bigdye xterminator purification kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher bigdye xterminator purification kit
    Bigdye Xterminator Purification Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 231 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bigdye xterminator purification kit/product/Thermo Fisher
    Average 99 stars, based on 231 article reviews
    Price from $9.99 to $1999.99
    bigdye xterminator purification kit - by Bioz Stars, 2020-02
    99/100 stars

    Images

    Related Articles

    DNA Extraction:

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: Paragraph title: DNA extraction and amplification ... The PCR products were purified according to the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

    Real-time Polymerase Chain Reaction:

    Article Title: Accurate detection of KRAS, NRAS and BRAF mutations in metastatic colorectal cancers by bridged nucleic acid-clamp real-time PCR
    Article Snippet: Purified products were used as templates and Sanger sequencing was performed using the BNA Real-time PCR Extended RAS Mutation Sequencing Primer (Riken Genesis) and the BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific). .. PCR products were purified with a BigDye XTerminator Purification Kit (Thermo Fisher Scientific) and subsequently sequenced on a 3500 Genetic Analyzer (Thermo Fisher Scientific).

    Amplification:

    Article Title: Are Long Noncoding RNAs New Potential Biomarkers in Gastrointestinal Stromal Tumors (GISTs)? The Role of H19 and MALAT1
    Article Snippet: To detect hotspot mutations, we amplified exons 9, 11, 13, 17, and 18 of the c-KIT gene by PCR in a preparation of genomic DNA. .. We purified PCR products with PureLink® PCR Purification Kit (Thermo Fisher Scientific) and directly sequenced them using BigDye XTerminator® Purification Kit (Thermo Fisher Scientific) through the ABI 3130 XL Genetic Analyzer automated sequencer (Applied Biosystems).

    Article Title: Rapidly declining trend of signet ring cell cancer of the stomach may parallel the infection rate of Helicobacter pylori
    Article Snippet: Reactions were subject to thermal cycling with the following conditions: 94 °C for 2 min, 45 cycles of 94 °C for 15 s, 60 °C for 15 s, and 68 °C for 30 s. To determine the H. pylori- specific amplicon, 5 μL of the PCR products was separated by electrophoresis on 2% agarose gel, stained with ethidium bromide and visualized on an FAS IV UV Illuminator (NIPPON Genetics, Japan) [ , ]. .. PCR products were purified BigDye XTerminator™ Purification Kit and subsequently analyzed by 3500 Genetic Analyzer (Thermo Fisher Scientific).

    Article Title: Evaluation of a Novel Mitochondrial Pan-Mucorales Marker for the Detection, Identification, Quantification, and Growth Stage Determination of Mucormycetes
    Article Snippet: PCR amplification used a peqSTAR 2× gradient thermal cycler (PEQLAB biotechnology, Erlangen, Germany) programmed as follows: initial cycle 95.0 °C/2 min, followed by 30 cycles at 95.0 °C/15 s, 57.0 °C/30 s, 72.0 °C/1 min, and a final cycle at 72.0 °C/3 min. PCR amplicon sizes ranged from 367 bp (for R. arrhizus ) to 391 bp (for L. ramosa and M. circinelloides ). .. DNA sequence analysis of the PCR products used the BigDye® Terminator v 3.1 Cycle Sequencing Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA) together with the BigDye XTerminator® Purification Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA).

    Article Title: Validation and Clinical Applications of a Comprehensive Next Generation Sequencing System for Molecular Characterization of Solid Cancer Tissues
    Article Snippet: PCR amplification of the target regions and cycle sequencing reactions were performed using the BigDye Direct Cycle Sequencing Kit protocol recommended by the manufacturer (ThermoFisher). .. The sequencing products were purified using the BigDye XTerminator Purification Kit (ThermoFisher).

    Article Title: Accurate detection of KRAS, NRAS and BRAF mutations in metastatic colorectal cancers by bridged nucleic acid-clamp real-time PCR
    Article Snippet: Sanger sequencing To further determine nucleotide changes and to characterize the deduced amino acid changes, we performed Sanger sequencing on samples, in which PCR amplification plot was observed but did not reached to threshold line by BNA-clamp PCR. .. PCR products were purified with a BigDye XTerminator Purification Kit (Thermo Fisher Scientific) and subsequently sequenced on a 3500 Genetic Analyzer (Thermo Fisher Scientific).

