bglii  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    Bgl II
    Description:
    Bgl II recognizes the sequence A↓GAT CT and generates fragments with 5 cohesive termini Bgl II is not inhibited by dam methylation that overlaps the site indicated on the recognition sequence but is sensitive to 5 methyl and 5 hydroxymethylcytosine at the other site indicated Bgl II is not known to have isoschizomers Bgl II cannot be heat inactivated by incubating it for 15 minutes at 65C The incubation temperature is 37 C
    Catalog Number:
    bglii-ro
    Price:
    None
    Applications:
    Bgl II has been used for the digestion of the genomic DNA.
    Buy from Supplier


    Structured Review

    Millipore bglii
    Bgl II recognizes the sequence A↓GAT CT and generates fragments with 5 cohesive termini Bgl II is not inhibited by dam methylation that overlaps the site indicated on the recognition sequence but is sensitive to 5 methyl and 5 hydroxymethylcytosine at the other site indicated Bgl II is not known to have isoschizomers Bgl II cannot be heat inactivated by incubating it for 15 minutes at 65C The incubation temperature is 37 C
    https://www.bioz.com/result/bglii/product/Millipore
    Average 94 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    bglii - by Bioz Stars, 2020-07
    94/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Toxoplasma gondii Recombinant antigen AMA1: Diagnostic Utility of Protein Fragments for the Detection of IgG and IgM Antibodies
    Article Snippet: .. The final PCR products were inserted into the Bgl II and Xho I sites (ama1 and ama1C ) or into the Bgl II and Eco RV sites (ama1N ) of the pET30 Ek/LIC vector (Novagen) using the In-Fusion® HD Cloning Kit (Takara Bio USA, Inc.). .. The resulting recombinant plasmids, pET30/AMA1N (containing amino acid residues 67–287 of AMA1), pET30/AMA1C (containing amino acid residues 287–569 of AMA1) and pET30/AMA1 (containing amino acid residues 67–569 of AMA1), were embedded in a frame between the His6 -tag domains for purification of the recombinant proteins by means of metal affinity chromatography.

    Article Title: Effect of single-chain antibody targeting of the ligand-binding domain in the anaplastic lymphoma kinase receptor
    Article Snippet: .. For scFv protein production in mammalian cells, the scFvs cDNAs were cloned into the Not I and Bgl II sites of pFLAG-CMV-3 vector (see ; Sigma-Aldrich, St Louis, MO, USA) without the C-terminal His-tag of the scFvs used for bacterial expression. .. For tetracycline-inducible expression, the scFvs were cloned into pTREx-DEST30 (see ; Invitrogen, Carlsbad, CA, USA).

    Article Title: Control of Mammalian Circadian Rhythm by CKI?-Regulated Proteasome-Mediated PER2 Degradation
    Article Snippet: .. FLAG epitope-tagged mPER2 was generated by PCR cloning that engineered a BglII site at its amino terminus and a SalI site at its carboxyl terminus. pFLAG-CMV-2 (Sigma) and the PCR product were digested with BglII and SalI and were ligated. β-TrCP(ΔF-box) was also cloned into pCS2+MT by a PCR-based strategy that resulted in an NcoI site at its amino terminus and XhoI at its carboxyl terminus. .. Both the PCR product and pCS2+MT were subsequently cut with NcoI and XhoI and ligated together. mPER2 point mutations and internal deletions were generated by using a QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's directions.

    Positron Emission Tomography:

    Article Title: RNA Imaging with Dimeric Broccoli in Live Bacterial and Mammalian Cells
    Article Snippet: .. The plasmid is generated by inserting dBroccoli with a part of T7 promoter into pET-28c-Broccoli ( ) cut with Bgl II and Nhe I enzymes. pET28c (Novagen) LB media with kanamycin (see recipe) LB/agar dishes with kanamycin (see recipe) Super Optimum Culture Media (SOC, Life Technologies, cat. no. 15544) Chemically competent Escherichia coli BL21 Star (DE3) cells (Invitrogen, cat. no. C6010-03) 1 M IPTG solution (see recipe) 1.5 ml microcentrifuge tubes (USA Scientific, cat. no. 1615–5500) Petri dishes (VWR International, cat. no. 25384–094) Culture tubes (VWR International, cat. no. 60818–667) 25-ml Erlenmeyer flasks with baffles (Corning, cat. no. 355115) Parafilm 42 °C water bath or heat block 37 °C air incubator Orbital shaker Cuvettes for NanoDrop (VWR International, cat. no. 470138–468) Microcentrifuge (Eppendorf, cat. no. 5424) NanoDrop (Thermo Scientific) or similar instrument .. pAVU6+27 plasmid , available by request from the corresponding author of the reference publication. pAV5S plasmid , available by request from the corresponding author of the reference publication. pAVU6+27-F30-2xdBroccoli plasmid (available at Addgene) ( ). pAV5S-F30-2xdBroccoli plasmid (available at Addgene).

    Agarose Gel Electrophoresis:

    Article Title: Transgenic Mice Expressing Yeast CUP1 Exhibit Increased Copper Utilization from Feeds
    Article Snippet: .. Twenty micrograms of DNA was restriction digested with Bgl II and Ssp I, fractionated in a 0.8% agarose gel electrophoresis, and transferred to a nylon membrane (Millipore, UK). .. The fragment containing the complete ORF of yeast CUP1 was amplified by PCR using specific primers (forward primer 5′TGGGGAATCAGTAGGAAGTCTTGGC 3′, reverse primer 5′CCCCAGAATAGAATGACACCTACTC 3′), and the fragment length was 832 bp.

    In Vitro:

    Article Title: Vanillin production using metabolically engineered Escherichia coli under non-growing conditions
    Article Snippet: .. Inactivation of the vanillin dehydrogenase encoding gene was obtained by a frameshift mutation generated after digestion of plasmid molecules containing the 5098-bp catabolic cassette with Bgl II, fill-in reaction with "End Conversion Mix" (Novagen; Madison, WI) to produce blunt ends, and re-circularization, in-vitro , of the plasmid DNA with T4 DNA ligase. .. This frameshift mutation can be predicted to generate a truncated vanillin dehydrogenase that resulted to be unable to oxidize vanillin to vanillic acid.

    Ligation:

    Article Title: An Alternative Model for the Role of RP2 Protein in Flagellum Assembly in the African Trypanosome *
    Article Snippet: .. Preparation of Recombinant TbRP2 Protein and Anti-TbRP2 Polyclonal Antisera The Tb RP2 open reading frame was amplified by PCR, and the resultant amplicon was digested with NdeI and BglII for ligation into NdeI-BglII-digested pET15b (Novagen), thereby generating a recombinant gene to facilitate expression of Tb RP2 protein containing a hexahistidine tag at its N terminus. .. The resulting plasmid was sequenced using ABI prism sequencing technology (Source Bioscience).

    Mutagenesis:

    Article Title: Vanillin production using metabolically engineered Escherichia coli under non-growing conditions
    Article Snippet: .. Inactivation of the vanillin dehydrogenase encoding gene was obtained by a frameshift mutation generated after digestion of plasmid molecules containing the 5098-bp catabolic cassette with Bgl II, fill-in reaction with "End Conversion Mix" (Novagen; Madison, WI) to produce blunt ends, and re-circularization, in-vitro , of the plasmid DNA with T4 DNA ligase. .. This frameshift mutation can be predicted to generate a truncated vanillin dehydrogenase that resulted to be unable to oxidize vanillin to vanillic acid.

    Blocking Assay:

    Article Title: RNA Imaging with Dimeric Broccoli in Live Bacterial and Mammalian Cells
    Article Snippet: .. The plasmid is generated by inserting dBroccoli with a part of T7 promoter into pET-28c-Broccoli ( ) cut with Bgl II and Nhe I enzymes. pET28c (Novagen) LB media with kanamycin (see recipe) LB/agar dishes with kanamycin (see recipe) Super Optimum Culture Media (SOC, Life Technologies, cat. no. 15544) Chemically competent Escherichia coli BL21 Star (DE3) cells (Invitrogen, cat. no. C6010-03) 1 M IPTG solution (see recipe) 1.5 ml microcentrifuge tubes (USA Scientific, cat. no. 1615–5500) Petri dishes (VWR International, cat. no. 25384–094) Culture tubes (VWR International, cat. no. 60818–667) 25-ml Erlenmeyer flasks with baffles (Corning, cat. no. 355115) Parafilm 42 °C water bath or heat block 37 °C air incubator Orbital shaker Cuvettes for NanoDrop (VWR International, cat. no. 470138–468) Microcentrifuge (Eppendorf, cat. no. 5424) NanoDrop (Thermo Scientific) or similar instrument .. pAVU6+27 plasmid , available by request from the corresponding author of the reference publication. pAV5S plasmid , available by request from the corresponding author of the reference publication. pAVU6+27-F30-2xdBroccoli plasmid (available at Addgene) ( ). pAV5S-F30-2xdBroccoli plasmid (available at Addgene).

    Purification:

    Article Title: Molecular indexing of human genomic DNA
    Article Snippet: .. A complete Bam HI and Bgl II double digest of 10 µg human genomic DNA (Sigma) was purified and ligated to a 30-fold excess of the adapter 5′-ccagtcgcaggtctcaagctcgatccctggagc and its complementary strand 5′-gatcgctccagggatcgagcttgagacctgcgactgg in a 120 µl reaction containing 4 U T4 DNA ligase (NEB). .. Excess adapters were removed by spin chromatography using Sepharose CL-4B (Amersham Pharmacia Biotech).

    Generated:

    Article Title: RNA Imaging with Dimeric Broccoli in Live Bacterial and Mammalian Cells
    Article Snippet: .. The plasmid is generated by inserting dBroccoli with a part of T7 promoter into pET-28c-Broccoli ( ) cut with Bgl II and Nhe I enzymes. pET28c (Novagen) LB media with kanamycin (see recipe) LB/agar dishes with kanamycin (see recipe) Super Optimum Culture Media (SOC, Life Technologies, cat. no. 15544) Chemically competent Escherichia coli BL21 Star (DE3) cells (Invitrogen, cat. no. C6010-03) 1 M IPTG solution (see recipe) 1.5 ml microcentrifuge tubes (USA Scientific, cat. no. 1615–5500) Petri dishes (VWR International, cat. no. 25384–094) Culture tubes (VWR International, cat. no. 60818–667) 25-ml Erlenmeyer flasks with baffles (Corning, cat. no. 355115) Parafilm 42 °C water bath or heat block 37 °C air incubator Orbital shaker Cuvettes for NanoDrop (VWR International, cat. no. 470138–468) Microcentrifuge (Eppendorf, cat. no. 5424) NanoDrop (Thermo Scientific) or similar instrument .. pAVU6+27 plasmid , available by request from the corresponding author of the reference publication. pAV5S plasmid , available by request from the corresponding author of the reference publication. pAVU6+27-F30-2xdBroccoli plasmid (available at Addgene) ( ). pAV5S-F30-2xdBroccoli plasmid (available at Addgene).

    Article Title: Control of Mammalian Circadian Rhythm by CKI?-Regulated Proteasome-Mediated PER2 Degradation
    Article Snippet: .. FLAG epitope-tagged mPER2 was generated by PCR cloning that engineered a BglII site at its amino terminus and a SalI site at its carboxyl terminus. pFLAG-CMV-2 (Sigma) and the PCR product were digested with BglII and SalI and were ligated. β-TrCP(ΔF-box) was also cloned into pCS2+MT by a PCR-based strategy that resulted in an NcoI site at its amino terminus and XhoI at its carboxyl terminus. .. Both the PCR product and pCS2+MT were subsequently cut with NcoI and XhoI and ligated together. mPER2 point mutations and internal deletions were generated by using a QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's directions.

    Article Title: Vanillin production using metabolically engineered Escherichia coli under non-growing conditions
    Article Snippet: .. Inactivation of the vanillin dehydrogenase encoding gene was obtained by a frameshift mutation generated after digestion of plasmid molecules containing the 5098-bp catabolic cassette with Bgl II, fill-in reaction with "End Conversion Mix" (Novagen; Madison, WI) to produce blunt ends, and re-circularization, in-vitro , of the plasmid DNA with T4 DNA ligase. .. This frameshift mutation can be predicted to generate a truncated vanillin dehydrogenase that resulted to be unable to oxidize vanillin to vanillic acid.

