Structured Review

Thermo Fisher bamhi
Expression and purification of rCM fusion protein. (A) Map of pPro2164 and the fusion gene encoding the predicted mature forms of CFP21 and MPT64, with a 45-bp linker, which was cloned into the <t>BamHI</t> and <t>HindIII</t> sites of pProExHTb, resulting in the recombinant
Bamhi, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 930 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bamhi/product/Thermo Fisher
Average 90 stars, based on 930 article reviews
Price from $9.99 to $1999.99
bamhi - by Bioz Stars, 2020-02
90/100 stars

Images

1) Product Images from "An Improved Whole-Blood Gamma Interferon Assay Based on the CFP21-MPT64 Fusion Protein ▿"

Article Title: An Improved Whole-Blood Gamma Interferon Assay Based on the CFP21-MPT64 Fusion Protein ▿

Journal:

doi: 10.1128/CVI.00486-08

Expression and purification of rCM fusion protein. (A) Map of pPro2164 and the fusion gene encoding the predicted mature forms of CFP21 and MPT64, with a 45-bp linker, which was cloned into the BamHI and HindIII sites of pProExHTb, resulting in the recombinant
Figure Legend Snippet: Expression and purification of rCM fusion protein. (A) Map of pPro2164 and the fusion gene encoding the predicted mature forms of CFP21 and MPT64, with a 45-bp linker, which was cloned into the BamHI and HindIII sites of pProExHTb, resulting in the recombinant

Techniques Used: Expressing, Purification, Clone Assay, Recombinant

2) Product Images from "qDSB-Seq is a general method for genome-wide quantification of DNA double-strand breaks using sequencing"

Article Title: qDSB-Seq is a general method for genome-wide quantification of DNA double-strand breaks using sequencing

Journal: Nature Communications

doi: 10.1038/s41467-019-10332-8

Quantitative DSB sequencing (qDSB-Seq) method. a A comparison of current DNA double-strand break (DSB) counting (e.g., immunofluorescence microscopy, quantitative PCR (qPCR)) and DSB sequencing strategies (e.g., BLESS 3 , i-BLESS 15 , END-Seq 6 , Break-Seq 4 , DSBCapture 5 ) with our qDSB-Seq method. b In qDSB-Seq protocol after DSB induction cells are treated with a restriction enzyme to introduce site-specific, infrequent DSBs (spike-ins). Next, DSBs are labeled (here using i-BLESS 15 or BLESS 3 ) and sequenced. Simultaneously, genomic DNA (gDNA) sequencing (or qPCR) is performed and used to estimate the cutting efficiency of the enzyme, and thus frequency of induced spike-in DSBs, which is then used to quantify the absolute DSB frequencies (per cell) of studied DSBs in the sample (Methods). c qDSB-Seq can be combined with any sequencing-based DSB labeling method. d , e Spike-in DSBs were induced in two different ways: d the studied cells were digested using the NotI, SrfI, AsiSI, or BamHI restriction enzyme in vitro; e cells expressing a restriction enzyme in vivo were mixed with the studied cells (I-SceI digestion) or alternatively a restriction enzyme was expressed in vivo in all studied cells (DIvA cells discussed below)
Figure Legend Snippet: Quantitative DSB sequencing (qDSB-Seq) method. a A comparison of current DNA double-strand break (DSB) counting (e.g., immunofluorescence microscopy, quantitative PCR (qPCR)) and DSB sequencing strategies (e.g., BLESS 3 , i-BLESS 15 , END-Seq 6 , Break-Seq 4 , DSBCapture 5 ) with our qDSB-Seq method. b In qDSB-Seq protocol after DSB induction cells are treated with a restriction enzyme to introduce site-specific, infrequent DSBs (spike-ins). Next, DSBs are labeled (here using i-BLESS 15 or BLESS 3 ) and sequenced. Simultaneously, genomic DNA (gDNA) sequencing (or qPCR) is performed and used to estimate the cutting efficiency of the enzyme, and thus frequency of induced spike-in DSBs, which is then used to quantify the absolute DSB frequencies (per cell) of studied DSBs in the sample (Methods). c qDSB-Seq can be combined with any sequencing-based DSB labeling method. d , e Spike-in DSBs were induced in two different ways: d the studied cells were digested using the NotI, SrfI, AsiSI, or BamHI restriction enzyme in vitro; e cells expressing a restriction enzyme in vivo were mixed with the studied cells (I-SceI digestion) or alternatively a restriction enzyme was expressed in vivo in all studied cells (DIvA cells discussed below)

Techniques Used: Sequencing, Immunofluorescence, Microscopy, Real-time Polymerase Chain Reaction, Introduce, Labeling, In Vitro, Expressing, In Vivo

3) Product Images from "Identification of a Naegleria fowleri Membrane Protein Reactive with Anti-Human CD59 Antibody"

Article Title: Identification of a Naegleria fowleri Membrane Protein Reactive with Anti-Human CD59 Antibody

Journal:

doi: 10.1128/IAI.74.2.1189-1195.2006

Southern blot analysis of pathogenic and nonpathogenic Naegleria genomic DNAs (10 μg) hybridized with human CD59 cDNA. Genomic DNA was digested overnight with restriction enzyme EcoRI (A), BamHI (B), or HindIII (C); separated by gel electrophoresis;
Figure Legend Snippet: Southern blot analysis of pathogenic and nonpathogenic Naegleria genomic DNAs (10 μg) hybridized with human CD59 cDNA. Genomic DNA was digested overnight with restriction enzyme EcoRI (A), BamHI (B), or HindIII (C); separated by gel electrophoresis;

Techniques Used: Southern Blot, Nucleic Acid Electrophoresis

Related Articles

Transduction:

Article Title: Impaired Efflux of the Siderophore Enterobactin Induces Envelope Stress in Escherichia coli
Article Snippet: The nuoA-N::kan and cyoA-E::kan alleles were then moved into strain TR50 by P1 transduction as previously described ( ). .. DNA bands corresponding to the size of the MC4100 entCEBA promoter and the E2348/69 entCEBA promoter were gel-purified using the GeneJet Gel Purification kit (Fermentas), digested with BamHI and EcoRI (Invitrogen), and ligated upstream of the luxABCDE operon in the pJW15 plasmid.

Clone Assay:

Article Title: Limited Role for the Bilirubin-Biliverdin Redox Amplification Cycle in the Cellular Antioxidant Protection by Biliverdin Reductase *
Article Snippet: The purified cDNA was then cloned into pGEM-T easy vector (Promega, Madison, WI) and transformed into TOP10 chemically competent cells (Invitrogen). .. The pGEM-T easy-BVR construct was propagated, purified with the QIAPREP spin miniprep kit (Qiagen), and digested with BamHI (Fermentas, Glen Burnie, MD) to excise the BVR cDNA. pcDNA3 vector (Invitrogen) was also digested with BamHI and treated with calf intestinal alkaline phosphatase (Invitrogen).

Article Title: The effects of c-Src kinase on EMT signaling pathway in human lens epithelial cells associated with lens diseases
Article Snippet: Mutant c-SrcY530F cDNA generated by RT-PCR from total mRNA of HLE-B3 cells with the primers: sense 5′-GGCAAGCTTATGGGTAGCAACAAGAGCAAGCCCAAG-3′; antisense 5′-GCTCTAGACTAGAGGTTCTCCCCGGGCT GGA ACTG-3′, (underlined sequences was the mutation site) was cloned into the expression vector pCDNA3.1 (Invitrogen, Carlsbad, CA, USA), creating pCDNA3.1-c-SrcY530F recombination vector. .. ShRNA expression vectors were generated by annealing single-stranded oligonucleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA).

