bigdye terminator v1 1 cycle sequencing kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BigDye Terminator v1.1 Cycle Sequencing Kit
    Description:

    Catalog Number:
    BTVCSK3693469
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher bigdye terminator v1 1 cycle sequencing kit
    The DNA sequencing of rs840088. Direct sequencing of a subgroup of samples with the same primers for PCR-RFLP was performed using the <t>BigDye</t> Terminator <t>v1.1</t> Cycle Sequencing kit (Applied Biosystems), and analyzed on an ABI PRISM 3100 DNA sequencer (Applied Biosystems, Foster City, USA). (A) GG genotype. (B) GA genotype. (C) AA genotype. 82×48 mm (300×300 DPI).

    https://www.bioz.com/result/bigdye terminator v1 1 cycle sequencing kit/product/Thermo Fisher
    Average 99 stars, based on 308 article reviews
    Price from $9.99 to $1999.99
    bigdye terminator v1 1 cycle sequencing kit - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "The Association of SERPINE2 Gene with COPD in a Chinese Han Population"

    Article Title: The Association of SERPINE2 Gene with COPD in a Chinese Han Population

    Journal: Yonsei Medical Journal

    doi: 10.3349/ymj.2011.52.6.953

    The DNA sequencing of rs840088. Direct sequencing of a subgroup of samples with the same primers for PCR-RFLP was performed using the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems), and analyzed on an ABI PRISM 3100 DNA sequencer (Applied Biosystems, Foster City, USA). (A) GG genotype. (B) GA genotype. (C) AA genotype. 82×48 mm (300×300 DPI).
    Figure Legend Snippet: The DNA sequencing of rs840088. Direct sequencing of a subgroup of samples with the same primers for PCR-RFLP was performed using the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems), and analyzed on an ABI PRISM 3100 DNA sequencer (Applied Biosystems, Foster City, USA). (A) GG genotype. (B) GA genotype. (C) AA genotype. 82×48 mm (300×300 DPI).

    Techniques Used: DNA Sequencing, Sequencing, Polymerase Chain Reaction

    2) Product Images from "An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules"

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkn956

    Overview of in vitro selection using a Ds -containing DNA library. ( a ) Scheme for in vitro selection using the Ds -containing DNA library, by FAM-hx- Px incorporation into PCR products and isolation with an anti-fluorescein antibody. A chemically synthesized, single-stranded DNA library containing an NNN Ds NNN sequence (55-mer) was amplified by 10 cycles of PCR, in the presence of natural dNTPs, d Ds TP and FAM-hx-d Px TP, with DeepVent DNA Pol. After selection of the PCR products containing FAM-hx- Px by binding with an anti-fluorescein antibody, the isolated DNA fragments were used as a template for the next round of PCR amplification and selection. For direct sequencing of the library after five rounds of selection, the isolated DNA fragments were amplified in the presence of NH 2 -hx-d Px TP, instead of FAM-hx-d Px TP ( Figure 3 a), by eight cycles of PCR. Direct sequencing was performed in the presence of 2 μM d Pa′ TP, using a BigDye terminator v1.1 Cycle Sequencing kit. For the sequencing of clones after five rounds of selection, the library was amplified in the presence of only the natural dNTPs with Taq DNA polymerase, and the PCR products were used for TOPO TA cloning. ( b ) Sequencing of the DNA library after five rounds of selection. ( c ) Sequencing of the initial library. The arrow indicates the unnatural base position. ( d ) Probability (%) of occurrence at each position of the selected 66-clone sequences ( Supplementary Figure 1 ). Bases with an occurrence rate of ≥35% among the clones are colored red.
    Figure Legend Snippet: Overview of in vitro selection using a Ds -containing DNA library. ( a ) Scheme for in vitro selection using the Ds -containing DNA library, by FAM-hx- Px incorporation into PCR products and isolation with an anti-fluorescein antibody. A chemically synthesized, single-stranded DNA library containing an NNN Ds NNN sequence (55-mer) was amplified by 10 cycles of PCR, in the presence of natural dNTPs, d Ds TP and FAM-hx-d Px TP, with DeepVent DNA Pol. After selection of the PCR products containing FAM-hx- Px by binding with an anti-fluorescein antibody, the isolated DNA fragments were used as a template for the next round of PCR amplification and selection. For direct sequencing of the library after five rounds of selection, the isolated DNA fragments were amplified in the presence of NH 2 -hx-d Px TP, instead of FAM-hx-d Px TP ( Figure 3 a), by eight cycles of PCR. Direct sequencing was performed in the presence of 2 μM d Pa′ TP, using a BigDye terminator v1.1 Cycle Sequencing kit. For the sequencing of clones after five rounds of selection, the library was amplified in the presence of only the natural dNTPs with Taq DNA polymerase, and the PCR products were used for TOPO TA cloning. ( b ) Sequencing of the DNA library after five rounds of selection. ( c ) Sequencing of the initial library. The arrow indicates the unnatural base position. ( d ) Probability (%) of occurrence at each position of the selected 66-clone sequences ( Supplementary Figure 1 ). Bases with an occurrence rate of ≥35% among the clones are colored red.

    Techniques Used: In Vitro, Selection, Polymerase Chain Reaction, Isolation, Synthesized, Sequencing, Amplification, Binding Assay, Clone Assay, TA Cloning

    Related Articles

    Clone Assay:

    Article Title: Identification of a PH domain-containing protein which is localized to crystalloid bodies of Plasmodium ookinetes
    Article Snippet: The amplified PyCryPH DNA fragment was cloned into the pEU-E01-HisGST (TEV)-N2 vector (CellFree Sciences) between the XhoI and BamHI recognition sites. .. The DNA sequence of the insert was confirmed using an ABI PRISM 3100 Genetic Analyzer and a BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Amplification:

    Article Title: Tumor molecular profiling of NSCLC patients using next generation sequencing
    Article Snippet: For the Sanger sequencing reaction, PCR amplification products were purified using the NucleoFast® 96 PCR Clean-up kit (Macherey-Nagel, Düren, Germany), according to the manufacturer's protocol. .. The purified product (7 µl) was used for the sequencing reaction using the BigDye® Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Inc., Foster City, CA, USA).

    Article Title: Mitochondria DNA Change and Oxidative Damage in Clinically Stable Patients with Major Depressive Disorder
    Article Snippet: Two primer sets were used for PCR amplification: (1) mtF10126 (5'- GACTACCACAACTCAACGGC-3') and mtR10629 (5'-GGGAGTGGGTGTT-GAGGG- 3'), (2) mtF4881 (5'- CCCATCTCAATCATATACCA- 3') and mtR5539 (5'-TCTTGGTCTG TATTTAACCTA- 3'). .. Then the PCR products were sequenced using an ABI 3130xl genetic analyzer and a BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, Foster City, CA).

    Article Title: Ambulatory Pediatric Surveillance of Hand, Foot and Mouth Disease as Signal of an Outbreak of Coxsackievirus A6 Infections, France, 2014–2015
    Article Snippet: Alternatively, genotyping was attempted with nonspecies-specific primers to amplify the partial VP1 gene ( ). .. Visible RT-PCR products after gel electrophoresis were purified and subjected to nucleotide sequencing with the same primers used for the amplification for the semi-nested RT-PCR A or, as previously described ( , ), by using the BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Ville-bon sur Yvette, France). .. The sequencing was performed on an ABI3500Dx genetic analyzer (Thermo Fisher Scientific).

    Article Title: Detection of tumor ALK status in neuroblastoma patients using peripheral blood
    Article Snippet: After amplification of ALK exons 23–25, PCR products were purified with Illustra Exostar (GE Healthcare Europe GmbH, Velizy-Villacoublay, France) for 15 min at 37°C and 15 min by 80°C. .. A sequencing reaction was set up with 1 μ l of purified PCR products and the BigDye® Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Saint Aubin, France) following the manufacturer's instructions.