    Article Title: Molecular Basis of Inherited Colorectal Carcinomas in the Macedonian Population: An Update
    Article Snippet: These PCR products were used as templates for the amplification of individual exons of the PMS2 gene. .. Sequencing products were purified using BigDye XTerminator® Purification Kit (Thermo Fisher Scientific) and analyzed with CE on a 3500 Genetic Analyzer (Thermo Fisher Scientific).

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: Paragraph title: DNA extraction and amplification ... The PCR products were purified according to the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

    Article Title: Prion Disease in Dromedary Camels, Algeria
    Article Snippet: We amplified the PrP gene (PRNP ) coding sequence in a 50-μL final volume using 5 μL of extracted DNA, 1× AmpliTaq Gold 360 PCR Buffer (Applied Biosystems, Foster City, CA, USA), 2.5 mmol/L MgCl2, 1× 360 GC Enhancer, 200 μmol/L dNTPs, 0.25 μmol/L of forward (5′-GCTGACACCCTCTTTATTTTGCAG-3′) and reverse (5′-GATTAAGAAGATAATGAAAACAGGAAG-3′) primers , and 0.5 μL of AmpliTaq Gold 360 (Applied Biosystems), according to the following amplification protocol: 5 min at 96°C; 30 s at 96°C, 15 s at 57°C, 90 s at 72°C for 40 cycles, and 4 min at 72°C. .. We conducted sequencing reactions by using the BigDye Terminator v1.1 Cycle Sequencing Kit, purified using BigDye XTerminator Purification Kit, and detected with the ABI PRISM 3130 apparatus (all Applied Biosystems).

    Agarose Gel Electrophoresis:

    Article Title: Rapidly declining trend of signet ring cell cancer of the stomach may parallel the infection rate of Helicobacter pylori
    Article Snippet: Reactions were subject to thermal cycling with the following conditions: 94 °C for 2 min, 45 cycles of 94 °C for 15 s, 60 °C for 15 s, and 68 °C for 30 s. To determine the H. pylori- specific amplicon, 5 μL of the PCR products was separated by electrophoresis on 2% agarose gel, stained with ethidium bromide and visualized on an FAS IV UV Illuminator (NIPPON Genetics, Japan) [ , ]. .. PCR products were purified BigDye XTerminator™ Purification Kit and subsequently analyzed by 3500 Genetic Analyzer (Thermo Fisher Scientific).

    Article Title: Highly Predictive Genetic Markers Distinguish Drug-Type from Fiber-Type Cannabis sativa L
    Article Snippet: The amplified products were loaded on a 2% agarose gel in 1X TBE. .. The sequences were purified with a BigDye XTerminator Purification Kit and analyzed with an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Validation of the Accuracy of Self-Reported ABO Blood Types in the Japan Nurses’ Health Study
    Article Snippet: A volume of 5 µl of reaction mixture was electrophoresed on a 2% agarose gel and PCR products were visualised by using GelRed (Biotium, Inc., Fremont, CA, USA) to confirm the size of the product and estimate its amount. .. DNA sequences of the PCR products were then analysed on the ABI 3130xl Prism Genetic Analyzer (Applied Biosystems) using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) and the BigDye XTerminator Purification Kit (Applied Biosystems).

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: The amplicon was visualized in 2% of agarose gel electrophoresis under UV illuminator [ ]. .. The PCR products were purified according to the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: Are Long Noncoding RNAs New Potential Biomarkers in Gastrointestinal Stromal Tumors (GISTs)? The Role of H19 and MALAT1
    Article Snippet: .. We purified PCR products with PureLink® PCR Purification Kit (Thermo Fisher Scientific) and directly sequenced them using BigDye XTerminator® Purification Kit (Thermo Fisher Scientific) through the ABI 3130 XL Genetic Analyzer automated sequencer (Applied Biosystems). .. Sequence data were analyzed using Sequencing Analysis software 5.2 (Applied Biosystems).

    Article Title: Rapidly declining trend of signet ring cell cancer of the stomach may parallel the infection rate of Helicobacter pylori
    Article Snippet: .. PCR products were purified BigDye XTerminator™ Purification Kit and subsequently analyzed by 3500 Genetic Analyzer (Thermo Fisher Scientific). ..

    Article Title: Evaluation of a Novel Mitochondrial Pan-Mucorales Marker for the Detection, Identification, Quantification, and Growth Stage Determination of Mucormycetes
    Article Snippet: .. DNA sequence analysis of the PCR products used the BigDye® Terminator v 3.1 Cycle Sequencing Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA) together with the BigDye XTerminator® Purification Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA). .. The products were sequenced using an ABI 3730 XL automatic sequencer (ThermoFisher Scientifics, Waltham, Massachusetts, USA).