Article Title: Improved Astaxanthin Production with Corynebacterium glutamicum by Application of a Membrane Fusion Protein
Article Snippet: Construction of pSH1- and pECXT99A-based Expression Vectors For construction of expression plasmids pSH1 and pECXT99A vectors were digested with BamHI (Thermo Scientific Fisher, Schwerte, Germany) and dephosphorylated (Antarctic phosphatase, New England Biolabs, Frankfurt, Germany). .. All genes were cloned with their native ORF sequences from gene donors.

Article Title: Morphological and Transcriptomic Analysis of a Beetle Chemosensory System Reveals a Gnathal Olfactory Center
Article Snippet: .. For the partial Orco -Gal4 line, a donor plasmid was generated by cloning a blunted and BamHI (Fermentas, Vilnius, Lithuania) digested PCR < product containing Gal4delta -SV40pA (amplified with primers Gal4deltafor and SV40rev from plasmid CH#757, see Additional file ) into the BamHI and EcoRV (Fermentas) digested pSLfa1180 vector [ ]. .. After propagation, a BamHI and BfuAI digested PCR product containing 2.5 kb upstream of the TcasOrco (amplified with TcOR1upfor and TcOR1uprev from San Bernardino gDNA) was cloned into the corresponding restriction sites to generate pSLfa1180[2.5kbOrcoUp_GAL4delta].

Article Title: An ultrasensitive fiveplex activity assay for cellular kinases
Article Snippet: .. GST-3xHA-IκBα(1-62) was cloned into the BamHI and EcoRI sites of pGEX-4T-1 (3xHA) by PCR of human IκBα(1-62) from pINCY (Open Biosystems #IHS1380-97433845) with primers containing restriction sites for BamHI and EcoRI. .. 3xGluGlu-c-jun-His6 was cloned into the NcoI and SacI sites of pET-29b by PCR and NcoI-SacI digest of human c-jun from pBluescriptR (Open Biosystems #MHS6278-202808200) with the primers gcgcccATGGAGTATATGCCGATGGAGGAGTATATGCCGATGGAGGAGTATATGCCGATGGAGGGATCCGAATTCatgactgcaaagatg (forward; capitals indicate 3xGluGlu followed by BamHI and EcoRI restriction sites) and gcgcgagctcGAATTCGGATCCaaatgtttgcaactgctgcg (reverse; capitals indicate BamHI and EcoRI restriction sites added for future applications).

Article Title: A Hydrophobic Network: Intersubunit and Intercapsomer Interactions Stabilizing the Bacteriophage P22 Capsid
Article Snippet: .. Gene 5 was cloned between the BamHI and HindIII sites of plasmid pSE380 (Invitrogen) to form recombinant plasmid pMS11 ( ). .. This plasmid was used for in vivo complementation.

Article Title: Phosphorylation by SR kinases regulates the binding of PTB-associated splicing factor (PSF) to the pre-mRNA polypyrimidine tract
Article Snippet: .. The ORF of ASF/SF2 was amplified by PCR using pfu DNA polymerase (Stratagene), and the amplified ASF/SF2 PCR fragment was subcloned into the BamHI and XhoI sites of pTrcHis (Invitrogen). pTrcHis-nonO was cloned by the same strategy. .. To clone pET29a-Dsk1, Dsk1 was amplified by PCR.

Article Title: Identification of a Claudin-4 Residue Important for Mediating the Host Cell Binding and Action of Clostridium perfringens Enterotoxin ▿ Enterotoxin ▿ †
Article Snippet: .. The amplicon was cloned into TOPO-TA (Invitrogen) and then subcloned, using EcoRI and BamHI, into pCEP4 (Invitrogen). .. Full-length cDNA encoding human Claudin-2, Claudin-2/E4, and Claudin4/E2 (supplied by James Anderson and Christina Van Itallie) were amplified by using the primers Cldn-2EcoRIF (GCGGAATTCGGTCTGCCATGGCCTCTCTTGGCC) and Claudin-2BamHIRev (GCGGGAATTCTCACACATACCCAGTCAGGCTGTATGA).

Article Title: Ubiquitin ligase MKRN1 modulates telomere length homeostasis through a proteolysis of hTERT
Article Snippet: .. The HA-ubiquitin expression vector was constructed by cloning the BamHI and XbaI fragment encoding the ubiqutin cDNA into pcDNA3.1 (Invitrogen) ( ). .. The MKRN1-V5 expression vector was constructed by inserting the EcoRI and NotI fragment from the full-length MKRN1 cDNA into pcDNA3.1/V5.

Amplification:

Article Title: Limited Role for the Bilirubin-Biliverdin Redox Amplification Cycle in the Cellular Antioxidant Protection by Biliverdin Reductase *
Article Snippet: BVRA was then amplified by PCR with Amplitaq (Applied Biosystems, Foster City, CA), using the primer pair 5′-TTATAGGATCCAAGATGAATGCAGAGCCCG-3′ and 5′-CAGAAGGATCCATCTTGGAAGTGCTACATCA-3′. .. The pGEM-T easy-BVR construct was propagated, purified with the QIAPREP spin miniprep kit (Qiagen), and digested with BamHI (Fermentas, Glen Burnie, MD) to excise the BVR cDNA. pcDNA3 vector (Invitrogen) was also digested with BamHI and treated with calf intestinal alkaline phosphatase (Invitrogen).

Article Title: Improved Astaxanthin Production with Corynebacterium glutamicum by Application of a Membrane Fusion Protein
Article Snippet: Construction of pSH1- and pECXT99A-based Expression Vectors For construction of expression plasmids pSH1 and pECXT99A vectors were digested with BamHI (Thermo Scientific Fisher, Schwerte, Germany) and dephosphorylated (Antarctic phosphatase, New England Biolabs, Frankfurt, Germany). .. PCR products were amplified using the oligonucleotides as the following: crtW1 : FpW1 + HN05; crtZ1 : HN06 + HA35; crtW-L : FpW1 + HA47; L-crtZ : HA48 + HA35; crtZ2 : HA34 + HA45; crtW2 : HA46 + FpW4; crtZ-L : HA34 + HA49; L-crtW : HA50 + FpW4; idi : HA67 + HA68; crtBI : HA69 + HA70; idi-idsA : HA67 + NH56; idsA-L : NH55 + NH57; L-crtBI : HA71 + HA70; idi-idsA-L : HA67 + NH57.

Article Title: UV Radiation Regulates Mi-2 through Protein Translation and Stability *UV Radiation Regulates Mi-2 through Protein Translation and Stability * S⃞
Article Snippet: The untranslated region (UTR) of Mi-2β (Refseq: ) was amplified using PCR with primers containing the restriction sites for BamHI (5′-UTR) or NheI (3′-UTR). .. The resulting PCR product was digested with the corresponding restriction endonuclease and inserted into the BamHI or SpeI sites of pMir-Report (Ambion).

Article Title: Morphological and Transcriptomic Analysis of a Beetle Chemosensory System Reveals a Gnathal Olfactory Center
Article Snippet: .. For the partial Orco -Gal4 line, a donor plasmid was generated by cloning a blunted and BamHI (Fermentas, Vilnius, Lithuania) digested PCR < product containing Gal4delta -SV40pA (amplified with primers Gal4deltafor and SV40rev from plasmid CH#757, see Additional file ) into the BamHI and EcoRV (Fermentas) digested pSLfa1180 vector [ ]. .. After propagation, a BamHI and BfuAI digested PCR product containing 2.5 kb upstream of the TcasOrco (amplified with TcOR1upfor and TcOR1uprev from San Bernardino gDNA) was cloned into the corresponding restriction sites to generate pSLfa1180[2.5kbOrcoUp_GAL4delta].