    Article Title: A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagellation. A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagell
    Article Snippet: Amplified PyMDV1/PEG3, α‐tublin‐II Pyg377, or Pys25 DNA fragments were independently inserted between the XhoI and BamHI sites of plasmid pEU‐E01‐HisGST(TEV)‐N2 (CellFree Sciences). .. DNA sequences of the inserts were confirmed using the ABI PRISM 3100 Genetic Analyzer and the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Article Title: Identification of a PH domain-containing protein which is localized to crystalloid bodies of Plasmodium ookinetes
    Article Snippet: The amplified PyCryPH DNA fragment was cloned into the pEU-E01-HisGST (TEV)-N2 vector (CellFree Sciences) between the XhoI and BamHI recognition sites. .. The DNA sequence of the insert was confirmed using an ABI PRISM 3100 Genetic Analyzer and a BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Article Title: Autism spectrum disorder associated with low serotonin in CSF and mutations in the SLC29A4 plasma membrane monoamine transporter (PMAT) gene
    Article Snippet: The PCR reactions were performed in a GeneAmp PCR System 9700 from (Life Technologies, Zug, Switzerland) using standard thermal cycling: hot start activation at 95°C for 15 minutes, followed by 35 cycles of denaturation 95°C for 1 minute, annealing 55°C for 45 seconds, and extension at 72°C for 1 minute, a final extension was performed at 72°C for 10 minutes and termination at 4°C. .. The same forward and reverse primers as mentioned above were used to sequence the amplified PCR products with BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). .. Sequencing PCR was performed in a 10 μLreaction mixture consisting of 0.5 μL PCR product, 0.8 μL primer (5 μM), 1.5 μLBigDye, and 1.25 μL5× sequencing buffer (BigDye and 5 × sequencing buffer were both from BigDye Terminator v1.1 Cycle Sequencing Kit from Applied Biosystems) using standard thermal cycling: (activation at 95°C for 1 min, followed by 25 cycles of 96°C for 10 seconds, 50°C for 5 seconds, 60°C for 3 minutes and termination at 4°C).

    Article Title: Targeting Aspergillus fumigatus Crf Transglycosylases With Neutralizing Antibody Is Relevant but Not Sufficient to Erase Fungal Burden in a Neutropenic Rat Model
    Article Snippet: After DNA recovery, an amplification PCR was carried out using forward primer CCCAGTAGACTCGAGCTAGC and reverse primer CCCGATGCCGAAATGTATAG (Eurogentec, Angers, France) specific for CRF1 gene, with an initial denaturation of 3 min at 94°C, followed by 35 cycles (30 s at 94°C, 30 s at 55°C, 45 s at 72°C), and a final elongation step of 15 min at 72°C. .. Sequencing was performed using BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific), with in addition of the primers cited above, the following supplementary primers: CTTCCTTGACAAAACGCTCC, CCTGGCACAGGTGTTGTTAG, ACGTCAAGTCCGTCCGTATC, and AGCTAGAGCCAGAGCCAGAG.

    Article Title: No association of CpG island methylator phenotype and colorectal cancer survival: population-based study
    Article Snippet: In the remaining tumour samples, KRAS mutation (N =178) and BRAF mutation (N =242) were determined by Sanger sequencing: exon 2 of KRAS and exon 15 of BRAF were amplified by PCR using FideliTaq polymerase (Affymetrix, Santa Clara, CA, USA) and the following primers: KRAS fw: 5′-GTGTGACATGTTCTAATATAGTCA-3′ and KRAS rv: 5′-GAATGGTCCTGCACCAGTAA-3′ BRAF fw: 5′-TGCTTGCTCTGATAGGAAAATG-3′ and BRAF rv: 5′-AGCATCTCAGGGCCAAAAAT-3′. .. After purification, Sanger sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA, USA) according to standard protocols.

    Filtration:

    Article Title: Autism spectrum disorder associated with low serotonin in CSF and mutations in the SLC29A4 plasma membrane monoamine transporter (PMAT) gene
    Article Snippet: The same forward and reverse primers as mentioned above were used to sequence the amplified PCR products with BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). .. Sequencing PCR was performed in a 10 μLreaction mixture consisting of 0.5 μL PCR product, 0.8 μL primer (5 μM), 1.5 μLBigDye, and 1.25 μL5× sequencing buffer (BigDye and 5 × sequencing buffer were both from BigDye Terminator v1.1 Cycle Sequencing Kit from Applied Biosystems) using standard thermal cycling: (activation at 95°C for 1 min, followed by 25 cycles of 96°C for 10 seconds, 50°C for 5 seconds, 60°C for 3 minutes and termination at 4°C).

    Polymerase Chain Reaction:

    Article Title: Tumor molecular profiling of NSCLC patients using next generation sequencing
    Article Snippet: For the Sanger sequencing reaction, PCR amplification products were purified using the NucleoFast® 96 PCR Clean-up kit (Macherey-Nagel, Düren, Germany), according to the manufacturer's protocol. .. The purified product (7 µl) was used for the sequencing reaction using the BigDye® Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Inc., Foster City, CA, USA).

    Article Title: Mitochondria DNA Change and Oxidative Damage in Clinically Stable Patients with Major Depressive Disorder
    Article Snippet: The PCR reaction mixture contained 20 ng DNA, 375 mmol/L of each dNTP, 50 nmol of each primer, 1X PCR buffer, and 2.5U Taq DNA polymerase (BD Biosciences, San Jose, CA) in a final volume of 20 μL. .. Then the PCR products were sequenced using an ABI 3130xl genetic analyzer and a BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, Foster City, CA). .. Many different types of somatic mtDNA mutations have been observed, with the dmtDNA4977 being the most common in humans [ ].

    Article Title: A new highly sensitive real-time quantitative-PCR method for detection of BCR-ABL1 to monitor minimal residual disease in chronic myeloid leukemia after discontinuation of imatinib
    Article Snippet: BCR-ABL1 PCR products were separated and purified using agarose gel electrophoresis and a QIAquick Gel Extraction Kit (Qiagen). .. Cycle sequencing was performed using a BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, USA).

    Article Title: Response of recurrent BRAFV600E mutated ganglioglioma to Vemurafenib as single agent
    Article Snippet: The integrity of the resulting cDNA was checked by amplifying the wild-type locus of the BRAF gene (in exon 6 / 7) and then submitted to PCR with specific pairs of primers flanking the fusion point between the KIAA1549 (in exon 15 or 16) and BRAF (in exon 9 or 11) genes as described by Jones et al. [ ]. .. The purified PCR products were then sequenced using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Courtaboeuf, France) with the forward and reverse primer used to perform the PCR. .. Sequencing was performed using the ABI 3130 XL DNA analyser (Applied Biosystem).

    Article Title: Differentiation-Dependent Regulation of Human Endogenous Retrovirus K Sequences and Neighboring Genes in Germ Cell Tumor Cells
    Article Snippet: Polymerase chain reaction products were purified with NucleoSpin Gel and PCR Clean-up (Machery-Nagel, Düren, Germany). .. Sequencing of PCR products was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Austin, TX, United States). .. Open reading frames in the intergenic region between PRODH and DGCR5 were identified by using getorf .

    Article Title: Detection of tumor ALK status in neuroblastoma patients using peripheral blood
    Article Snippet: After amplification of ALK exons 23–25, PCR products were purified with Illustra Exostar (GE Healthcare Europe GmbH, Velizy-Villacoublay, France) for 15 min at 37°C and 15 min by 80°C. .. A sequencing reaction was set up with 1 μ l of purified PCR products and the BigDye® Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Saint Aubin, France) following the manufacturer's instructions. .. The purification of the DNA sequencing reactions was performed by precipitation with ethanol and washing with 70% ethanol for removing nonincorporated BigDye® terminators and salts.