    Amplification:

    Article Title: An Alternative Model for the Role of RP2 Protein in Flagellum Assembly in the African Trypanosome *
    Article Snippet: .. Preparation of Recombinant TbRP2 Protein and Anti-TbRP2 Polyclonal Antisera The Tb RP2 open reading frame was amplified by PCR, and the resultant amplicon was digested with NdeI and BglII for ligation into NdeI-BglII-digested pET15b (Novagen), thereby generating a recombinant gene to facilitate expression of Tb RP2 protein containing a hexahistidine tag at its N terminus. .. The resulting plasmid was sequenced using ABI prism sequencing technology (Source Bioscience).

    Expressing:

    Article Title: An Alternative Model for the Role of RP2 Protein in Flagellum Assembly in the African Trypanosome *
    Article Snippet: .. Preparation of Recombinant TbRP2 Protein and Anti-TbRP2 Polyclonal Antisera The Tb RP2 open reading frame was amplified by PCR, and the resultant amplicon was digested with NdeI and BglII for ligation into NdeI-BglII-digested pET15b (Novagen), thereby generating a recombinant gene to facilitate expression of Tb RP2 protein containing a hexahistidine tag at its N terminus. .. The resulting plasmid was sequenced using ABI prism sequencing technology (Source Bioscience).

    Article Title: Effect of single-chain antibody targeting of the ligand-binding domain in the anaplastic lymphoma kinase receptor
    Article Snippet: .. For scFv protein production in mammalian cells, the scFvs cDNAs were cloned into the Not I and Bgl II sites of pFLAG-CMV-3 vector (see ; Sigma-Aldrich, St Louis, MO, USA) without the C-terminal His-tag of the scFvs used for bacterial expression. .. For tetracycline-inducible expression, the scFvs were cloned into pTREx-DEST30 (see ; Invitrogen, Carlsbad, CA, USA).

    Polymerase Chain Reaction:

    Article Title: Toxoplasma gondii Recombinant antigen AMA1: Diagnostic Utility of Protein Fragments for the Detection of IgG and IgM Antibodies
    Article Snippet: .. The final PCR products were inserted into the Bgl II and Xho I sites (ama1 and ama1C ) or into the Bgl II and Eco RV sites (ama1N ) of the pET30 Ek/LIC vector (Novagen) using the In-Fusion® HD Cloning Kit (Takara Bio USA, Inc.). .. The resulting recombinant plasmids, pET30/AMA1N (containing amino acid residues 67–287 of AMA1), pET30/AMA1C (containing amino acid residues 287–569 of AMA1) and pET30/AMA1 (containing amino acid residues 67–569 of AMA1), were embedded in a frame between the His6 -tag domains for purification of the recombinant proteins by means of metal affinity chromatography.

    Article Title: An Alternative Model for the Role of RP2 Protein in Flagellum Assembly in the African Trypanosome *
    Article Snippet: .. Preparation of Recombinant TbRP2 Protein and Anti-TbRP2 Polyclonal Antisera The Tb RP2 open reading frame was amplified by PCR, and the resultant amplicon was digested with NdeI and BglII for ligation into NdeI-BglII-digested pET15b (Novagen), thereby generating a recombinant gene to facilitate expression of Tb RP2 protein containing a hexahistidine tag at its N terminus. .. The resulting plasmid was sequenced using ABI prism sequencing technology (Source Bioscience).

    Article Title: Control of Mammalian Circadian Rhythm by CKI?-Regulated Proteasome-Mediated PER2 Degradation
    Article Snippet: .. FLAG epitope-tagged mPER2 was generated by PCR cloning that engineered a BglII site at its amino terminus and a SalI site at its carboxyl terminus. pFLAG-CMV-2 (Sigma) and the PCR product were digested with BglII and SalI and were ligated. β-TrCP(ΔF-box) was also cloned into pCS2+MT by a PCR-based strategy that resulted in an NcoI site at its amino terminus and XhoI at its carboxyl terminus. .. Both the PCR product and pCS2+MT were subsequently cut with NcoI and XhoI and ligated together. mPER2 point mutations and internal deletions were generated by using a QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's directions.

