Structured Review

EpigenDx bisulfite treated dna
Bisulfite Treated Dna, supplied by EpigenDx, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bisulfite treated dna/product/EpigenDx
Average 92 stars, based on 5 article reviews
Price from $9.99 to $1999.99
bisulfite treated dna - by Bioz Stars, 2020-07
92/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: BET bromodomain inhibitors and agonists of the beta-2 adrenergic receptor identified in screens for compounds that inhibit DUX4 expression in FSHD muscle cells
Article Snippet: .. PCR was performed using 1 μl of bisulfite-treated DNA and 0.2 μM of each primer for EpigenDx methylation assays ADS3747 and ADS1454. .. One primer was biotin-labeled and high-performance liquid chromatography-purified in order to capture the final PCR product using sepharose beads.

Article Title: Assessment of Epigenetic Contributions to Sexually-Dimorphic Kiss1 Expression in the Anteroventral Periventricular Nucleus of Mice
Article Snippet: .. Bisulfite-treated DNA was then PCR amplified using primers designed by EpigenDX (Worcestor, MA) to isolate multiple short amplicons in three regions of the murine Kiss1 gene. .. The first region included the first CpG of intron 1, all of exon 1, and 938 bp upstream of transcription start site (the putative promoter) (assay numbers: ADS2132, ADS2133, ADS2134, ADS2135, ADS2136).

Article Title: LINE-1 methylation is inherited in familial testicular cancer kindreds
Article Snippet: .. LINE-1 PCR and pyrosequencing DNA methylation (%5-mC) of LINE-1 was quantified using PCR-pyrosequencing of the bisulfite-treated DNA by EpigenDx Laboratory Service (Worcester, MA), as previously described [ ]. .. In brief, the bisulfite-treated DNA was amplified by PCR using primers designed toward a consensus LINE-1 sequence.

Article Title: LINE-1 methylation is inherited in familial testicular cancer kindreds
Article Snippet: .. In brief, the bisulfite-treated DNA was amplified by PCR using primers designed toward a consensus LINE-1 sequence. .. A 50-μL PCR was carried out in 25-μL GoTaq Green Master mix (Promega, Madison, WI, USA), 1 pmol of the forward primer (TTTTGAGTTAGGTGTGGGATATA), 1 pmol of the biotinylated reverse primer (biotin-AAAATCAAAAAATTCCCTTTC), 50 ng of bisulfite-treated genomic DNA, and water.

Sequencing:

Article Title: LINE-1 methylation is inherited in familial testicular cancer kindreds
Article Snippet: .. In brief, the bisulfite-treated DNA was amplified by PCR using primers designed toward a consensus LINE-1 sequence. .. A 50-μL PCR was carried out in 25-μL GoTaq Green Master mix (Promega, Madison, WI, USA), 1 pmol of the forward primer (TTTTGAGTTAGGTGTGGGATATA), 1 pmol of the biotinylated reverse primer (biotin-AAAATCAAAAAATTCCCTTTC), 50 ng of bisulfite-treated genomic DNA, and water.

Amplification:

Article Title: Assessment of Epigenetic Contributions to Sexually-Dimorphic Kiss1 Expression in the Anteroventral Periventricular Nucleus of Mice
Article Snippet: .. Bisulfite-treated DNA was then PCR amplified using primers designed by EpigenDX (Worcestor, MA) to isolate multiple short amplicons in three regions of the murine Kiss1 gene. .. The first region included the first CpG of intron 1, all of exon 1, and 938 bp upstream of transcription start site (the putative promoter) (assay numbers: ADS2132, ADS2133, ADS2134, ADS2135, ADS2136).

Article Title: LINE-1 methylation is inherited in familial testicular cancer kindreds
Article Snippet: .. In brief, the bisulfite-treated DNA was amplified by PCR using primers designed toward a consensus LINE-1 sequence. .. A 50-μL PCR was carried out in 25-μL GoTaq Green Master mix (Promega, Madison, WI, USA), 1 pmol of the forward primer (TTTTGAGTTAGGTGTGGGATATA), 1 pmol of the biotinylated reverse primer (biotin-AAAATCAAAAAATTCCCTTTC), 50 ng of bisulfite-treated genomic DNA, and water.

Methylation:

Article Title: BET bromodomain inhibitors and agonists of the beta-2 adrenergic receptor identified in screens for compounds that inhibit DUX4 expression in FSHD muscle cells
Article Snippet: .. PCR was performed using 1 μl of bisulfite-treated DNA and 0.2 μM of each primer for EpigenDx methylation assays ADS3747 and ADS1454. .. One primer was biotin-labeled and high-performance liquid chromatography-purified in order to capture the final PCR product using sepharose beads.

DNA Methylation Assay:

Article Title: Promoter methylation of candidate genes associated with familial testicular cancer
Article Snippet: .. DNA methylation (%5-methylcytosine [5-mC]) of consecutive CpG sites was quantified using pyrosequencing of the bisulfite-treated DNA by EpigenDx Laboratory Service (Worcester, MA). ..

Article Title: LINE-1 methylation is inherited in familial testicular cancer kindreds
Article Snippet: .. LINE-1 PCR and pyrosequencing DNA methylation (%5-mC) of LINE-1 was quantified using PCR-pyrosequencing of the bisulfite-treated DNA by EpigenDx Laboratory Service (Worcester, MA), as previously described [ ]. .. In brief, the bisulfite-treated DNA was amplified by PCR using primers designed toward a consensus LINE-1 sequence.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    EpigenDx bisulfite treated dna
    Bisulfite Treated Dna, supplied by EpigenDx, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bisulfite treated dna/product/EpigenDx
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    bisulfite treated dna - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    Image Search Results