    Article Title: A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagellation. A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagell
    Article Snippet: A fragment encoding Pys25 (amino acid positions [aa] 24–193) was amplified from PyWT ookinete cDNA by PCR, using primer pairs Pys25 CF std F (5′‐gagagagactcgag ATG GCAATTACACCAGCAACTCAATGTA‐3′) and Pys25 CF std R , (5′‐gagagagaggatcc CTA GTGATGATGATGATGATGGATACATTTTTCTTCTTCAACGCTAAG‐3′). .. DNA sequences of the inserts were confirmed using the ABI PRISM 3100 Genetic Analyzer and the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Article Title: Autism spectrum disorder associated with low serotonin in CSF and mutations in the SLC29A4 plasma membrane monoamine transporter (PMAT) gene
    Article Snippet: The PCR reactions were performed in a GeneAmp PCR System 9700 from (Life Technologies, Zug, Switzerland) using standard thermal cycling: hot start activation at 95°C for 15 minutes, followed by 35 cycles of denaturation 95°C for 1 minute, annealing 55°C for 45 seconds, and extension at 72°C for 1 minute, a final extension was performed at 72°C for 10 minutes and termination at 4°C. .. The same forward and reverse primers as mentioned above were used to sequence the amplified PCR products with BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). .. Sequencing PCR was performed in a 10 μLreaction mixture consisting of 0.5 μL PCR product, 0.8 μL primer (5 μM), 1.5 μLBigDye, and 1.25 μL5× sequencing buffer (BigDye and 5 × sequencing buffer were both from BigDye Terminator v1.1 Cycle Sequencing Kit from Applied Biosystems) using standard thermal cycling: (activation at 95°C for 1 min, followed by 25 cycles of 96°C for 10 seconds, 50°C for 5 seconds, 60°C for 3 minutes and termination at 4°C).

    Article Title: Peptide-mediated delivery of donor mitochondria improves mitochondrial function and cell viability in human cybrid cells with the MELAS A3243G mutation
    Article Snippet: The proportion of mtDNA with the A3243G mutation in each group was calculated by normalizing the mutant DNA fragments of length 233 and 213 bp to total band intensity using GelPro Analyzer (Media Cybernetics, Silver Spring, MD, USA). .. The mtDNA A3243G mutation ratio was determined by sequencing the PCR products, which were randomly sampled then sequenced using an ABI 3130xl genetic analyzer and a BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, Foster City, CA). .. To confirm the sequencing results, the position 3243 A to G mutation of mtDNA heteroplasmy was performed by using an automated DNA sequencer (ABI Prism 310 Genetic Analyzer, PE Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions.

    Article Title: Targeting Aspergillus fumigatus Crf Transglycosylases With Neutralizing Antibody Is Relevant but Not Sufficient to Erase Fungal Burden in a Neutropenic Rat Model
    Article Snippet: After DNA recovery, an amplification PCR was carried out using forward primer CCCAGTAGACTCGAGCTAGC and reverse primer CCCGATGCCGAAATGTATAG (Eurogentec, Angers, France) specific for CRF1 gene, with an initial denaturation of 3 min at 94°C, followed by 35 cycles (30 s at 94°C, 30 s at 55°C, 45 s at 72°C), and a final elongation step of 15 min at 72°C. .. Sequencing was performed using BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific), with in addition of the primers cited above, the following supplementary primers: CTTCCTTGACAAAACGCTCC, CCTGGCACAGGTGTTGTTAG, ACGTCAAGTCCGTCCGTATC, and AGCTAGAGCCAGAGCCAGAG.

    Article Title: No association of CpG island methylator phenotype and colorectal cancer survival: population-based study
    Article Snippet: In the remaining tumour samples, KRAS mutation (N =178) and BRAF mutation (N =242) were determined by Sanger sequencing: exon 2 of KRAS and exon 15 of BRAF were amplified by PCR using FideliTaq polymerase (Affymetrix, Santa Clara, CA, USA) and the following primers: KRAS fw: 5′-GTGTGACATGTTCTAATATAGTCA-3′ and KRAS rv: 5′-GAATGGTCCTGCACCAGTAA-3′ BRAF fw: 5′-TGCTTGCTCTGATAGGAAAATG-3′ and BRAF rv: 5′-AGCATCTCAGGGCCAAAAAT-3′. .. After purification, Sanger sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA, USA) according to standard protocols.

    Article Title: Left Atrial Appendage Thrombus Formation in a Patient on Dabigatran Therapy Associated With ABCB1 and CES-1 Genetic Defect
    Article Snippet: Sequencing was performed on 1 μl of the purified mixture using the BigDye Terminator v1.1 Cycle Sequencing kit (Life Technologies, Warsaw, Poland) and an ABI 3130 Automatic Capillary DNA Sequencer. .. Sequencing was performed on 1 μl of the purified mixture using the BigDye Terminator v1.1 Cycle Sequencing kit (Life Technologies, Warsaw, Poland) and an ABI 3130 Automatic Capillary DNA Sequencer.

    Electrophoresis:

    Article Title: Peptide-mediated delivery of donor mitochondria improves mitochondrial function and cell viability in human cybrid cells with the MELAS A3243G mutation
    Article Snippet: Digested products were visualized by electrophoresis on a 4% agarose gel with 0.3 μg/mL ethidium bromide. .. The mtDNA A3243G mutation ratio was determined by sequencing the PCR products, which were randomly sampled then sequenced using an ABI 3130xl genetic analyzer and a BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, Foster City, CA).

    Microarray:

    Article Title: No association of CpG island methylator phenotype and colorectal cancer survival: population-based study
    Article Snippet: In most tumour samples, KRAS mutation was determined by single-stranded conformational polymorphism technique (SSCP) using the same DNA sample, and expression of BRAF V600E was determined by immunohistochemical analyses in sections of tissue microarray blocks and evaluated by two pathologists independently ( ). .. After purification, Sanger sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA, USA) according to standard protocols.

    Incubation:

    Article Title: Detection of tumor ALK status in neuroblastoma patients using peripheral blood
    Article Snippet: A sequencing reaction was set up with 1 μ l of purified PCR products and the BigDye® Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Saint Aubin, France) following the manufacturer's instructions. .. The purification of the DNA sequencing reactions was performed by precipitation with ethanol and washing with 70% ethanol for removing nonincorporated BigDye® terminators and salts.

    Expressing:

    Article Title: No association of CpG island methylator phenotype and colorectal cancer survival: population-based study
    Article Snippet: In most tumour samples, KRAS mutation was determined by single-stranded conformational polymorphism technique (SSCP) using the same DNA sample, and expression of BRAF V600E was determined by immunohistochemical analyses in sections of tissue microarray blocks and evaluated by two pathologists independently ( ). .. After purification, Sanger sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA, USA) according to standard protocols.

    Modification:

    Article Title: WebHERV: A Web Server for the Computational Investigation of Gene Expression Associated With Endogenous Retrovirus-Like Sequences
    Article Snippet: Transcripts of CYP4Z1 in HL cells were characterized by using a modified SMART (switching mechanism at 5′ end of RNA transcript) technique as described in Kewitz et al. ( ). .. Sequencing of RT-PCR products was performed using the BigDye Terminator V1.1 Cycle Sequencing Kit (Life Technologies, Austin, TX, USA).

    Hybridization:

    Article Title: Ambulatory Pediatric Surveillance of Hand, Foot and Mouth Disease as Signal of an Outbreak of Coxsackievirus A6 Infections, France, 2014–2015
    Article Snippet: The amplification programs were the same as those described except for the hybridization step, which was performed at 58°C. .. Visible RT-PCR products after gel electrophoresis were purified and subjected to nucleotide sequencing with the same primers used for the amplification for the semi-nested RT-PCR A or, as previously described ( , ), by using the BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Ville-bon sur Yvette, France).

    Countercurrent Chromatography:

    Article Title: Response of recurrent BRAFV600E mutated ganglioglioma to Vemurafenib as single agent
    Article Snippet: The purified PCR products were then sequenced using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Courtaboeuf, France) with the forward and reverse primer used to perform the PCR. .. Sequencing was performed using the ABI 3130 XL DNA analyser (Applied Biosystem).