Article Title: Impaired Efflux of the Siderophore Enterobactin Induces Envelope Stress in Escherichia coli
Article Snippet: Briefly, the promoter region of the entCEBA operon was amplified from E2348/69 or MC4100 using the primers PentCluxF and PentCluxR ( ) and the high-fidelity Phusion DNA polymerase (ThermoFisher) according to the manufacturer’s protocol with the addition of 10% betaine. .. DNA bands corresponding to the size of the MC4100 entCEBA promoter and the E2348/69 entCEBA promoter were gel-purified using the GeneJet Gel Purification kit (Fermentas), digested with BamHI and EcoRI (Invitrogen), and ligated upstream of the luxABCDE operon in the pJW15 plasmid.

Article Title: Phosphorylation by SR kinases regulates the binding of PTB-associated splicing factor (PSF) to the pre-mRNA polypyrimidine tract
Article Snippet: .. The ORF of ASF/SF2 was amplified by PCR using pfu DNA polymerase (Stratagene), and the amplified ASF/SF2 PCR fragment was subcloned into the BamHI and XhoI sites of pTrcHis (Invitrogen). pTrcHis-nonO was cloned by the same strategy. .. To clone pET29a-Dsk1, Dsk1 was amplified by PCR.

Article Title: Identification of a Claudin-4 Residue Important for Mediating the Host Cell Binding and Action of Clostridium perfringens Enterotoxin ▿ Enterotoxin ▿ †
Article Snippet: .. The amplicon was cloned into TOPO-TA (Invitrogen) and then subcloned, using EcoRI and BamHI, into pCEP4 (Invitrogen). .. Full-length cDNA encoding human Claudin-2, Claudin-2/E4, and Claudin4/E2 (supplied by James Anderson and Christina Van Itallie) were amplified by using the primers Cldn-2EcoRIF (GCGGAATTCGGTCTGCCATGGCCTCTCTTGGCC) and Claudin-2BamHIRev (GCGGGAATTCTCACACATACCCAGTCAGGCTGTATGA).

Article Title: mTOR-regulated U2af1 tandem exon splicing specifies transcriptome features for translational control
Article Snippet: Minigene reporter assay Minigene U2af1 reporter gene fragment was amplified at genomic region from the start of exon 2 to the end of exon 4 with forward primer 5′-GCCATGGATCCAGTCAACTGTTCATTTTATTTC-3′ and reverse primer 5′-.ATATTAGAGCGGCCGCCTCAAAGAACTCATCATAG-3′. .. The fragments were then digested with BamHI and NotI, then ligated into pcDNA3.1 (+) plasmid (Thermo Fisher Scientific).

Article Title: An Improved Whole-Blood Gamma Interferon Assay Based on the CFP21-MPT64 Fusion Protein ▿
Article Snippet: The coding sequences of the mature form of the CFP21 (Rv1984c) and MPT64 (Rv1980c) proteins were amplified by PCRs using the specific primers listed in Table (Sangon Biotech, Shanghai, China), with the chromosomal DNA of M. tuberculosis H37Rv as a template. .. The fusion gene was digested with BamHI and HindIII and inserted into the expression vector pProEXHTb (Invitrogen, Carlsbad, CA), predigested with the same restriction enzymes.

Reporter Assay:

Article Title: mTOR-regulated U2af1 tandem exon splicing specifies transcriptome features for translational control
Article Snippet: Paragraph title: Minigene reporter assay ... The fragments were then digested with BamHI and NotI, then ligated into pcDNA3.1 (+) plasmid (Thermo Fisher Scientific).

Scaffolding:

Article Title: A Hydrophobic Network: Intersubunit and Intercapsomer Interactions Stabilizing the Bacteriophage P22 Capsid
Article Snippet: Gene 5 was cloned between the BamHI and HindIII sites of plasmid pSE380 (Invitrogen) to form recombinant plasmid pMS11 ( ). .. Plasmid pPC (derived from pET3a, kindly given to us by Peter E. Prevelige) has gene 8 (encoding scaffolding protein) followed by gene 5 ( ).

DNA Ligation:

Article Title: Limited Role for the Bilirubin-Biliverdin Redox Amplification Cycle in the Cellular Antioxidant Protection by Biliverdin Reductase *
Article Snippet: The pGEM-T easy-BVR construct was propagated, purified with the QIAPREP spin miniprep kit (Qiagen), and digested with BamHI (Fermentas, Glen Burnie, MD) to excise the BVR cDNA. pcDNA3 vector (Invitrogen) was also digested with BamHI and treated with calf intestinal alkaline phosphatase (Invitrogen). .. Both the BVR cDNA and pcDNA3 vector were resolved and purified from a 1% agarose gel and then ligated with LigaFast quick DNA ligation kit (Promega).

Construct:

Article Title: Limited Role for the Bilirubin-Biliverdin Redox Amplification Cycle in the Cellular Antioxidant Protection by Biliverdin Reductase *
Article Snippet: .. The pGEM-T easy-BVR construct was propagated, purified with the QIAPREP spin miniprep kit (Qiagen), and digested with BamHI (Fermentas, Glen Burnie, MD) to excise the BVR cDNA. pcDNA3 vector (Invitrogen) was also digested with BamHI and treated with calf intestinal alkaline phosphatase (Invitrogen). .. Both the BVR cDNA and pcDNA3 vector were resolved and purified from a 1% agarose gel and then ligated with LigaFast quick DNA ligation kit (Promega).

Article Title: Impaired Efflux of the Siderophore Enterobactin Induces Envelope Stress in Escherichia coli
Article Snippet: Luminescent transcriptional reporters of entCEBA expression were constructed as previously described ( ). .. DNA bands corresponding to the size of the MC4100 entCEBA promoter and the E2348/69 entCEBA promoter were gel-purified using the GeneJet Gel Purification kit (Fermentas), digested with BamHI and EcoRI (Invitrogen), and ligated upstream of the luxABCDE operon in the pJW15 plasmid.

Article Title: Identification of a Claudin-4 Residue Important for Mediating the Host Cell Binding and Action of Clostridium perfringens Enterotoxin ▿ Enterotoxin ▿ †
Article Snippet: Paragraph title: Plasmid cDNA constructs. ... The amplicon was cloned into TOPO-TA (Invitrogen) and then subcloned, using EcoRI and BamHI, into pCEP4 (Invitrogen).

Article Title: Ubiquitin ligase MKRN1 modulates telomere length homeostasis through a proteolysis of hTERT
Article Snippet: .. The HA-ubiquitin expression vector was constructed by cloning the BamHI and XbaI fragment encoding the ubiqutin cDNA into pcDNA3.1 (Invitrogen) ( ). .. The MKRN1-V5 expression vector was constructed by inserting the EcoRI and NotI fragment from the full-length MKRN1 cDNA into pcDNA3.1/V5.

Electrophoresis:

Article Title: Identification of a Naegleria fowleri Membrane Protein Reactive with Anti-Human CD59 Antibody
Article Snippet: .. Ten micrograms of gDNA was digested with EcoRI, BamHI, or HindIII (Invitrogen) overnight at 37°C, separated by electrophoresis through a 0.8% agarose gel, and transferred to a positively charged nylon membrane (Roche Applied Science, Indianapolis, IN). .. The DNA was cross-linked to the nylon membrane with a UV Stratalinker (Stratagene, La Jolla, CA).