    Recombinant:

    Article Title: An Alternative Model for the Role of RP2 Protein in Flagellum Assembly in the African Trypanosome *
    Article Snippet: .. Preparation of Recombinant TbRP2 Protein and Anti-TbRP2 Polyclonal Antisera The Tb RP2 open reading frame was amplified by PCR, and the resultant amplicon was digested with NdeI and BglII for ligation into NdeI-BglII-digested pET15b (Novagen), thereby generating a recombinant gene to facilitate expression of Tb RP2 protein containing a hexahistidine tag at its N terminus. .. The resulting plasmid was sequenced using ABI prism sequencing technology (Source Bioscience).

    Plasmid Preparation:

    Article Title: Toxoplasma gondii Recombinant antigen AMA1: Diagnostic Utility of Protein Fragments for the Detection of IgG and IgM Antibodies
    Article Snippet: .. The final PCR products were inserted into the Bgl II and Xho I sites (ama1 and ama1C ) or into the Bgl II and Eco RV sites (ama1N ) of the pET30 Ek/LIC vector (Novagen) using the In-Fusion® HD Cloning Kit (Takara Bio USA, Inc.). .. The resulting recombinant plasmids, pET30/AMA1N (containing amino acid residues 67–287 of AMA1), pET30/AMA1C (containing amino acid residues 287–569 of AMA1) and pET30/AMA1 (containing amino acid residues 67–569 of AMA1), were embedded in a frame between the His6 -tag domains for purification of the recombinant proteins by means of metal affinity chromatography.

    Article Title: RNA Imaging with Dimeric Broccoli in Live Bacterial and Mammalian Cells
    Article Snippet: .. The plasmid is generated by inserting dBroccoli with a part of T7 promoter into pET-28c-Broccoli ( ) cut with Bgl II and Nhe I enzymes. pET28c (Novagen) LB media with kanamycin (see recipe) LB/agar dishes with kanamycin (see recipe) Super Optimum Culture Media (SOC, Life Technologies, cat. no. 15544) Chemically competent Escherichia coli BL21 Star (DE3) cells (Invitrogen, cat. no. C6010-03) 1 M IPTG solution (see recipe) 1.5 ml microcentrifuge tubes (USA Scientific, cat. no. 1615–5500) Petri dishes (VWR International, cat. no. 25384–094) Culture tubes (VWR International, cat. no. 60818–667) 25-ml Erlenmeyer flasks with baffles (Corning, cat. no. 355115) Parafilm 42 °C water bath or heat block 37 °C air incubator Orbital shaker Cuvettes for NanoDrop (VWR International, cat. no. 470138–468) Microcentrifuge (Eppendorf, cat. no. 5424) NanoDrop (Thermo Scientific) or similar instrument .. pAVU6+27 plasmid , available by request from the corresponding author of the reference publication. pAV5S plasmid , available by request from the corresponding author of the reference publication. pAVU6+27-F30-2xdBroccoli plasmid (available at Addgene) ( ). pAV5S-F30-2xdBroccoli plasmid (available at Addgene).

    Article Title: Effect of single-chain antibody targeting of the ligand-binding domain in the anaplastic lymphoma kinase receptor
    Article Snippet: .. For scFv protein production in mammalian cells, the scFvs cDNAs were cloned into the Not I and Bgl II sites of pFLAG-CMV-3 vector (see ; Sigma-Aldrich, St Louis, MO, USA) without the C-terminal His-tag of the scFvs used for bacterial expression. .. For tetracycline-inducible expression, the scFvs were cloned into pTREx-DEST30 (see ; Invitrogen, Carlsbad, CA, USA).