    Flow Cytometry:

    Article Title: A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagellation. A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagell
    Article Snippet: DNA sequences of the inserts were confirmed using the ABI PRISM 3100 Genetic Analyzer and the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA). .. Expressed recombinant PyMDV1/PEG3 or Pys25 was captured by a glutathione‐Sepharose 4B column and eluted with elution buffer (40 mM reduced glutathione, 50 mM Tris‐HCl, 300 mM NaCl, 200 mM Imidazole, 2%glycerole, and pH 8.0).

    Gas Chromatography:

    Article Title: WebHERV: A Web Server for the Computational Investigation of Gene Expression Associated With Endogenous Retrovirus-Like Sequences
    Article Snippet: The following primers were used: CYP4Z1-E1-3: 5′-ttc ttg ctg ctg atc ctc ct-3′, 5′-ccc agg att caa gga ttt tg-3′; CYP4Z1-HERVLE: 5′-tca gca aac tat cgc aag ga-3′, 5′-tag ggg ttg tgg tga aga gc-3′. .. Sequencing of RT-PCR products was performed using the BigDye Terminator V1.1 Cycle Sequencing Kit (Life Technologies, Austin, TX, USA).

    Concentration Assay:

    Article Title: Ambulatory Pediatric Surveillance of Hand, Foot and Mouth Disease as Signal of an Outbreak of Coxsackievirus A6 Infections, France, 2014–2015
    Article Snippet: The second round RT-PCR A assays were performed in a final volume of 50 µL by using the Taq polymerase Kit (QIAGEN) and contained 5 µL of the first RT-PCR A amplicons and primers HEVAS1405 and HEVAR2429 (5′-GTNGGRTANCCRTCRTARAACC-3′, location 2,450–2,429) at a final concentration of 0.4 µmol/L. .. Visible RT-PCR products after gel electrophoresis were purified and subjected to nucleotide sequencing with the same primers used for the amplification for the semi-nested RT-PCR A or, as previously described ( , ), by using the BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Ville-bon sur Yvette, France).

    Infection:

    Article Title: Ambulatory Pediatric Surveillance of Hand, Foot and Mouth Disease as Signal of an Outbreak of Coxsackievirus A6 Infections, France, 2014–2015
    Article Snippet: Paragraph title: Diagnosis of Enterovirus Infection and Molecular Typing of Strains in Clinical Specimens ... Visible RT-PCR products after gel electrophoresis were purified and subjected to nucleotide sequencing with the same primers used for the amplification for the semi-nested RT-PCR A or, as previously described ( , ), by using the BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Ville-bon sur Yvette, France).

    DNA Sequencing:

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: Paragraph title: DNA sequencing ... The cycle sequencing reaction (20 μl) was performed with the Cycle Sequencing Mix (8 μl) from the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems), containing ∼0.3 pmol of the template and 4 pmol of the sequencing primer (20-mer), in the presence of 40 pmol or 1 nmol of 4-propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde 5′-triphosphate (d Pa′ TP) (40 pmol for DNA fragments containing one Ds base and 1 nmol for DNAs with two Ds bases) or 1 nmol of dd Pa′ TP.

    Article Title: The Association of SERPINE2 Gene with COPD in a Chinese Han Population
    Article Snippet: Paragraph title: DNA sequencing ... Sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems), and analyzed on an ABI PRISM 3100 DNA sequencer (Applied Biosystems, Foster City, CA, USA).

    Protein Concentration:

    Article Title: Identification of a PH domain-containing protein which is localized to crystalloid bodies of Plasmodium ookinetes
    Article Snippet: The DNA sequence of the insert was confirmed using an ABI PRISM 3100 Genetic Analyzer and a BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA). .. Protein synthesis was confirmed by separation on SDS-PAGE under reducing condition and visualized with Coomassie Brilliant Blue protein staining.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Ambulatory Pediatric Surveillance of Hand, Foot and Mouth Disease as Signal of an Outbreak of Coxsackievirus A6 Infections, France, 2014–2015
    Article Snippet: Alternatively, genotyping was attempted with nonspecies-specific primers to amplify the partial VP1 gene ( ). .. Visible RT-PCR products after gel electrophoresis were purified and subjected to nucleotide sequencing with the same primers used for the amplification for the semi-nested RT-PCR A or, as previously described ( , ), by using the BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Ville-bon sur Yvette, France). .. The sequencing was performed on an ABI3500Dx genetic analyzer (Thermo Fisher Scientific).

    Article Title: Response of recurrent BRAFV600E mutated ganglioglioma to Vemurafenib as single agent
    Article Snippet: Reverse-transcription polymerase chain reaction (RT-PCR) was performed on 1 μg of total RNA using High Capacity cDNA Reverse Transcriptionkit (Life Technologies) according to the manufacturer’s protocol. .. The purified PCR products were then sequenced using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Courtaboeuf, France) with the forward and reverse primer used to perform the PCR.

    Article Title: WebHERV: A Web Server for the Computational Investigation of Gene Expression Associated With Endogenous Retrovirus-Like Sequences
    Article Snippet: Transcripts of CYP4Z1 in HL cells were characterized by using a modified SMART (switching mechanism at 5′ end of RNA transcript) technique as described in Kewitz et al. ( ). .. Sequencing of RT-PCR products was performed using the BigDye Terminator V1.1 Cycle Sequencing Kit (Life Technologies, Austin, TX, USA). .. The sequences were analyzed by BLAST (Altschul et al., ), and splice-site prediction was performed by Human Splicing Finder (Desmet et al., ).

    Affinity Purification:

    Article Title: A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagellation. A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagell
    Article Snippet: DNA sequences of the inserts were confirmed using the ABI PRISM 3100 Genetic Analyzer and the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA). .. The recombinant proteins were expressed using a wheat germ cell‐free system (CellFree Sciences, Matsuyama, Japan) (Tsuboi, Takeo, et al., ; Tsuboi, Takeo, Sawasaki, et al., ).

    Recombinant:

    Article Title: A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagellation. A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagell
    Article Snippet: Paragraph title: 4.5. Recombinant proteins and antisera production ... DNA sequences of the inserts were confirmed using the ABI PRISM 3100 Genetic Analyzer and the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Article Title: Identification of a PH domain-containing protein which is localized to crystalloid bodies of Plasmodium ookinetes
    Article Snippet: Paragraph title: Recombinant proteins and antiserum production ... The DNA sequence of the insert was confirmed using an ABI PRISM 3100 Genetic Analyzer and a BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Cellular Antioxidant Activity Assay:

    Article Title: WebHERV: A Web Server for the Computational Investigation of Gene Expression Associated With Endogenous Retrovirus-Like Sequences
    Article Snippet: The following primers were used: CYP4Z1-E1-3: 5′-ttc ttg ctg ctg atc ctc ct-3′, 5′-ccc agg att caa gga ttt tg-3′; CYP4Z1-HERVLE: 5′-tca gca aac tat cgc aag ga-3′, 5′-tag ggg ttg tgg tga aga gc-3′. .. Sequencing of RT-PCR products was performed using the BigDye Terminator V1.1 Cycle Sequencing Kit (Life Technologies, Austin, TX, USA).

    Nucleic Acid Electrophoresis:

    Article Title: Ambulatory Pediatric Surveillance of Hand, Foot and Mouth Disease as Signal of an Outbreak of Coxsackievirus A6 Infections, France, 2014–2015
    Article Snippet: Alternatively, genotyping was attempted with nonspecies-specific primers to amplify the partial VP1 gene ( ). .. Visible RT-PCR products after gel electrophoresis were purified and subjected to nucleotide sequencing with the same primers used for the amplification for the semi-nested RT-PCR A or, as previously described ( , ), by using the BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Ville-bon sur Yvette, France). .. The sequencing was performed on an ABI3500Dx genetic analyzer (Thermo Fisher Scientific).

    Methylation:

    Article Title: No association of CpG island methylator phenotype and colorectal cancer survival: population-based study
    Article Snippet: The CIMP status was defined according to the number of hypermethylated loci: hypermethylation at 3 or more loci was classified as CIMP-high, methylation at 1 or 2 loci was classified as CIMP-low (CIMP-L) and if none of the loci was methylated, CIMP status was negative (CIMP-N). .. After purification, Sanger sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA, USA) according to standard protocols.