Incubation:

Article Title: Identification of a Naegleria fowleri Membrane Protein Reactive with Anti-Human CD59 Antibody
Article Snippet: Ten micrograms of gDNA was digested with EcoRI, BamHI, or HindIII (Invitrogen) overnight at 37°C, separated by electrophoresis through a 0.8% agarose gel, and transferred to a positively charged nylon membrane (Roche Applied Science, Indianapolis, IN). .. The membrane was incubated with the labeled CD59 probe at 60°C in ExpressHyb hybridization solution (BD Biosciences Clontech, Palo Alto, CA) according to the manufacturer's instructions.

Expressing:

Article Title: The effects of c-Src kinase on EMT signaling pathway in human lens epithelial cells associated with lens diseases
Article Snippet: .. ShRNA expression vectors were generated by annealing single-stranded oligonucleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA). .. The target sequences were as follows: ShSrc (c-Src, NM_005417, 1682–1700 bp): 5′-TCGGCTCATTGAAGACAAT-3′ (provided by Genepharma Inc., Shanghai, China), and a scrambled sequence was used as a negative control (ShNC): 5′-TTCTCCGAACGTGTCACGT-3′ (Ambion, Austin, TX, USA).

Article Title: Improved Astaxanthin Production with Corynebacterium glutamicum by Application of a Membrane Fusion Protein
Article Snippet: .. Construction of pSH1- and pECXT99A-based Expression Vectors For construction of expression plasmids pSH1 and pECXT99A vectors were digested with BamHI (Thermo Scientific Fisher, Schwerte, Germany) and dephosphorylated (Antarctic phosphatase, New England Biolabs, Frankfurt, Germany). .. PCR products were amplified using the oligonucleotides as the following: crtW1 : FpW1 + HN05; crtZ1 : HN06 + HA35; crtW-L : FpW1 + HA47; L-crtZ : HA48 + HA35; crtZ2 : HA34 + HA45; crtW2 : HA46 + FpW4; crtZ-L : HA34 + HA49; L-crtW : HA50 + FpW4; idi : HA67 + HA68; crtBI : HA69 + HA70; idi-idsA : HA67 + NH56; idsA-L : NH55 + NH57; L-crtBI : HA71 + HA70; idi-idsA-L : HA67 + NH57.

Article Title: Morphological and Transcriptomic Analysis of a Beetle Chemosensory System Reveals a Gnathal Olfactory Center
Article Snippet: For the partial Orco -Gal4 line, a donor plasmid was generated by cloning a blunted and BamHI (Fermentas, Vilnius, Lithuania) digested PCR < product containing Gal4delta -SV40pA (amplified with primers Gal4deltafor and SV40rev from plasmid CH#757, see Additional file ) into the BamHI and EcoRV (Fermentas) digested pSLfa1180 vector [ ]. .. The tissue-specific expression of Gal4 in the Orco -Gal4 line was determined by crossing it with an UAS -tGFP [ ] line and performing IHC on the antennae with α-tGFP and α-Orco antibody or by staining of the whole brain with α-tGFP and an α-synapsin counterstaining.

Article Title: Impaired Efflux of the Siderophore Enterobactin Induces Envelope Stress in Escherichia coli
Article Snippet: Luminescent transcriptional reporters of entCEBA expression were constructed as previously described ( ). .. DNA bands corresponding to the size of the MC4100 entCEBA promoter and the E2348/69 entCEBA promoter were gel-purified using the GeneJet Gel Purification kit (Fermentas), digested with BamHI and EcoRI (Invitrogen), and ligated upstream of the luxABCDE operon in the pJW15 plasmid.

Article Title: An ultrasensitive fiveplex activity assay for cellular kinases
Article Snippet: Plasmids Bacterial plasmids expressing glutathione S-transferase (GST) fused to triple epitope tags were prepared by directionally cloning in-frame epitope tags into the BamHI and EcoRI restriction sites of pGEX-4T-1 (GE Healthcare Life Sciences #28954549). .. GST-3xHA-IκBα(1-62) was cloned into the BamHI and EcoRI sites of pGEX-4T-1 (3xHA) by PCR of human IκBα(1-62) from pINCY (Open Biosystems #IHS1380-97433845) with primers containing restriction sites for BamHI and EcoRI.

Article Title: Ubiquitin ligase MKRN1 modulates telomere length homeostasis through a proteolysis of hTERT
Article Snippet: .. The HA-ubiquitin expression vector was constructed by cloning the BamHI and XbaI fragment encoding the ubiqutin cDNA into pcDNA3.1 (Invitrogen) ( ). .. The MKRN1-V5 expression vector was constructed by inserting the EcoRI and NotI fragment from the full-length MKRN1 cDNA into pcDNA3.1/V5.

Article Title: An Improved Whole-Blood Gamma Interferon Assay Based on the CFP21-MPT64 Fusion Protein ▿
Article Snippet: .. The fusion gene was digested with BamHI and HindIII and inserted into the expression vector pProEXHTb (Invitrogen, Carlsbad, CA), predigested with the same restriction enzymes. .. This procedure resulted in plasmid pPro2164, with the fusion gene under the control of the Trc promoter (Fig. ).

Transformation Assay:

Article Title: Limited Role for the Bilirubin-Biliverdin Redox Amplification Cycle in the Cellular Antioxidant Protection by Biliverdin Reductase *
Article Snippet: The purified cDNA was then cloned into pGEM-T easy vector (Promega, Madison, WI) and transformed into TOP10 chemically competent cells (Invitrogen). .. The pGEM-T easy-BVR construct was propagated, purified with the QIAPREP spin miniprep kit (Qiagen), and digested with BamHI (Fermentas, Glen Burnie, MD) to excise the BVR cDNA. pcDNA3 vector (Invitrogen) was also digested with BamHI and treated with calf intestinal alkaline phosphatase (Invitrogen).

Derivative Assay:

Article Title: A Hydrophobic Network: Intersubunit and Intercapsomer Interactions Stabilizing the Bacteriophage P22 Capsid
Article Snippet: Gene 5 was cloned between the BamHI and HindIII sites of plasmid pSE380 (Invitrogen) to form recombinant plasmid pMS11 ( ). .. Plasmid pPC (derived from pET3a, kindly given to us by Peter E. Prevelige) has gene 8 (encoding scaffolding protein) followed by gene 5 ( ).

Gel Purification:

Article Title: Limited Role for the Bilirubin-Biliverdin Redox Amplification Cycle in the Cellular Antioxidant Protection by Biliverdin Reductase *
Article Snippet: The PCR product was resolved on a 1.5% agarose gel and purified using a gel purification kit obtained from Qiagen (Valencia, CA). .. The pGEM-T easy-BVR construct was propagated, purified with the QIAPREP spin miniprep kit (Qiagen), and digested with BamHI (Fermentas, Glen Burnie, MD) to excise the BVR cDNA. pcDNA3 vector (Invitrogen) was also digested with BamHI and treated with calf intestinal alkaline phosphatase (Invitrogen).

Article Title: Impaired Efflux of the Siderophore Enterobactin Induces Envelope Stress in Escherichia coli
Article Snippet: .. DNA bands corresponding to the size of the MC4100 entCEBA promoter and the E2348/69 entCEBA promoter were gel-purified using the GeneJet Gel Purification kit (Fermentas), digested with BamHI and EcoRI (Invitrogen), and ligated upstream of the luxABCDE operon in the pJW15 plasmid. .. PCR and DNA sequencing verified correct insertion of the promoter sequences.