    Article Title: Validation and Clinical Applications of a Comprehensive Next Generation Sequencing System for Molecular Characterization of Solid Cancer Tissues
    Article Snippet: PCR amplification of the target regions and cycle sequencing reactions were performed using the BigDye Direct Cycle Sequencing Kit protocol recommended by the manufacturer (ThermoFisher). .. The sequencing products were purified using the BigDye XTerminator Purification Kit (ThermoFisher).

    Article Title: Highly Predictive Genetic Markers Distinguish Drug-Type from Fiber-Type Cannabis sativa L
    Article Snippet: Sequencing was conducted using a BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA, USA) as follows: 4 μL reaction mix, 3.2 pmol of primer, and 2 μL of the purified PCR product in 15 μL total volume. .. The sequences were purified with a BigDye XTerminator Purification Kit and analyzed with an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Accurate detection of KRAS, NRAS and BRAF mutations in metastatic colorectal cancers by bridged nucleic acid-clamp real-time PCR
    Article Snippet: .. PCR products were purified with a BigDye XTerminator Purification Kit (Thermo Fisher Scientific) and subsequently sequenced on a 3500 Genetic Analyzer (Thermo Fisher Scientific). .. The data were analyzed by Sequencing Analysis Software v5.4 (Thermo Fisher Scientific) [ , , ].

    Article Title: Molecular Basis of Inherited Colorectal Carcinomas in the Macedonian Population: An Update
    Article Snippet: These PCR products were used as templates for the amplification of individual exons of the PMS2 gene. .. Sequencing products were purified using BigDye XTerminator® Purification Kit (Thermo Fisher Scientific) and analyzed with CE on a 3500 Genetic Analyzer (Thermo Fisher Scientific).

    Article Title: Validation of the Accuracy of Self-Reported ABO Blood Types in the Japan Nurses’ Health Study
    Article Snippet: .. DNA sequences of the PCR products were then analysed on the ABI 3130xl Prism Genetic Analyzer (Applied Biosystems) using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) and the BigDye XTerminator Purification Kit (Applied Biosystems). ..

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: .. The PCR products were purified with the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer. .. The sequence product was confirmed with Clone Manager Professional 9 (Sci-Ed Software) and the Neighbor-Joining method was done with MEGA6 to build a phylogenetic tree.

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: .. The PCR products were purified according to the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer (Applied Biosystems). .. Bioinformatics analysis The sequence was analyzed with program Clone Manager Professional 9 (Sci-Ed Software) where the reverse primer was inverted to make complete alignments.

    Article Title: Prion Disease in Dromedary Camels, Algeria
    Article Snippet: We amplified the PrP gene (PRNP ) coding sequence in a 50-μL final volume using 5 μL of extracted DNA, 1× AmpliTaq Gold 360 PCR Buffer (Applied Biosystems, Foster City, CA, USA), 2.5 mmol/L MgCl2, 1× 360 GC Enhancer, 200 μmol/L dNTPs, 0.25 μmol/L of forward (5′-GCTGACACCCTCTTTATTTTGCAG-3′) and reverse (5′-GATTAAGAAGATAATGAAAACAGGAAG-3′) primers , and 0.5 μL of AmpliTaq Gold 360 (Applied Biosystems), according to the following amplification protocol: 5 min at 96°C; 30 s at 96°C, 15 s at 57°C, 90 s at 72°C for 40 cycles, and 4 min at 72°C. .. We conducted sequencing reactions by using the BigDye Terminator v1.1 Cycle Sequencing Kit, purified using BigDye XTerminator Purification Kit, and detected with the ABI PRISM 3130 apparatus (all Applied Biosystems).

    Mutagenesis:

    Article Title: Are Long Noncoding RNAs New Potential Biomarkers in Gastrointestinal Stromal Tumors (GISTs)? The Role of H19 and MALAT1
    Article Snippet: Paragraph title: 4.3. DNA Preparation and Mutation Screening ... We purified PCR products with PureLink® PCR Purification Kit (Thermo Fisher Scientific) and directly sequenced them using BigDye XTerminator® Purification Kit (Thermo Fisher Scientific) through the ABI 3130 XL Genetic Analyzer automated sequencer (Applied Biosystems).

