purified over a B lactose affinity column, and further fractionated on a gel filtration column, as described previously by . .. Functional activity of the purified protein was assessed by a T cell death assay.

    Selection:

    Article Title: Phosphoproteomic Analysis Reveals the Effects of PilF Phosphorylation on Type IV Pilus and Biofilm Formation in Thermus thermophilus HB27 *
    Article Snippet: E. coli DH5α and BL21 (DE3) competent cells (Novagen, Madison, WI) were used as hosts for genetic manipulations of plasmids and for the overexpression of proteins, respectively. .. When needed, kanamycin (30 μg/ml) and/or ampicillin (100 μg/ml) was added to TM or LB plates for plasmid selection.

    Affinity Chromatography:

    Article Title: Osteoinductive LIM Mineralization Protein-1 Suppresses Activation of NF-?B and Selectively Regulates MAPK Pathways in Pre-osteoclasts
    Article Snippet: BL21 (DE3) competent cells (Novagen, Madison, WI) were transformed with plasmid by standard methods, and the correct clones were confirmed by restriction analysis followed by DNA sequencing. .. The recombinant LMP-1 and LMP-2 proteins were purified by size exclusion chromatography followed by metal affinity chromatography.

    Produced:

    Article Title: Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr97 → Ile and Pro101 → Ser in 5-Enolpyruvylshikimate-3-phosphate Synthase from Escherichia coli
    Article Snippet: The single mutant T97I and double mutant TIPS EPSPS enzymes were overexpressed in BL21(DE3)-competent cells (Novagen) and purified as previously described ( ). .. Enzyme Kinetics —The enzymatic activities of WT, P101S, T97I, and TIPS EPSPS were measured by determining the amount of inorganic phosphate produced in the forward reaction with S3P and PEP as substrates in 96-well plates on a Spectra-Max 340PC plate reader (Molecular Devices, Sunnyvale, CA).

    Article Title: Vaccine Induced Antibodies to the First Variable Loop of Human Immunodeficiency Virus Type 1 gp120, Mediate Antibody-Dependent Virus Inhibition in Macaques
    Article Snippet: The HIV89.6 Tev protein was produced in E. coli and purified using immunoaffinity chromatography. .. BL21 (DE3) competent cells (EMD Biosciences) were transformed with pET26 HIV89.6 tev and the tev sequence of clones were confirmed by DNA sequence analysis.

    Thin Layer Chromatography:

    Article Title: Colocalization and Sequential Enzyme Activity in Aqueous Biphasic Systems: Experiments and Modeling
    Article Snippet: Rosetta 2(DE3)pLysS competent Escherichia coli cells and BL21 (DE3) competent E. coli cells were from Novagen (Madison, WI). .. Yeast extract, tryptone, agar, PMSF (phenylmethylsulfonyl fluoride), acrylamide/bis-acrylamide 19:1, TLC PEI cellulose F plates, ammonium acetate, ammonium hydroxide, methanol, potassium phosphate monobasic, and potassium phosphate dibasic were acquired from EMD Chemicals (Darmstadt, Germany).

    Staining:

    Article Title: Osteoinductive LIM Mineralization Protein-1 Suppresses Activation of NF-?B and Selectively Regulates MAPK Pathways in Pre-osteoclasts
    Article Snippet: BL21 (DE3) competent cells (Novagen, Madison, WI) were transformed with plasmid by standard methods, and the correct clones were confirmed by restriction analysis followed by DNA sequencing. .. Purity of the LMP-1 and LMP-2 proteins used in the current study was higher than 90% as determined by densitometric analysis of a scanned Coomassie stained gel; protein quantification was performed with assay reagent (Bio-Rad, Hercules, CA) using BSA as the standard.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore bl21 de3 competent cells
    Bl21 De3 Competent Cells, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 competent cells/product/Millipore
    Average 99 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 competent cells - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results