Immunohistochemistry:

Article Title: Morphological and Transcriptomic Analysis of a Beetle Chemosensory System Reveals a Gnathal Olfactory Center
Article Snippet: For the partial Orco -Gal4 line, a donor plasmid was generated by cloning a blunted and BamHI (Fermentas, Vilnius, Lithuania) digested PCR < product containing Gal4delta -SV40pA (amplified with primers Gal4deltafor and SV40rev from plasmid CH#757, see Additional file ) into the BamHI and EcoRV (Fermentas) digested pSLfa1180 vector [ ]. .. The tissue-specific expression of Gal4 in the Orco -Gal4 line was determined by crossing it with an UAS -tGFP [ ] line and performing IHC on the antennae with α-tGFP and α-Orco antibody or by staining of the whole brain with α-tGFP and an α-synapsin counterstaining.

Southern Blot:

Article Title: Identification of a Naegleria fowleri Membrane Protein Reactive with Anti-Human CD59 Antibody
Article Snippet: Paragraph title: gDNA isolation and Southern blot analysis. ... Ten micrograms of gDNA was digested with EcoRI, BamHI, or HindIII (Invitrogen) overnight at 37°C, separated by electrophoresis through a 0.8% agarose gel, and transferred to a positively charged nylon membrane (Roche Applied Science, Indianapolis, IN).

Cell Culture:

Article Title: UV Radiation Regulates Mi-2 through Protein Translation and Stability *UV Radiation Regulates Mi-2 through Protein Translation and Stability * S⃞
Article Snippet: The MCF7, C33a, HEK-293, and Hela were obtained from ATCC and cultured in DMEM cell lines containing 10% fetal bovine serum. .. The resulting PCR product was digested with the corresponding restriction endonuclease and inserted into the BamHI or SpeI sites of pMir-Report (Ambion).

Reverse Transcription Polymerase Chain Reaction:

Article Title: The effects of c-Src kinase on EMT signaling pathway in human lens epithelial cells associated with lens diseases
Article Snippet: Mutant c-SrcY530F cDNA generated by RT-PCR from total mRNA of HLE-B3 cells with the primers: sense 5′-GGCAAGCTTATGGGTAGCAACAAGAGCAAGCCCAAG-3′; antisense 5′-GCTCTAGACTAGAGGTTCTCCCCGGGCT GGA ACTG-3′, (underlined sequences was the mutation site) was cloned into the expression vector pCDNA3.1 (Invitrogen, Carlsbad, CA, USA), creating pCDNA3.1-c-SrcY530F recombination vector. .. ShRNA expression vectors were generated by annealing single-stranded oligonucleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA).

Generated:

Article Title: The effects of c-Src kinase on EMT signaling pathway in human lens epithelial cells associated with lens diseases
Article Snippet: .. ShRNA expression vectors were generated by annealing single-stranded oligonucleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA). .. The target sequences were as follows: ShSrc (c-Src, NM_005417, 1682–1700 bp): 5′-TCGGCTCATTGAAGACAAT-3′ (provided by Genepharma Inc., Shanghai, China), and a scrambled sequence was used as a negative control (ShNC): 5′-TTCTCCGAACGTGTCACGT-3′ (Ambion, Austin, TX, USA).

Article Title: Morphological and Transcriptomic Analysis of a Beetle Chemosensory System Reveals a Gnathal Olfactory Center
Article Snippet: .. For the partial Orco -Gal4 line, a donor plasmid was generated by cloning a blunted and BamHI (Fermentas, Vilnius, Lithuania) digested PCR < product containing Gal4delta -SV40pA (amplified with primers Gal4deltafor and SV40rev from plasmid CH#757, see Additional file ) into the BamHI and EcoRV (Fermentas) digested pSLfa1180 vector [ ]. .. After propagation, a BamHI and BfuAI digested PCR product containing 2.5 kb upstream of the TcasOrco (amplified with TcOR1upfor and TcOR1uprev from San Bernardino gDNA) was cloned into the corresponding restriction sites to generate pSLfa1180[2.5kbOrcoUp_GAL4delta].

Article Title: An Improved Whole-Blood Gamma Interferon Assay Based on the CFP21-MPT64 Fusion Protein ▿
Article Snippet: The PCR fragments encoding the fusion protein of CFP21 and MPT64 were generated by a second PCR according to the method of gene splicing with overlap extension ( ). .. The fusion gene was digested with BamHI and HindIII and inserted into the expression vector pProEXHTb (Invitrogen, Carlsbad, CA), predigested with the same restriction enzymes.

DNA Sequencing:

Article Title: Impaired Efflux of the Siderophore Enterobactin Induces Envelope Stress in Escherichia coli
Article Snippet: DNA bands corresponding to the size of the MC4100 entCEBA promoter and the E2348/69 entCEBA promoter were gel-purified using the GeneJet Gel Purification kit (Fermentas), digested with BamHI and EcoRI (Invitrogen), and ligated upstream of the luxABCDE operon in the pJW15 plasmid. .. PCR and DNA sequencing verified correct insertion of the promoter sequences.

DNA Labeling:

Article Title: Identification of a Naegleria fowleri Membrane Protein Reactive with Anti-Human CD59 Antibody
Article Snippet: Ten micrograms of gDNA was digested with EcoRI, BamHI, or HindIII (Invitrogen) overnight at 37°C, separated by electrophoresis through a 0.8% agarose gel, and transferred to a positively charged nylon membrane (Roche Applied Science, Indianapolis, IN). .. A human CD59 cDNA probe was labeled with the RadPrime DNA labeling system (Invitrogen).

Sequencing:

Article Title: The effects of c-Src kinase on EMT signaling pathway in human lens epithelial cells associated with lens diseases
Article Snippet: ShRNA expression vectors were generated by annealing single-stranded oligonucleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA). .. The target sequences were as follows: ShSrc (c-Src, NM_005417, 1682–1700 bp): 5′-TCGGCTCATTGAAGACAAT-3′ (provided by Genepharma Inc., Shanghai, China), and a scrambled sequence was used as a negative control (ShNC): 5′-TTCTCCGAACGTGTCACGT-3′ (Ambion, Austin, TX, USA).

Article Title: Improved Astaxanthin Production with Corynebacterium glutamicum by Application of a Membrane Fusion Protein
Article Snippet: Construction of pSH1- and pECXT99A-based Expression Vectors For construction of expression plasmids pSH1 and pECXT99A vectors were digested with BamHI (Thermo Scientific Fisher, Schwerte, Germany) and dephosphorylated (Antarctic phosphatase, New England Biolabs, Frankfurt, Germany). .. For transcriptional fusions of crtZ/crtW genes the artificial linker sequence AACTGCCACACGAAC was used and the consensus ribosome binding sequence with optimal spacing (GAAAGGAGGCCCTTCAG) was used for each gene.

Article Title: UV Radiation Regulates Mi-2 through Protein Translation and Stability *UV Radiation Regulates Mi-2 through Protein Translation and Stability * S⃞
Article Snippet: The resulting PCR product was digested with the corresponding restriction endonuclease and inserted into the BamHI or SpeI sites of pMir-Report (Ambion). .. Sequences were verified by sequencing at the NIEHS sequencing core using Big Dye terminator kit (Applied Biosystems). pRL-CMV was acquired from Promega Corporation.

Binding Assay:

Article Title: Improved Astaxanthin Production with Corynebacterium glutamicum by Application of a Membrane Fusion Protein
Article Snippet: Construction of pSH1- and pECXT99A-based Expression Vectors For construction of expression plasmids pSH1 and pECXT99A vectors were digested with BamHI (Thermo Scientific Fisher, Schwerte, Germany) and dephosphorylated (Antarctic phosphatase, New England Biolabs, Frankfurt, Germany). .. For transcriptional fusions of crtZ/crtW genes the artificial linker sequence AACTGCCACACGAAC was used and the consensus ribosome binding sequence with optimal spacing (GAAAGGAGGCCCTTCAG) was used for each gene.