    Article Title: Validation and Clinical Applications of a Comprehensive Next Generation Sequencing System for Molecular Characterization of Solid Cancer Tissues
    Article Snippet: The sequencing products were purified using the BigDye XTerminator Purification Kit (ThermoFisher). .. Sequence data was analyzed using the Mutation Surveyor DNA Variant Analysis Software (v4.0.9) (Softgenetics, State College, PA).

    Article Title: Accurate detection of KRAS, NRAS and BRAF mutations in metastatic colorectal cancers by bridged nucleic acid-clamp real-time PCR
    Article Snippet: Purified products were used as templates and Sanger sequencing was performed using the BNA Real-time PCR Extended RAS Mutation Sequencing Primer (Riken Genesis) and the BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific). .. PCR products were purified with a BigDye XTerminator Purification Kit (Thermo Fisher Scientific) and subsequently sequenced on a 3500 Genetic Analyzer (Thermo Fisher Scientific).

    Isolation:

    Article Title: Highly Predictive Genetic Markers Distinguish Drug-Type from Fiber-Type Cannabis sativa L
    Article Snippet: Paragraph title: 2.3. Isolation and Sequencing of DNA ... The sequences were purified with a BigDye XTerminator Purification Kit and analyzed with an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: The Primers were designed, which refer to the GenBank Accession Number EU256388.1, the mitochondrial COX-1 gene of S. scabiei was isolated from Chongqing rabbit. .. The PCR products were purified according to the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

    Sequencing:

    Article Title: Are Long Noncoding RNAs New Potential Biomarkers in Gastrointestinal Stromal Tumors (GISTs)? The Role of H19 and MALAT1
    Article Snippet: We purified PCR products with PureLink® PCR Purification Kit (Thermo Fisher Scientific) and directly sequenced them using BigDye XTerminator® Purification Kit (Thermo Fisher Scientific) through the ABI 3130 XL Genetic Analyzer automated sequencer (Applied Biosystems). .. Sequence data were analyzed using Sequencing Analysis software 5.2 (Applied Biosystems).

    Article Title: Rapidly declining trend of signet ring cell cancer of the stomach may parallel the infection rate of Helicobacter pylori
    Article Snippet: Sanger sequencing was performed with BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) using forward or reverse primers. .. PCR products were purified BigDye XTerminator™ Purification Kit and subsequently analyzed by 3500 Genetic Analyzer (Thermo Fisher Scientific).

    Article Title: Evaluation of a Novel Mitochondrial Pan-Mucorales Marker for the Detection, Identification, Quantification, and Growth Stage Determination of Mucormycetes
    Article Snippet: .. DNA sequence analysis of the PCR products used the BigDye® Terminator v 3.1 Cycle Sequencing Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA) together with the BigDye XTerminator® Purification Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA). .. The products were sequenced using an ABI 3730 XL automatic sequencer (ThermoFisher Scientifics, Waltham, Massachusetts, USA).

    Article Title: Validation and Clinical Applications of a Comprehensive Next Generation Sequencing System for Molecular Characterization of Solid Cancer Tissues
    Article Snippet: .. The sequencing products were purified using the BigDye XTerminator Purification Kit (ThermoFisher). .. Capillary electrophoresis was performed on an Applied Biosystems® 3500 or 3730XL Genetic Analyzer.

    Article Title: Highly Predictive Genetic Markers Distinguish Drug-Type from Fiber-Type Cannabis sativa L
    Article Snippet: Paragraph title: 2.3. Isolation and Sequencing of DNA ... The sequences were purified with a BigDye XTerminator Purification Kit and analyzed with an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Accurate detection of KRAS, NRAS and BRAF mutations in metastatic colorectal cancers by bridged nucleic acid-clamp real-time PCR
    Article Snippet: Paragraph title: Sanger sequencing ... PCR products were purified with a BigDye XTerminator Purification Kit (Thermo Fisher Scientific) and subsequently sequenced on a 3500 Genetic Analyzer (Thermo Fisher Scientific).

    Article Title: Molecular Basis of Inherited Colorectal Carcinomas in the Macedonian Population: An Update
    Article Snippet: .. Sequencing products were purified using BigDye XTerminator® Purification Kit (Thermo Fisher Scientific) and analyzed with CE on a 3500 Genetic Analyzer (Thermo Fisher Scientific). .. The reference sequences used for variant nomenclature are given in Supplementary .