    Article Title: Vanillin production using metabolically engineered Escherichia coli under non-growing conditions
    Article Snippet: .. Inactivation of the vanillin dehydrogenase encoding gene was obtained by a frameshift mutation generated after digestion of plasmid molecules containing the 5098-bp catabolic cassette with Bgl II, fill-in reaction with "End Conversion Mix" (Novagen; Madison, WI) to produce blunt ends, and re-circularization, in-vitro , of the plasmid DNA with T4 DNA ligase. .. This frameshift mutation can be predicted to generate a truncated vanillin dehydrogenase that resulted to be unable to oxidize vanillin to vanillic acid.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Millipore bgl ii
    Identification of yeast CUP1 transgene by southern blot and western blot analysis. (A) Southern blot analysis of the transgenes. Purified genomic <t>DNA</t> from each transgenic founder was digested with <t>Bgl</t> II and Ssp I, and analyzed by southern blotting using probes specific for CUP1 . Transgenic founders numbered 5, 6, 15, 20, 22, and 26; N: genomic DNA of control mice as a negative control. (B) Western blot was performed to confirm expression of CUP1 in the parotid and submandibular glands and in the saliva of transgenic lines. The expected protein size is 9 kDa. The lower band is β-actin (42 kDa, used as an internal control). The results demonstrated high expression of CUP1 in the parotid and submandibular glands after normalization against β-actin, as well as that in the saliva of transgenic mice. PG1 and PG2: the parotid glands of transgenic mice; SG1 and SG2: the submandibular glands of transgenic mice; Sa: the saliva of transgenic mice; N1, N2, and N3: the parotid gland, the submandibular gland and the saliva of control mice as negative controls, respectively.
    Bgl Ii, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bgl ii/product/Millipore
    Average 94 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    bgl ii - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results


    Identification of yeast CUP1 transgene by southern blot and western blot analysis. (A) Southern blot analysis of the transgenes. Purified genomic DNA from each transgenic founder was digested with Bgl II and Ssp I, and analyzed by southern blotting using probes specific for CUP1 . Transgenic founders numbered 5, 6, 15, 20, 22, and 26; N: genomic DNA of control mice as a negative control. (B) Western blot was performed to confirm expression of CUP1 in the parotid and submandibular glands and in the saliva of transgenic lines. The expected protein size is 9 kDa. The lower band is β-actin (42 kDa, used as an internal control). The results demonstrated high expression of CUP1 in the parotid and submandibular glands after normalization against β-actin, as well as that in the saliva of transgenic mice. PG1 and PG2: the parotid glands of transgenic mice; SG1 and SG2: the submandibular glands of transgenic mice; Sa: the saliva of transgenic mice; N1, N2, and N3: the parotid gland, the submandibular gland and the saliva of control mice as negative controls, respectively.

    Journal: PLoS ONE

    Article Title: Transgenic Mice Expressing Yeast CUP1 Exhibit Increased Copper Utilization from Feeds

    doi: 10.1371/journal.pone.0107810

    Figure Lengend Snippet: Identification of yeast CUP1 transgene by southern blot and western blot analysis. (A) Southern blot analysis of the transgenes. Purified genomic DNA from each transgenic founder was digested with Bgl II and Ssp I, and analyzed by southern blotting using probes specific for CUP1 . Transgenic founders numbered 5, 6, 15, 20, 22, and 26; N: genomic DNA of control mice as a negative control. (B) Western blot was performed to confirm expression of CUP1 in the parotid and submandibular glands and in the saliva of transgenic lines. The expected protein size is 9 kDa. The lower band is β-actin (42 kDa, used as an internal control). The results demonstrated high expression of CUP1 in the parotid and submandibular glands after normalization against β-actin, as well as that in the saliva of transgenic mice. PG1 and PG2: the parotid glands of transgenic mice; SG1 and SG2: the submandibular glands of transgenic mice; Sa: the saliva of transgenic mice; N1, N2, and N3: the parotid gland, the submandibular gland and the saliva of control mice as negative controls, respectively.

    Article Snippet: Twenty micrograms of DNA was restriction digested with Bgl II and Ssp I, fractionated in a 0.8% agarose gel electrophoresis, and transferred to a nylon membrane (Millipore, UK).

    Techniques: Southern Blot, Western Blot, Purification, Transgenic Assay, Mouse Assay, Negative Control, Expressing