In Vivo:

Article Title: A Hydrophobic Network: Intersubunit and Intercapsomer Interactions Stabilizing the Bacteriophage P22 Capsid
Article Snippet: Gene 5 was cloned between the BamHI and HindIII sites of plasmid pSE380 (Invitrogen) to form recombinant plasmid pMS11 ( ). .. This plasmid was used for in vivo complementation.

Mutagenesis:

Article Title: The effects of c-Src kinase on EMT signaling pathway in human lens epithelial cells associated with lens diseases
Article Snippet: Mutant c-SrcY530F cDNA generated by RT-PCR from total mRNA of HLE-B3 cells with the primers: sense 5′-GGCAAGCTTATGGGTAGCAACAAGAGCAAGCCCAAG-3′; antisense 5′-GCTCTAGACTAGAGGTTCTCCCCGGGCT GGA ACTG-3′, (underlined sequences was the mutation site) was cloned into the expression vector pCDNA3.1 (Invitrogen, Carlsbad, CA, USA), creating pCDNA3.1-c-SrcY530F recombination vector. .. ShRNA expression vectors were generated by annealing single-stranded oligonucleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA).

Article Title: Morphological and Transcriptomic Analysis of a Beetle Chemosensory System Reveals a Gnathal Olfactory Center
Article Snippet: The Orco -Gal4 and UAS -DsRed lines were generated by piggyBac -based insertional mutagenesis [ ]. .. For the partial Orco -Gal4 line, a donor plasmid was generated by cloning a blunted and BamHI (Fermentas, Vilnius, Lithuania) digested PCR < product containing Gal4delta -SV40pA (amplified with primers Gal4deltafor and SV40rev from plasmid CH#757, see Additional file ) into the BamHI and EcoRV (Fermentas) digested pSLfa1180 vector [ ].

Article Title: An ultrasensitive fiveplex activity assay for cellular kinases
Article Snippet: GST-3xHA-IκBα(1-62) was cloned into the BamHI and EcoRI sites of pGEX-4T-1 (3xHA) by PCR of human IκBα(1-62) from pINCY (Open Biosystems #IHS1380-97433845) with primers containing restriction sites for BamHI and EcoRI. .. The C-terminal hexahistidine tag was brought in frame by QuikChange II XL site-directed mutagenesis (Agilent #200521) using the following primers: catttggatccgaattcgcgagctccgtcgacaagc (forward) and gcttgtcgacggagctcgcgaattcggatccaaatg (reverse).

Article Title: A Hydrophobic Network: Intersubunit and Intercapsomer Interactions Stabilizing the Bacteriophage P22 Capsid
Article Snippet: Gene 5 was cloned between the BamHI and HindIII sites of plasmid pSE380 (Invitrogen) to form recombinant plasmid pMS11 ( ). .. Site-directed mutagenesis was used to generate mutations in the gene 5 of both of the plasmids.

Isolation:

Article Title: Identification of a Naegleria fowleri Membrane Protein Reactive with Anti-Human CD59 Antibody
Article Snippet: Paragraph title: gDNA isolation and Southern blot analysis. ... Ten micrograms of gDNA was digested with EcoRI, BamHI, or HindIII (Invitrogen) overnight at 37°C, separated by electrophoresis through a 0.8% agarose gel, and transferred to a positively charged nylon membrane (Roche Applied Science, Indianapolis, IN).

Immunodetection:

Article Title: UV Radiation Regulates Mi-2 through Protein Translation and Stability *UV Radiation Regulates Mi-2 through Protein Translation and Stability * S⃞
Article Snippet: The resulting PCR product was digested with the corresponding restriction endonuclease and inserted into the BamHI or SpeI sites of pMir-Report (Ambion). .. Immunodetection —Keratinocytes plated on 10-cm2 dishes overnight were treated with UV radiation with a Tyler Research UV irradiator emitting a narrow 313-nm output at roughly 15 J/m2 ·s or ionizing radiation with the NIEHS 137 Cs irradiator.

Labeling:

Article Title: Identification of a Naegleria fowleri Membrane Protein Reactive with Anti-Human CD59 Antibody
Article Snippet: Ten micrograms of gDNA was digested with EcoRI, BamHI, or HindIII (Invitrogen) overnight at 37°C, separated by electrophoresis through a 0.8% agarose gel, and transferred to a positively charged nylon membrane (Roche Applied Science, Indianapolis, IN). .. A human CD59 cDNA probe was labeled with the RadPrime DNA labeling system (Invitrogen).

Purification:

Article Title: Limited Role for the Bilirubin-Biliverdin Redox Amplification Cycle in the Cellular Antioxidant Protection by Biliverdin Reductase *
Article Snippet: .. The pGEM-T easy-BVR construct was propagated, purified with the QIAPREP spin miniprep kit (Qiagen), and digested with BamHI (Fermentas, Glen Burnie, MD) to excise the BVR cDNA. pcDNA3 vector (Invitrogen) was also digested with BamHI and treated with calf intestinal alkaline phosphatase (Invitrogen). .. Both the BVR cDNA and pcDNA3 vector were resolved and purified from a 1% agarose gel and then ligated with LigaFast quick DNA ligation kit (Promega).

Polymerase Chain Reaction:

Article Title: Limited Role for the Bilirubin-Biliverdin Redox Amplification Cycle in the Cellular Antioxidant Protection by Biliverdin Reductase *
Article Snippet: The PCR product was resolved on a 1.5% agarose gel and purified using a gel purification kit obtained from Qiagen (Valencia, CA). .. The pGEM-T easy-BVR construct was propagated, purified with the QIAPREP spin miniprep kit (Qiagen), and digested with BamHI (Fermentas, Glen Burnie, MD) to excise the BVR cDNA. pcDNA3 vector (Invitrogen) was also digested with BamHI and treated with calf intestinal alkaline phosphatase (Invitrogen).

Article Title: Improved Astaxanthin Production with Corynebacterium glutamicum by Application of a Membrane Fusion Protein
Article Snippet: Construction of pSH1- and pECXT99A-based Expression Vectors For construction of expression plasmids pSH1 and pECXT99A vectors were digested with BamHI (Thermo Scientific Fisher, Schwerte, Germany) and dephosphorylated (Antarctic phosphatase, New England Biolabs, Frankfurt, Germany). .. PCR products were amplified using the oligonucleotides as the following: crtW1 : FpW1 + HN05; crtZ1 : HN06 + HA35; crtW-L : FpW1 + HA47; L-crtZ : HA48 + HA35; crtZ2 : HA34 + HA45; crtW2 : HA46 + FpW4; crtZ-L : HA34 + HA49; L-crtW : HA50 + FpW4; idi : HA67 + HA68; crtBI : HA69 + HA70; idi-idsA : HA67 + NH56; idsA-L : NH55 + NH57; L-crtBI : HA71 + HA70; idi-idsA-L : HA67 + NH57.

Article Title: UV Radiation Regulates Mi-2 through Protein Translation and Stability *UV Radiation Regulates Mi-2 through Protein Translation and Stability * S⃞
Article Snippet: .. The resulting PCR product was digested with the corresponding restriction endonuclease and inserted into the BamHI or SpeI sites of pMir-Report (Ambion). .. Sequences were verified by sequencing at the NIEHS sequencing core using Big Dye terminator kit (Applied Biosystems). pRL-CMV was acquired from Promega Corporation.