    Article Title: Validation of the Accuracy of Self-Reported ABO Blood Types in the Japan Nurses’ Health Study
    Article Snippet: .. DNA sequences of the PCR products were then analysed on the ABI 3130xl Prism Genetic Analyzer (Applied Biosystems) using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) and the BigDye XTerminator Purification Kit (Applied Biosystems). ..

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: The PCR products were purified with the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer. .. The sequence product was confirmed with Clone Manager Professional 9 (Sci-Ed Software) and the Neighbor-Joining method was done with MEGA6 to build a phylogenetic tree.

    Article Title: Prion Disease in Dromedary Camels, Algeria
    Article Snippet: .. We conducted sequencing reactions by using the BigDye Terminator v1.1 Cycle Sequencing Kit, purified using BigDye XTerminator Purification Kit, and detected with the ABI PRISM 3130 apparatus (all Applied Biosystems). .. We analyzed sequences by using Seq Scape version 2.5 (Applied Biosystems).

    Size-exclusion Chromatography:

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: PCR steps were done for 35 cycles in the following temperatures, initial denaturation (95°C 5 min), denaturation (95°C 30 sec), annealing (50°C 60 sec), extension (72°C 60 sec), and final extension (72°C 5 min). .. The PCR products were purified according to the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

    Infection:

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: The mites were collected and identified from rabbits that have an indication of scabies infection. .. The PCR products were purified with the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer.

    Purification:

    Article Title: Are Long Noncoding RNAs New Potential Biomarkers in Gastrointestinal Stromal Tumors (GISTs)? The Role of H19 and MALAT1
    Article Snippet: .. We purified PCR products with PureLink® PCR Purification Kit (Thermo Fisher Scientific) and directly sequenced them using BigDye XTerminator® Purification Kit (Thermo Fisher Scientific) through the ABI 3130 XL Genetic Analyzer automated sequencer (Applied Biosystems). .. Sequence data were analyzed using Sequencing Analysis software 5.2 (Applied Biosystems).

    Article Title: Rapidly declining trend of signet ring cell cancer of the stomach may parallel the infection rate of Helicobacter pylori
    Article Snippet: .. PCR products were purified BigDye XTerminator™ Purification Kit and subsequently analyzed by 3500 Genetic Analyzer (Thermo Fisher Scientific). ..

    Article Title: Evaluation of a Novel Mitochondrial Pan-Mucorales Marker for the Detection, Identification, Quantification, and Growth Stage Determination of Mucormycetes
    Article Snippet: .. DNA sequence analysis of the PCR products used the BigDye® Terminator v 3.1 Cycle Sequencing Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA) together with the BigDye XTerminator® Purification Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA). .. The products were sequenced using an ABI 3730 XL automatic sequencer (ThermoFisher Scientifics, Waltham, Massachusetts, USA).

    Article Title: Validation and Clinical Applications of a Comprehensive Next Generation Sequencing System for Molecular Characterization of Solid Cancer Tissues
    Article Snippet: .. The sequencing products were purified using the BigDye XTerminator Purification Kit (ThermoFisher). .. Capillary electrophoresis was performed on an Applied Biosystems® 3500 or 3730XL Genetic Analyzer.

    Article Title: Highly Predictive Genetic Markers Distinguish Drug-Type from Fiber-Type Cannabis sativa L
    Article Snippet: .. The sequences were purified with a BigDye XTerminator Purification Kit and analyzed with an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems). ..

    Article Title: Accurate detection of KRAS, NRAS and BRAF mutations in metastatic colorectal cancers by bridged nucleic acid-clamp real-time PCR
    Article Snippet: .. PCR products were purified with a BigDye XTerminator Purification Kit (Thermo Fisher Scientific) and subsequently sequenced on a 3500 Genetic Analyzer (Thermo Fisher Scientific). .. The data were analyzed by Sequencing Analysis Software v5.4 (Thermo Fisher Scientific) [ , , ].

    Article Title: Molecular Basis of Inherited Colorectal Carcinomas in the Macedonian Population: An Update
    Article Snippet: .. Sequencing products were purified using BigDye XTerminator® Purification Kit (Thermo Fisher Scientific) and analyzed with CE on a 3500 Genetic Analyzer (Thermo Fisher Scientific). .. The reference sequences used for variant nomenclature are given in Supplementary .