    Mutagenesis:

    Article Title: Tumor molecular profiling of NSCLC patients using next generation sequencing
    Article Snippet: EGFR exon 18, 19, 20, 21, KRAS and NRAS exon 2,3,4 and BRAF exon 11 and 15 mutation analysis was carried out by high resolution melting curve (HRM) analysis followed by sequencing analysis as previously described ( , ). .. The purified product (7 µl) was used for the sequencing reaction using the BigDye® Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Inc., Foster City, CA, USA).

    Article Title: Detection of tumor ALK status in neuroblastoma patients using peripheral blood
    Article Snippet: A sequencing reaction was set up with 1 μ l of purified PCR products and the BigDye® Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Saint Aubin, France) following the manufacturer's instructions. .. Sequencing analyses were carried out on the 48 capillary 3730 DNA Analyzer (Life Technologies).

    Article Title: Autism spectrum disorder associated with low serotonin in CSF and mutations in the SLC29A4 plasma membrane monoamine transporter (PMAT) gene
    Article Snippet: The same forward and reverse primers as mentioned above were used to sequence the amplified PCR products with BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). .. After end run, 15 μL H2 O was added to the sequencing reactions before purified by gel filtration (using MultiScreen HV 96-well filter plates (Merck Millipore, Darmstadt, Germany) with Sephadex G-50 (GE Healthcare, Little Chalfont, UK) and analyzed on a 3130xl Genetic Analyzer (Applied Biosystems).

    Article Title: Peptide-mediated delivery of donor mitochondria improves mitochondrial function and cell viability in human cybrid cells with the MELAS A3243G mutation
    Article Snippet: The proportion of mtDNA with the A3243G mutation in each group was calculated by normalizing the mutant DNA fragments of length 233 and 213 bp to total band intensity using GelPro Analyzer (Media Cybernetics, Silver Spring, MD, USA). .. The mtDNA A3243G mutation ratio was determined by sequencing the PCR products, which were randomly sampled then sequenced using an ABI 3130xl genetic analyzer and a BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, Foster City, CA). .. To confirm the sequencing results, the position 3243 A to G mutation of mtDNA heteroplasmy was performed by using an automated DNA sequencer (ABI Prism 310 Genetic Analyzer, PE Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions.

    Article Title: No association of CpG island methylator phenotype and colorectal cancer survival: population-based study
    Article Snippet: In the remaining tumour samples, KRAS mutation (N =178) and BRAF mutation (N =242) were determined by Sanger sequencing: exon 2 of KRAS and exon 15 of BRAF were amplified by PCR using FideliTaq polymerase (Affymetrix, Santa Clara, CA, USA) and the following primers: KRAS fw: 5′-GTGTGACATGTTCTAATATAGTCA-3′ and KRAS rv: 5′-GAATGGTCCTGCACCAGTAA-3′ BRAF fw: 5′-TGCTTGCTCTGATAGGAAAATG-3′ and BRAF rv: 5′-AGCATCTCAGGGCCAAAAAT-3′. .. After purification, Sanger sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA, USA) according to standard protocols.

    CTG Assay:

    Article Title: WebHERV: A Web Server for the Computational Investigation of Gene Expression Associated With Endogenous Retrovirus-Like Sequences
    Article Snippet: The following primers were used: CYP4Z1-E1-3: 5′-ttc ttg ctg ctg atc ctc ct-3′, 5′-ccc agg att caa gga ttt tg-3′; CYP4Z1-HERVLE: 5′-tca gca aac tat cgc aag ga-3′, 5′-tag ggg ttg tgg tga aga gc-3′. .. Sequencing of RT-PCR products was performed using the BigDye Terminator V1.1 Cycle Sequencing Kit (Life Technologies, Austin, TX, USA).

    Immunohistochemistry:

    Article Title: No association of CpG island methylator phenotype and colorectal cancer survival: population-based study
    Article Snippet: In most tumour samples, KRAS mutation was determined by single-stranded conformational polymorphism technique (SSCP) using the same DNA sample, and expression of BRAF V600E was determined by immunohistochemical analyses in sections of tissue microarray blocks and evaluated by two pathologists independently ( ). .. After purification, Sanger sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA, USA) according to standard protocols.

    Purification:

    Article Title: Tumor molecular profiling of NSCLC patients using next generation sequencing
    Article Snippet: For the Sanger sequencing reaction, PCR amplification products were purified using the NucleoFast® 96 PCR Clean-up kit (Macherey-Nagel, Düren, Germany), according to the manufacturer's protocol. .. The purified product (7 µl) was used for the sequencing reaction using the BigDye® Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Inc., Foster City, CA, USA). .. Sequencing reaction products were purified prior to electrophoresis using the Montage™ SEQ96 Sequencing Reaction kit (EMD Millipore Corporation, Billerica, MA, USA).

    Article Title: A new highly sensitive real-time quantitative-PCR method for detection of BCR-ABL1 to monitor minimal residual disease in chronic myeloid leukemia after discontinuation of imatinib
    Article Snippet: BCR-ABL1 PCR products were separated and purified using agarose gel electrophoresis and a QIAquick Gel Extraction Kit (Qiagen). .. Cycle sequencing was performed using a BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, USA).

    Article Title: Ambulatory Pediatric Surveillance of Hand, Foot and Mouth Disease as Signal of an Outbreak of Coxsackievirus A6 Infections, France, 2014–2015
    Article Snippet: Alternatively, genotyping was attempted with nonspecies-specific primers to amplify the partial VP1 gene ( ). .. Visible RT-PCR products after gel electrophoresis were purified and subjected to nucleotide sequencing with the same primers used for the amplification for the semi-nested RT-PCR A or, as previously described ( , ), by using the BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Ville-bon sur Yvette, France). .. The sequencing was performed on an ABI3500Dx genetic analyzer (Thermo Fisher Scientific).

    Article Title: Response of recurrent BRAFV600E mutated ganglioglioma to Vemurafenib as single agent
    Article Snippet: The integrity of the resulting cDNA was checked by amplifying the wild-type locus of the BRAF gene (in exon 6 / 7) and then submitted to PCR with specific pairs of primers flanking the fusion point between the KIAA1549 (in exon 15 or 16) and BRAF (in exon 9 or 11) genes as described by Jones et al. [ ]. .. The purified PCR products were then sequenced using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Courtaboeuf, France) with the forward and reverse primer used to perform the PCR. .. Sequencing was performed using the ABI 3130 XL DNA analyser (Applied Biosystem).

    Article Title: Differentiation-Dependent Regulation of Human Endogenous Retrovirus K Sequences and Neighboring Genes in Germ Cell Tumor Cells
    Article Snippet: Polymerase chain reaction products were purified with NucleoSpin Gel and PCR Clean-up (Machery-Nagel, Düren, Germany). .. Sequencing of PCR products was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Austin, TX, United States).

    Article Title: Detection of tumor ALK status in neuroblastoma patients using peripheral blood
    Article Snippet: After amplification of ALK exons 23–25, PCR products were purified with Illustra Exostar (GE Healthcare Europe GmbH, Velizy-Villacoublay, France) for 15 min at 37°C and 15 min by 80°C. .. A sequencing reaction was set up with 1 μ l of purified PCR products and the BigDye® Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Saint Aubin, France) following the manufacturer's instructions. .. The purification of the DNA sequencing reactions was performed by precipitation with ethanol and washing with 70% ethanol for removing nonincorporated BigDye® terminators and salts.