Article Title: Morphological and Transcriptomic Analysis of a Beetle Chemosensory System Reveals a Gnathal Olfactory Center
Article Snippet: .. For the partial Orco -Gal4 line, a donor plasmid was generated by cloning a blunted and BamHI (Fermentas, Vilnius, Lithuania) digested PCR < product containing Gal4delta -SV40pA (amplified with primers Gal4deltafor and SV40rev from plasmid CH#757, see Additional file ) into the BamHI and EcoRV (Fermentas) digested pSLfa1180 vector [ ]. .. After propagation, a BamHI and BfuAI digested PCR product containing 2.5 kb upstream of the TcasOrco (amplified with TcOR1upfor and TcOR1uprev from San Bernardino gDNA) was cloned into the corresponding restriction sites to generate pSLfa1180[2.5kbOrcoUp_GAL4delta].

Article Title: Impaired Efflux of the Siderophore Enterobactin Induces Envelope Stress in Escherichia coli
Article Snippet: Presence of the kanamycin resistance cassette was confirmed by PCR. .. DNA bands corresponding to the size of the MC4100 entCEBA promoter and the E2348/69 entCEBA promoter were gel-purified using the GeneJet Gel Purification kit (Fermentas), digested with BamHI and EcoRI (Invitrogen), and ligated upstream of the luxABCDE operon in the pJW15 plasmid.

Article Title: An ultrasensitive fiveplex activity assay for cellular kinases
Article Snippet: .. GST-3xHA-IκBα(1-62) was cloned into the BamHI and EcoRI sites of pGEX-4T-1 (3xHA) by PCR of human IκBα(1-62) from pINCY (Open Biosystems #IHS1380-97433845) with primers containing restriction sites for BamHI and EcoRI. .. 3xGluGlu-c-jun-His6 was cloned into the NcoI and SacI sites of pET-29b by PCR and NcoI-SacI digest of human c-jun from pBluescriptR (Open Biosystems #MHS6278-202808200) with the primers gcgcccATGGAGTATATGCCGATGGAGGAGTATATGCCGATGGAGGAGTATATGCCGATGGAGGGATCCGAATTCatgactgcaaagatg (forward; capitals indicate 3xGluGlu followed by BamHI and EcoRI restriction sites) and gcgcgagctcGAATTCGGATCCaaatgtttgcaactgctgcg (reverse; capitals indicate BamHI and EcoRI restriction sites added for future applications).

Article Title: Phosphorylation by SR kinases regulates the binding of PTB-associated splicing factor (PSF) to the pre-mRNA polypyrimidine tract
Article Snippet: .. The ORF of ASF/SF2 was amplified by PCR using pfu DNA polymerase (Stratagene), and the amplified ASF/SF2 PCR fragment was subcloned into the BamHI and XhoI sites of pTrcHis (Invitrogen). pTrcHis-nonO was cloned by the same strategy. .. To clone pET29a-Dsk1, Dsk1 was amplified by PCR.

Article Title: Identification of a Claudin-4 Residue Important for Mediating the Host Cell Binding and Action of Clostridium perfringens Enterotoxin ▿ Enterotoxin ▿ †
Article Snippet: Full-length human Claudin-1 cDNA (Invitrogen) was PCR amplified by using Taq polymerase (New England Biolabs) and primers cldn1BamHI (GGCCGGATCCAACTCTCCGCCTTCTGCAC) and cldn1EcoRI (GGCCGAATTCTTGAGTATGATTACTCAA). .. The amplicon was cloned into TOPO-TA (Invitrogen) and then subcloned, using EcoRI and BamHI, into pCEP4 (Invitrogen).

Article Title: An Improved Whole-Blood Gamma Interferon Assay Based on the CFP21-MPT64 Fusion Protein ▿
Article Snippet: The PCR fragments encoding the fusion protein of CFP21 and MPT64 were generated by a second PCR according to the method of gene splicing with overlap extension ( ). .. The fusion gene was digested with BamHI and HindIII and inserted into the expression vector pProEXHTb (Invitrogen, Carlsbad, CA), predigested with the same restriction enzymes.

Recombinant:

Article Title: The effects of c-Src kinase on EMT signaling pathway in human lens epithelial cells associated with lens diseases
Article Snippet: ShRNA expression vectors were generated by annealing single-stranded oligonucleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA). .. The recombinant ShRNA vectors were named as pSlience4.1-ShSrc and pSlience4.1-ShNC.

Article Title: A Hydrophobic Network: Intersubunit and Intercapsomer Interactions Stabilizing the Bacteriophage P22 Capsid
Article Snippet: .. Gene 5 was cloned between the BamHI and HindIII sites of plasmid pSE380 (Invitrogen) to form recombinant plasmid pMS11 ( ). .. This plasmid was used for in vivo complementation.

shRNA:

Article Title: The effects of c-Src kinase on EMT signaling pathway in human lens epithelial cells associated with lens diseases
Article Snippet: .. ShRNA expression vectors were generated by annealing single-stranded oligonucleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA). .. The target sequences were as follows: ShSrc (c-Src, NM_005417, 1682–1700 bp): 5′-TCGGCTCATTGAAGACAAT-3′ (provided by Genepharma Inc., Shanghai, China), and a scrambled sequence was used as a negative control (ShNC): 5′-TTCTCCGAACGTGTCACGT-3′ (Ambion, Austin, TX, USA).

Polyacrylamide Gel Electrophoresis:

Article Title: An ultrasensitive fiveplex activity assay for cellular kinases
Article Snippet: PCR amplicons were prepared from a PAGE-purified oligonucleotide template with forward primers containing a BglII restriction site and reverse primers containing HindIII–BamHI–EcoRI sites (Supplementary Table ). .. GST-3xHA-IκBα(1-62) was cloned into the BamHI and EcoRI sites of pGEX-4T-1 (3xHA) by PCR of human IκBα(1-62) from pINCY (Open Biosystems #IHS1380-97433845) with primers containing restriction sites for BamHI and EcoRI.

Lysis:

Article Title: UV Radiation Regulates Mi-2 through Protein Translation and Stability *UV Radiation Regulates Mi-2 through Protein Translation and Stability * S⃞
Article Snippet: The resulting PCR product was digested with the corresponding restriction endonuclease and inserted into the BamHI or SpeI sites of pMir-Report (Ambion). .. Cells were harvested in lysis buffer (50 m m Tris-HCL, 1.0% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 400 mm NaCl) and total protein quantified using the Bio-Rad Protein assay.

Plasmid Preparation:

Article Title: Limited Role for the Bilirubin-Biliverdin Redox Amplification Cycle in the Cellular Antioxidant Protection by Biliverdin Reductase *
Article Snippet: .. The pGEM-T easy-BVR construct was propagated, purified with the QIAPREP spin miniprep kit (Qiagen), and digested with BamHI (Fermentas, Glen Burnie, MD) to excise the BVR cDNA. pcDNA3 vector (Invitrogen) was also digested with BamHI and treated with calf intestinal alkaline phosphatase (Invitrogen). .. Both the BVR cDNA and pcDNA3 vector were resolved and purified from a 1% agarose gel and then ligated with LigaFast quick DNA ligation kit (Promega).