    Article Title: Validation of the Accuracy of Self-Reported ABO Blood Types in the Japan Nurses’ Health Study
    Article Snippet: .. DNA sequences of the PCR products were then analysed on the ABI 3130xl Prism Genetic Analyzer (Applied Biosystems) using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) and the BigDye XTerminator Purification Kit (Applied Biosystems). ..

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: .. The PCR products were purified with the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer. .. The sequence product was confirmed with Clone Manager Professional 9 (Sci-Ed Software) and the Neighbor-Joining method was done with MEGA6 to build a phylogenetic tree.

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: .. The PCR products were purified according to the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer (Applied Biosystems). .. Bioinformatics analysis The sequence was analyzed with program Clone Manager Professional 9 (Sci-Ed Software) where the reverse primer was inverted to make complete alignments.

    Electrophoresis:

    Article Title: Rapidly declining trend of signet ring cell cancer of the stomach may parallel the infection rate of Helicobacter pylori
    Article Snippet: Reactions were subject to thermal cycling with the following conditions: 94 °C for 2 min, 45 cycles of 94 °C for 15 s, 60 °C for 15 s, and 68 °C for 30 s. To determine the H. pylori- specific amplicon, 5 μL of the PCR products was separated by electrophoresis on 2% agarose gel, stained with ethidium bromide and visualized on an FAS IV UV Illuminator (NIPPON Genetics, Japan) [ , ]. .. PCR products were purified BigDye XTerminator™ Purification Kit and subsequently analyzed by 3500 Genetic Analyzer (Thermo Fisher Scientific).

    Article Title: Validation and Clinical Applications of a Comprehensive Next Generation Sequencing System for Molecular Characterization of Solid Cancer Tissues
    Article Snippet: The sequencing products were purified using the BigDye XTerminator Purification Kit (ThermoFisher). .. Capillary electrophoresis was performed on an Applied Biosystems® 3500 or 3730XL Genetic Analyzer.

    CTG Assay:

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: The forward primer is 5’-TCT TAG GGG CTG GAT TTA GTA TG-3’ and the reverse primer is 5’-AGT TCC TCT ACC AGT TCC AC-3’. .. The PCR products were purified according to the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

    Software:

    Article Title: Are Long Noncoding RNAs New Potential Biomarkers in Gastrointestinal Stromal Tumors (GISTs)? The Role of H19 and MALAT1
    Article Snippet: We purified PCR products with PureLink® PCR Purification Kit (Thermo Fisher Scientific) and directly sequenced them using BigDye XTerminator® Purification Kit (Thermo Fisher Scientific) through the ABI 3130 XL Genetic Analyzer automated sequencer (Applied Biosystems). .. Sequence data were analyzed using Sequencing Analysis software 5.2 (Applied Biosystems).

    Article Title: Evaluation of a Novel Mitochondrial Pan-Mucorales Marker for the Detection, Identification, Quantification, and Growth Stage Determination of Mucormycetes
    Article Snippet: Universal primers for amplification and sequencing, rnl_fw (5′-GCGAAATACCTTGGCCACTA–3′), and rnl_rv (5′–CCGGCTTATGCCATTACACT–3′) were designed using Geneious™ software v. 8.1.9 (Biomatters Limited, Auckland, NZ) to give a DNA fragment amplified from positions 1925 bp to 2314 bp of the R. arrhizus rnl gene (GenBank AY863212.1). .. DNA sequence analysis of the PCR products used the BigDye® Terminator v 3.1 Cycle Sequencing Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA) together with the BigDye XTerminator® Purification Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA).

    Article Title: Validation and Clinical Applications of a Comprehensive Next Generation Sequencing System for Molecular Characterization of Solid Cancer Tissues
    Article Snippet: The sequencing products were purified using the BigDye XTerminator Purification Kit (ThermoFisher). .. Sequence data was analyzed using the Mutation Surveyor DNA Variant Analysis Software (v4.0.9) (Softgenetics, State College, PA).

    Article Title: Accurate detection of KRAS, NRAS and BRAF mutations in metastatic colorectal cancers by bridged nucleic acid-clamp real-time PCR
    Article Snippet: PCR products were purified with a BigDye XTerminator Purification Kit (Thermo Fisher Scientific) and subsequently sequenced on a 3500 Genetic Analyzer (Thermo Fisher Scientific). .. The data were analyzed by Sequencing Analysis Software v5.4 (Thermo Fisher Scientific) [ , , ].