    Article Title: Autism spectrum disorder associated with low serotonin in CSF and mutations in the SLC29A4 plasma membrane monoamine transporter (PMAT) gene
    Article Snippet: The same forward and reverse primers as mentioned above were used to sequence the amplified PCR products with BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). .. Sequencing PCR was performed in a 10 μLreaction mixture consisting of 0.5 μL PCR product, 0.8 μL primer (5 μM), 1.5 μLBigDye, and 1.25 μL5× sequencing buffer (BigDye and 5 × sequencing buffer were both from BigDye Terminator v1.1 Cycle Sequencing Kit from Applied Biosystems) using standard thermal cycling: (activation at 95°C for 1 min, followed by 25 cycles of 96°C for 10 seconds, 50°C for 5 seconds, 60°C for 3 minutes and termination at 4°C).

    Article Title: No association of CpG island methylator phenotype and colorectal cancer survival: population-based study
    Article Snippet: In the remaining tumour samples, KRAS mutation (N =178) and BRAF mutation (N =242) were determined by Sanger sequencing: exon 2 of KRAS and exon 15 of BRAF were amplified by PCR using FideliTaq polymerase (Affymetrix, Santa Clara, CA, USA) and the following primers: KRAS fw: 5′-GTGTGACATGTTCTAATATAGTCA-3′ and KRAS rv: 5′-GAATGGTCCTGCACCAGTAA-3′ BRAF fw: 5′-TGCTTGCTCTGATAGGAAAATG-3′ and BRAF rv: 5′-AGCATCTCAGGGCCAAAAAT-3′. .. After purification, Sanger sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA, USA) according to standard protocols. .. Samples were sequenced on an ABI 3500 Genetic Analyzer (Life Technologies).

    Article Title: Left Atrial Appendage Thrombus Formation in a Patient on Dabigatran Therapy Associated With ABCB1 and CES-1 Genetic Defect
    Article Snippet: The polymerase chain reaction primers were presented in Table . .. Sequencing was performed on 1 μl of the purified mixture using the BigDye Terminator v1.1 Cycle Sequencing kit (Life Technologies, Warsaw, Poland) and an ABI 3130 Automatic Capillary DNA Sequencer. .. Several reasons that contributed to treatment failure with dabigatran should be considered in this case: (1) the patient is a 70-year-old Chinese male and had a moderate renal insufficiency (estimated glomerular filtration rate of 55 mL/min); (2) the drug-drug interaction between dabigatran and atorvastatin was present; (3) as shown in Table , The patient is a heterozygote carrier of ABCB1 variant alleles with 7 heterozygote single nucleotide polymorphisms (SNPs: rs4148738, rs2235046, rs1128503, rs10276036, rs1202169, rs1202168, rs1202167) as well as CES-1 variant alleles with 2 homozygote SNPs (rs2244613 and rs4122238) and 2 heterozygote SNPs (rs8192935 and rs4580160).

    Sequencing:

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: For the sequencing analysis, the PCR products were purified by denaturing 8–15% PAGE, unless otherwise noted. .. The cycle sequencing reaction (20 μl) was performed with the Cycle Sequencing Mix (8 μl) from the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems), containing ∼0.3 pmol of the template and 4 pmol of the sequencing primer (20-mer), in the presence of 40 pmol or 1 nmol of 4-propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde 5′-triphosphate (d Pa′ TP) (40 pmol for DNA fragments containing one Ds base and 1 nmol for DNAs with two Ds bases) or 1 nmol of dd Pa′ TP. .. After 25 cycles of PCR (96°C, 10 s; 50°C, 5 s; 60°C, 4 min), the residual dye terminators were removed from the reaction with CENTRI-SEP columns (Princeton Separations), and the solutions were dried.

    Article Title: The Association of SERPINE2 Gene with COPD in a Chinese Han Population
    Article Snippet: Direct sequencing of a subgroup of samples with the same primers was used to further validate the authenticity of genotype analysis. .. Sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems), and analyzed on an ABI PRISM 3100 DNA sequencer (Applied Biosystems, Foster City, CA, USA). .. Patient and case-control age is expressed as mean±SD.

    Article Title: Tumor molecular profiling of NSCLC patients using next generation sequencing
    Article Snippet: For the Sanger sequencing reaction, PCR amplification products were purified using the NucleoFast® 96 PCR Clean-up kit (Macherey-Nagel, Düren, Germany), according to the manufacturer's protocol. .. The purified product (7 µl) was used for the sequencing reaction using the BigDye® Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Inc., Foster City, CA, USA). .. Sequencing reaction products were purified prior to electrophoresis using the Montage™ SEQ96 Sequencing Reaction kit (EMD Millipore Corporation, Billerica, MA, USA).

    Article Title: Mitochondria DNA Change and Oxidative Damage in Clinically Stable Patients with Major Depressive Disorder
    Article Snippet: The PCR reaction mixture contained 20 ng DNA, 375 mmol/L of each dNTP, 50 nmol of each primer, 1X PCR buffer, and 2.5U Taq DNA polymerase (BD Biosciences, San Jose, CA) in a final volume of 20 μL. .. Then the PCR products were sequenced using an ABI 3130xl genetic analyzer and a BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, Foster City, CA). .. Many different types of somatic mtDNA mutations have been observed, with the dmtDNA4977 being the most common in humans [ ].

    Article Title: A new highly sensitive real-time quantitative-PCR method for detection of BCR-ABL1 to monitor minimal residual disease in chronic myeloid leukemia after discontinuation of imatinib
    Article Snippet: BCR-ABL1 PCR products were separated and purified using agarose gel electrophoresis and a QIAquick Gel Extraction Kit (Qiagen). .. Cycle sequencing was performed using a BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, USA). .. Cycle sequencing products were purified using a BigDye Xterminator Purification Kit (Applied Biosystems, Foster City, USA) before being run on an automated ABI 3500 genetic analyzer (Applied Biosystems), and sequences were analyzed using Sequencing Analysis software ver.6.

    Article Title: Ambulatory Pediatric Surveillance of Hand, Foot and Mouth Disease as Signal of an Outbreak of Coxsackievirus A6 Infections, France, 2014–2015
    Article Snippet: Alternatively, genotyping was attempted with nonspecies-specific primers to amplify the partial VP1 gene ( ). .. Visible RT-PCR products after gel electrophoresis were purified and subjected to nucleotide sequencing with the same primers used for the amplification for the semi-nested RT-PCR A or, as previously described ( , ), by using the BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Ville-bon sur Yvette, France). .. The sequencing was performed on an ABI3500Dx genetic analyzer (Thermo Fisher Scientific).

    Article Title: Response of recurrent BRAFV600E mutated ganglioglioma to Vemurafenib as single agent
    Article Snippet: The integrity of the resulting cDNA was checked by amplifying the wild-type locus of the BRAF gene (in exon 6 / 7) and then submitted to PCR with specific pairs of primers flanking the fusion point between the KIAA1549 (in exon 15 or 16) and BRAF (in exon 9 or 11) genes as described by Jones et al. [ ]. .. The purified PCR products were then sequenced using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Courtaboeuf, France) with the forward and reverse primer used to perform the PCR. .. Sequencing was performed using the ABI 3130 XL DNA analyser (Applied Biosystem).

    Article Title: Differentiation-Dependent Regulation of Human Endogenous Retrovirus K Sequences and Neighboring Genes in Germ Cell Tumor Cells
    Article Snippet: Polymerase chain reaction products were purified with NucleoSpin Gel and PCR Clean-up (Machery-Nagel, Düren, Germany). .. Sequencing of PCR products was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Austin, TX, United States). .. Open reading frames in the intergenic region between PRODH and DGCR5 were identified by using getorf .

    Article Title: WebHERV: A Web Server for the Computational Investigation of Gene Expression Associated With Endogenous Retrovirus-Like Sequences
    Article Snippet: Transcripts of CYP4Z1 in HL cells were characterized by using a modified SMART (switching mechanism at 5′ end of RNA transcript) technique as described in Kewitz et al. ( ). .. Sequencing of RT-PCR products was performed using the BigDye Terminator V1.1 Cycle Sequencing Kit (Life Technologies, Austin, TX, USA). .. The sequences were analyzed by BLAST (Altschul et al., ), and splice-site prediction was performed by Human Splicing Finder (Desmet et al., ).