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: The PCR products were purified with the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer. .. The sequence product was confirmed with Clone Manager Professional 9 (Sci-Ed Software) and the Neighbor-Joining method was done with MEGA6 to build a phylogenetic tree.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Are Long Noncoding RNAs New Potential Biomarkers in Gastrointestinal Stromal Tumors (GISTs)? The Role of H19 and MALAT1
    Article Snippet: DNA Preparation and Mutation Screening Genomic DNA was extracted from FFPE tissues, using the QIAamp DNA FFPE Tissue Kit (Qiagen). .. We purified PCR products with PureLink® PCR Purification Kit (Thermo Fisher Scientific) and directly sequenced them using BigDye XTerminator® Purification Kit (Thermo Fisher Scientific) through the ABI 3130 XL Genetic Analyzer automated sequencer (Applied Biosystems).

    Construct:

    Article Title: Characterization of mitochondrial COX-1 gene of Sarcoptes scabiei from rabbits in East Java, Indonesia
    Article Snippet: PCR amplification was constructed in Biorad iCycles IQ. .. The PCR products were purified according to the protocol of the BigDye XTerminator™ Purification Kit (Thermo Scientific) and were double-sequenced with the forward and reverse PCR primers of ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

    Marker:

    Article Title: Evaluation of a Novel Mitochondrial Pan-Mucorales Marker for the Detection, Identification, Quantification, and Growth Stage Determination of Mucormycetes
    Article Snippet: Paragraph title: 2.2. rnl Marker Design ... DNA sequence analysis of the PCR products used the BigDye® Terminator v 3.1 Cycle Sequencing Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA) together with the BigDye XTerminator® Purification Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA).

    Staining:

    Article Title: Rapidly declining trend of signet ring cell cancer of the stomach may parallel the infection rate of Helicobacter pylori
    Article Snippet: Reactions were subject to thermal cycling with the following conditions: 94 °C for 2 min, 45 cycles of 94 °C for 15 s, 60 °C for 15 s, and 68 °C for 30 s. To determine the H. pylori- specific amplicon, 5 μL of the PCR products was separated by electrophoresis on 2% agarose gel, stained with ethidium bromide and visualized on an FAS IV UV Illuminator (NIPPON Genetics, Japan) [ , ]. .. PCR products were purified BigDye XTerminator™ Purification Kit and subsequently analyzed by 3500 Genetic Analyzer (Thermo Fisher Scientific).

    Article Title: Highly Predictive Genetic Markers Distinguish Drug-Type from Fiber-Type Cannabis sativa L
    Article Snippet: After being stained with ethidium bromide, the amplified products were photographed under UV light (254 nm). .. The sequences were purified with a BigDye XTerminator Purification Kit and analyzed with an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems).

    Variant Assay:

    Article Title: Validation and Clinical Applications of a Comprehensive Next Generation Sequencing System for Molecular Characterization of Solid Cancer Tissues
    Article Snippet: The sequencing products were purified using the BigDye XTerminator Purification Kit (ThermoFisher). .. Sequence data was analyzed using the Mutation Surveyor DNA Variant Analysis Software (v4.0.9) (Softgenetics, State College, PA).

    Article Title: Molecular Basis of Inherited Colorectal Carcinomas in the Macedonian Population: An Update
    Article Snippet: Sequencing products were purified using BigDye XTerminator® Purification Kit (Thermo Fisher Scientific) and analyzed with CE on a 3500 Genetic Analyzer (Thermo Fisher Scientific). .. The reference sequences used for variant nomenclature are given in Supplementary .

    In Silico:

    Article Title: Evaluation of a Novel Mitochondrial Pan-Mucorales Marker for the Detection, Identification, Quantification, and Growth Stage Determination of Mucormycetes
    Article Snippet: 2.2. rnl Marker Design The discriminatory power of the mitochondrial rnl gene was evaluated in silico using reference mitochondrial genomes of three Mucorales species: Rhizopus arrhizus , Lichtheimia hongkongensis (syn. .. DNA sequence analysis of the PCR products used the BigDye® Terminator v 3.1 Cycle Sequencing Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA) together with the BigDye XTerminator® Purification Kit (ThermoFisher Scientifics, Waltham, Massachusetts, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher bigdye xterminator purification kit
    Bigdye Xterminator Purification Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 237 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bigdye xterminator purification kit/product/Thermo Fisher
    Average 90 stars, based on 237 article reviews
    Price from $9.99 to $1999.99
    bigdye xterminator purification kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results