    Article Title: Detection of tumor ALK status in neuroblastoma patients using peripheral blood
    Article Snippet: After amplification of ALK exons 23–25, PCR products were purified with Illustra Exostar (GE Healthcare Europe GmbH, Velizy-Villacoublay, France) for 15 min at 37°C and 15 min by 80°C. .. A sequencing reaction was set up with 1 μ l of purified PCR products and the BigDye® Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Saint Aubin, France) following the manufacturer's instructions. .. The purification of the DNA sequencing reactions was performed by precipitation with ethanol and washing with 70% ethanol for removing nonincorporated BigDye® terminators and salts.

    Article Title: A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagellation. A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagell
    Article Snippet: Amplified PyMDV1/PEG3, α‐tublin‐II Pyg377, or Pys25 DNA fragments were independently inserted between the XhoI and BamHI sites of plasmid pEU‐E01‐HisGST(TEV)‐N2 (CellFree Sciences). .. DNA sequences of the inserts were confirmed using the ABI PRISM 3100 Genetic Analyzer and the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA). .. The recombinant proteins were expressed using a wheat germ cell‐free system (CellFree Sciences, Matsuyama, Japan) (Tsuboi, Takeo, et al., ; Tsuboi, Takeo, Sawasaki, et al., ).

    Article Title: Identification of a PH domain-containing protein which is localized to crystalloid bodies of Plasmodium ookinetes
    Article Snippet: The amplified PyCryPH DNA fragment was cloned into the pEU-E01-HisGST (TEV)-N2 vector (CellFree Sciences) between the XhoI and BamHI recognition sites. .. The DNA sequence of the insert was confirmed using an ABI PRISM 3100 Genetic Analyzer and a BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA). .. Py CryPH GST fusion recombinant protein was expressed using the wheat germ cell-free protein synthesis system (CellFree Sciences), and then tag-free rCryPH was purified by on-column cleavage using AcTEV protease (Invitrogen, Carlsbad, CA, USA) and the glutathione-Sepharose 4B column (GE Healthcare, Camarillo, CA, USA).

    Article Title: Autism spectrum disorder associated with low serotonin in CSF and mutations in the SLC29A4 plasma membrane monoamine transporter (PMAT) gene
    Article Snippet: The PCR reactions were performed in a GeneAmp PCR System 9700 from (Life Technologies, Zug, Switzerland) using standard thermal cycling: hot start activation at 95°C for 15 minutes, followed by 35 cycles of denaturation 95°C for 1 minute, annealing 55°C for 45 seconds, and extension at 72°C for 1 minute, a final extension was performed at 72°C for 10 minutes and termination at 4°C. .. The same forward and reverse primers as mentioned above were used to sequence the amplified PCR products with BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). .. Sequencing PCR was performed in a 10 μLreaction mixture consisting of 0.5 μL PCR product, 0.8 μL primer (5 μM), 1.5 μLBigDye, and 1.25 μL5× sequencing buffer (BigDye and 5 × sequencing buffer were both from BigDye Terminator v1.1 Cycle Sequencing Kit from Applied Biosystems) using standard thermal cycling: (activation at 95°C for 1 min, followed by 25 cycles of 96°C for 10 seconds, 50°C for 5 seconds, 60°C for 3 minutes and termination at 4°C).

    Article Title: Peptide-mediated delivery of donor mitochondria improves mitochondrial function and cell viability in human cybrid cells with the MELAS A3243G mutation
    Article Snippet: The proportion of mtDNA with the A3243G mutation in each group was calculated by normalizing the mutant DNA fragments of length 233 and 213 bp to total band intensity using GelPro Analyzer (Media Cybernetics, Silver Spring, MD, USA). .. The mtDNA A3243G mutation ratio was determined by sequencing the PCR products, which were randomly sampled then sequenced using an ABI 3130xl genetic analyzer and a BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, Foster City, CA). .. To confirm the sequencing results, the position 3243 A to G mutation of mtDNA heteroplasmy was performed by using an automated DNA sequencer (ABI Prism 310 Genetic Analyzer, PE Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions.

    Article Title: Targeting Aspergillus fumigatus Crf Transglycosylases With Neutralizing Antibody Is Relevant but Not Sufficient to Erase Fungal Burden in a Neutropenic Rat Model
    Article Snippet: After DNA recovery, an amplification PCR was carried out using forward primer CCCAGTAGACTCGAGCTAGC and reverse primer CCCGATGCCGAAATGTATAG (Eurogentec, Angers, France) specific for CRF1 gene, with an initial denaturation of 3 min at 94°C, followed by 35 cycles (30 s at 94°C, 30 s at 55°C, 45 s at 72°C), and a final elongation step of 15 min at 72°C. .. Sequencing was performed using BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific), with in addition of the primers cited above, the following supplementary primers: CTTCCTTGACAAAACGCTCC, CCTGGCACAGGTGTTGTTAG, ACGTCAAGTCCGTCCGTATC, and AGCTAGAGCCAGAGCCAGAG. .. Sanger capillary electrophoresis was realized with 3130xl Genetic Analyzer (Applied Biosystems, Villebon-sur-Yvette, France), as recommended by the supplier instructions.

    Article Title: No association of CpG island methylator phenotype and colorectal cancer survival: population-based study
    Article Snippet: In the remaining tumour samples, KRAS mutation (N =178) and BRAF mutation (N =242) were determined by Sanger sequencing: exon 2 of KRAS and exon 15 of BRAF were amplified by PCR using FideliTaq polymerase (Affymetrix, Santa Clara, CA, USA) and the following primers: KRAS fw: 5′-GTGTGACATGTTCTAATATAGTCA-3′ and KRAS rv: 5′-GAATGGTCCTGCACCAGTAA-3′ BRAF fw: 5′-TGCTTGCTCTGATAGGAAAATG-3′ and BRAF rv: 5′-AGCATCTCAGGGCCAAAAAT-3′. .. After purification, Sanger sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA, USA) according to standard protocols. .. Samples were sequenced on an ABI 3500 Genetic Analyzer (Life Technologies).

    Article Title: Left Atrial Appendage Thrombus Formation in a Patient on Dabigatran Therapy Associated With ABCB1 and CES-1 Genetic Defect
    Article Snippet: The polymerase chain reaction primers were presented in Table . .. Sequencing was performed on 1 μl of the purified mixture using the BigDye Terminator v1.1 Cycle Sequencing kit (Life Technologies, Warsaw, Poland) and an ABI 3130 Automatic Capillary DNA Sequencer. .. Several reasons that contributed to treatment failure with dabigatran should be considered in this case: (1) the patient is a 70-year-old Chinese male and had a moderate renal insufficiency (estimated glomerular filtration rate of 55 mL/min); (2) the drug-drug interaction between dabigatran and atorvastatin was present; (3) as shown in Table , The patient is a heterozygote carrier of ABCB1 variant alleles with 7 heterozygote single nucleotide polymorphisms (SNPs: rs4148738, rs2235046, rs1128503, rs10276036, rs1202169, rs1202168, rs1202167) as well as CES-1 variant alleles with 2 homozygote SNPs (rs2244613 and rs4122238) and 2 heterozygote SNPs (rs8192935 and rs4580160).

    Bradford Protein Assay:

    Article Title: Identification of a PH domain-containing protein which is localized to crystalloid bodies of Plasmodium ookinetes
    Article Snippet: The DNA sequence of the insert was confirmed using an ABI PRISM 3100 Genetic Analyzer and a BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA). .. Protein synthesis was confirmed by separation on SDS-PAGE under reducing condition and visualized with Coomassie Brilliant Blue protein staining.

    Gel Extraction:

    Article Title: A new highly sensitive real-time quantitative-PCR method for detection of BCR-ABL1 to monitor minimal residual disease in chronic myeloid leukemia after discontinuation of imatinib
    Article Snippet: BCR-ABL1 PCR products were separated and purified using agarose gel electrophoresis and a QIAquick Gel Extraction Kit (Qiagen). .. Cycle sequencing was performed using a BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, USA).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Response of recurrent BRAFV600E mutated ganglioglioma to Vemurafenib as single agent
    Article Snippet: The purified PCR products were then sequenced using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Courtaboeuf, France) with the forward and reverse primer used to perform the PCR. .. Sequencing was performed using the ABI 3130 XL DNA analyser (Applied Biosystem).

    SDS Page:

    Article Title: Identification of a PH domain-containing protein which is localized to crystalloid bodies of Plasmodium ookinetes
    Article Snippet: The DNA sequence of the insert was confirmed using an ABI PRISM 3100 Genetic Analyzer and a BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA). .. Py CryPH GST fusion recombinant protein was expressed using the wheat germ cell-free protein synthesis system (CellFree Sciences), and then tag-free rCryPH was purified by on-column cleavage using AcTEV protease (Invitrogen, Carlsbad, CA, USA) and the glutathione-Sepharose 4B column (GE Healthcare, Camarillo, CA, USA).

    Plasmid Preparation:

    Article Title: A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagellation. A male gametocyte osmiophilic body and microgamete surface protein of the rodent malaria parasite Plasmodium yoelii (PyMiGS) plays a critical role in male osmiophilic body formation and exflagell
    Article Snippet: Amplified PyMDV1/PEG3, α‐tublin‐II Pyg377, or Pys25 DNA fragments were independently inserted between the XhoI and BamHI sites of plasmid pEU‐E01‐HisGST(TEV)‐N2 (CellFree Sciences). .. DNA sequences of the inserts were confirmed using the ABI PRISM 3100 Genetic Analyzer and the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Article Title: Identification of a PH domain-containing protein which is localized to crystalloid bodies of Plasmodium ookinetes
    Article Snippet: The amplified PyCryPH DNA fragment was cloned into the pEU-E01-HisGST (TEV)-N2 vector (CellFree Sciences) between the XhoI and BamHI recognition sites. .. The DNA sequence of the insert was confirmed using an ABI PRISM 3100 Genetic Analyzer and a BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Software:

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: The cycle sequencing reaction (20 μl) was performed with the Cycle Sequencing Mix (8 μl) from the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems), containing ∼0.3 pmol of the template and 4 pmol of the sequencing primer (20-mer), in the presence of 40 pmol or 1 nmol of 4-propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde 5′-triphosphate (d Pa′ TP) (40 pmol for DNA fragments containing one Ds base and 1 nmol for DNAs with two Ds bases) or 1 nmol of dd Pa′ TP. .. The cycle sequencing reaction (20 μl) was performed with the Cycle Sequencing Mix (8 μl) from the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems), containing ∼0.3 pmol of the template and 4 pmol of the sequencing primer (20-mer), in the presence of 40 pmol or 1 nmol of 4-propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde 5′-triphosphate (d Pa′ TP) (40 pmol for DNA fragments containing one Ds base and 1 nmol for DNAs with two Ds bases) or 1 nmol of dd Pa′ TP.

    Article Title: Autism spectrum disorder associated with low serotonin in CSF and mutations in the SLC29A4 plasma membrane monoamine transporter (PMAT) gene
    Article Snippet: The same forward and reverse primers as mentioned above were used to sequence the amplified PCR products with BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). .. After end run, 15 μL H2 O was added to the sequencing reactions before purified by gel filtration (using MultiScreen HV 96-well filter plates (Merck Millipore, Darmstadt, Germany) with Sephadex G-50 (GE Healthcare, Little Chalfont, UK) and analyzed on a 3130xl Genetic Analyzer (Applied Biosystems).

    Article Title: Targeting Aspergillus fumigatus Crf Transglycosylases With Neutralizing Antibody Is Relevant but Not Sufficient to Erase Fungal Burden in a Neutropenic Rat Model
    Article Snippet: Sequencing was performed using BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific), with in addition of the primers cited above, the following supplementary primers: CTTCCTTGACAAAACGCTCC, CCTGGCACAGGTGTTGTTAG, ACGTCAAGTCCGTCCGTATC, and AGCTAGAGCCAGAGCCAGAG. .. Sanger capillary electrophoresis was realized with 3130xl Genetic Analyzer (Applied Biosystems, Villebon-sur-Yvette, France), as recommended by the supplier instructions.

    Agarose Gel Electrophoresis:

    Article Title: A new highly sensitive real-time quantitative-PCR method for detection of BCR-ABL1 to monitor minimal residual disease in chronic myeloid leukemia after discontinuation of imatinib
    Article Snippet: BCR-ABL1 PCR products were separated and purified using agarose gel electrophoresis and a QIAquick Gel Extraction Kit (Qiagen). .. Cycle sequencing was performed using a BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, USA).

    Article Title: Peptide-mediated delivery of donor mitochondria improves mitochondrial function and cell viability in human cybrid cells with the MELAS A3243G mutation
    Article Snippet: Digested products were visualized by electrophoresis on a 4% agarose gel with 0.3 μg/mL ethidium bromide. .. The mtDNA A3243G mutation ratio was determined by sequencing the PCR products, which were randomly sampled then sequenced using an ABI 3130xl genetic analyzer and a BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, Foster City, CA).

    Produced:

    Article Title: Identification of a PH domain-containing protein which is localized to crystalloid bodies of Plasmodium ookinetes
    Article Snippet: Recombinant Py CryPH (rCryPH) was produced using the wheat germ cell-free protein synthesis system (CellFree Sciences, Matsuyama, Japan) as described [ , ]. .. The DNA sequence of the insert was confirmed using an ABI PRISM 3100 Genetic Analyzer and a BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA).

    Activation Assay:

    Article Title: Autism spectrum disorder associated with low serotonin in CSF and mutations in the SLC29A4 plasma membrane monoamine transporter (PMAT) gene
    Article Snippet: The PCR reactions were performed in a GeneAmp PCR System 9700 from (Life Technologies, Zug, Switzerland) using standard thermal cycling: hot start activation at 95°C for 15 minutes, followed by 35 cycles of denaturation 95°C for 1 minute, annealing 55°C for 45 seconds, and extension at 72°C for 1 minute, a final extension was performed at 72°C for 10 minutes and termination at 4°C. .. The same forward and reverse primers as mentioned above were used to sequence the amplified PCR products with BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems).

    Marker:

    Article Title: No association of CpG island methylator phenotype and colorectal cancer survival: population-based study
    Article Snippet: A mononucleotide marker panel (BAT25, BAT26 and CAT25) was used to screen for MSI-high (MSI-H) ( ). .. After purification, Sanger sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA, USA) according to standard protocols.

    Staining:

    Article Title: Identification of a PH domain-containing protein which is localized to crystalloid bodies of Plasmodium ookinetes
    Article Snippet: The DNA sequence of the insert was confirmed using an ABI PRISM 3100 Genetic Analyzer and a BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA). .. Py CryPH GST fusion recombinant protein was expressed using the wheat germ cell-free protein synthesis system (CellFree Sciences), and then tag-free rCryPH was purified by on-column cleavage using AcTEV protease (Invitrogen, Carlsbad, CA, USA) and the glutathione-Sepharose 4B column (GE Healthcare, Camarillo, CA, USA).

    Variant Assay:

    Article Title: Autism spectrum disorder associated with low serotonin in CSF and mutations in the SLC29A4 plasma membrane monoamine transporter (PMAT) gene
    Article Snippet: The same forward and reverse primers as mentioned above were used to sequence the amplified PCR products with BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). .. Sequencing results were compared with wild-type sequence of the SLC29A4 gene by using Mutation Surveyor (Demo) Software v3.20 from SoftGenetics (State College, PA, USA; Transcript ID: ENST00000297195 or accession number NM_001040661).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher bigdye terminator v1 1 cycle sequencing kit
    Bigdye Terminator V1 1 Cycle Sequencing Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 308 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bigdye terminator v1 1 cycle sequencing kit/product/Thermo Fisher
    Average 99 stars, based on 308 article reviews
    Price from $9.99 to $1999.99
    bigdye terminator v1 1 cycle sequencing kit - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results