Article Title: The effects of c-Src kinase on EMT signaling pathway in human lens epithelial cells associated with lens diseases
Article Snippet: .. ShRNA expression vectors were generated by annealing single-stranded oligonucleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA). .. The target sequences were as follows: ShSrc (c-Src, NM_005417, 1682–1700 bp): 5′-TCGGCTCATTGAAGACAAT-3′ (provided by Genepharma Inc., Shanghai, China), and a scrambled sequence was used as a negative control (ShNC): 5′-TTCTCCGAACGTGTCACGT-3′ (Ambion, Austin, TX, USA).

Article Title: Morphological and Transcriptomic Analysis of a Beetle Chemosensory System Reveals a Gnathal Olfactory Center
Article Snippet: .. For the partial Orco -Gal4 line, a donor plasmid was generated by cloning a blunted and BamHI (Fermentas, Vilnius, Lithuania) digested PCR < product containing Gal4delta -SV40pA (amplified with primers Gal4deltafor and SV40rev from plasmid CH#757, see Additional file ) into the BamHI and EcoRV (Fermentas) digested pSLfa1180 vector [ ]. .. After propagation, a BamHI and BfuAI digested PCR product containing 2.5 kb upstream of the TcasOrco (amplified with TcOR1upfor and TcOR1uprev from San Bernardino gDNA) was cloned into the corresponding restriction sites to generate pSLfa1180[2.5kbOrcoUp_GAL4delta].

Article Title: Impaired Efflux of the Siderophore Enterobactin Induces Envelope Stress in Escherichia coli
Article Snippet: .. DNA bands corresponding to the size of the MC4100 entCEBA promoter and the E2348/69 entCEBA promoter were gel-purified using the GeneJet Gel Purification kit (Fermentas), digested with BamHI and EcoRI (Invitrogen), and ligated upstream of the luxABCDE operon in the pJW15 plasmid. .. PCR and DNA sequencing verified correct insertion of the promoter sequences.

Article Title: A Hydrophobic Network: Intersubunit and Intercapsomer Interactions Stabilizing the Bacteriophage P22 Capsid
Article Snippet: .. Gene 5 was cloned between the BamHI and HindIII sites of plasmid pSE380 (Invitrogen) to form recombinant plasmid pMS11 ( ). .. This plasmid was used for in vivo complementation.

Article Title: Phosphorylation by SR kinases regulates the binding of PTB-associated splicing factor (PSF) to the pre-mRNA polypyrimidine tract
Article Snippet: Paragraph title: Plasmid construction s ... The ORF of ASF/SF2 was amplified by PCR using pfu DNA polymerase (Stratagene), and the amplified ASF/SF2 PCR fragment was subcloned into the BamHI and XhoI sites of pTrcHis (Invitrogen). pTrcHis-nonO was cloned by the same strategy.

Article Title: Identification of a Claudin-4 Residue Important for Mediating the Host Cell Binding and Action of Clostridium perfringens Enterotoxin ▿ Enterotoxin ▿ †
Article Snippet: Paragraph title: Plasmid cDNA constructs. ... The amplicon was cloned into TOPO-TA (Invitrogen) and then subcloned, using EcoRI and BamHI, into pCEP4 (Invitrogen).

Article Title: mTOR-regulated U2af1 tandem exon splicing specifies transcriptome features for translational control
Article Snippet: .. The fragments were then digested with BamHI and NotI, then ligated into pcDNA3.1 (+) plasmid (Thermo Fisher Scientific). .. CRISPR-induced homologous recombination To insert a 3x-Flag tag at the C-terminal of U2af1 gene via homologous recombination, the donor sequence was synthesized as a gBlocks gene fragment (IDT) and cloned into pAAV-SEPT-acceptor vector (Addgene).

Article Title: Ubiquitin ligase MKRN1 modulates telomere length homeostasis through a proteolysis of hTERT
Article Snippet: .. The HA-ubiquitin expression vector was constructed by cloning the BamHI and XbaI fragment encoding the ubiqutin cDNA into pcDNA3.1 (Invitrogen) ( ). .. The MKRN1-V5 expression vector was constructed by inserting the EcoRI and NotI fragment from the full-length MKRN1 cDNA into pcDNA3.1/V5.

Article Title: An Improved Whole-Blood Gamma Interferon Assay Based on the CFP21-MPT64 Fusion Protein ▿
Article Snippet: .. The fusion gene was digested with BamHI and HindIII and inserted into the expression vector pProEXHTb (Invitrogen, Carlsbad, CA), predigested with the same restriction enzymes. .. This procedure resulted in plasmid pPro2164, with the fusion gene under the control of the Trc promoter (Fig. ).

Hybridization:

Article Title: Identification of a Naegleria fowleri Membrane Protein Reactive with Anti-Human CD59 Antibody
Article Snippet: Ten micrograms of gDNA was digested with EcoRI, BamHI, or HindIII (Invitrogen) overnight at 37°C, separated by electrophoresis through a 0.8% agarose gel, and transferred to a positively charged nylon membrane (Roche Applied Science, Indianapolis, IN). .. The membrane was incubated with the labeled CD59 probe at 60°C in ExpressHyb hybridization solution (BD Biosciences Clontech, Palo Alto, CA) according to the manufacturer's instructions.

Irradiation:

Article Title: UV Radiation Regulates Mi-2 through Protein Translation and Stability *UV Radiation Regulates Mi-2 through Protein Translation and Stability * S⃞
Article Snippet: The resulting PCR product was digested with the corresponding restriction endonuclease and inserted into the BamHI or SpeI sites of pMir-Report (Ambion). .. Immunodetection —Keratinocytes plated on 10-cm2 dishes overnight were treated with UV radiation with a Tyler Research UV irradiator emitting a narrow 313-nm output at roughly 15 J/m2 ·s or ionizing radiation with the NIEHS 137 Cs irradiator.

Negative Control:

Article Title: The effects of c-Src kinase on EMT signaling pathway in human lens epithelial cells associated with lens diseases
Article Snippet: ShRNA expression vectors were generated by annealing single-stranded oligonucleotides and inserting them into the BamHI and HindIII enzyme sites of pSilencer4.1-CMVneo vector (Ambion, Austin, TX, USA). .. The target sequences were as follows: ShSrc (c-Src, NM_005417, 1682–1700 bp): 5′-TCGGCTCATTGAAGACAAT-3′ (provided by Genepharma Inc., Shanghai, China), and a scrambled sequence was used as a negative control (ShNC): 5′-TTCTCCGAACGTGTCACGT-3′ (Ambion, Austin, TX, USA).

Positron Emission Tomography:

Article Title: An ultrasensitive fiveplex activity assay for cellular kinases
Article Snippet: 3xVSVG-GSK3α(1-97)-His6 was cloned into the NdeI and XhoI sites of pET-29b (Novagen #69872) by PCR and NdeI-SalI digest of human GSK3α(1-97) from GST-3xVSVG-GSK3α(1-97) with the primers gcgccatATGGAGCAGAAACTCATCTCTGAAGAGGATCTGGAGCAGAAACTCATCTCTGAAGAGGATCTGGAGCAGAAACTCATCTCTGAAGAGGATCTGcctcccagtgcaggtgc (forward; capitals indicate 3xVSVG) and gcgcctcgagCCCTTGGAAGTATAGGTTCTCcagggtggtggaggggagc (reverse; capitals indicate a tobacco etch virus protease cleavage site). .. GST-3xHA-IκBα(1-62) was cloned into the BamHI and EcoRI sites of pGEX-4T-1 (3xHA) by PCR of human IκBα(1-62) from pINCY (Open Biosystems #IHS1380-97433845) with primers containing restriction sites for BamHI and EcoRI.

Agarose Gel Electrophoresis:

Article Title: Limited Role for the Bilirubin-Biliverdin Redox Amplification Cycle in the Cellular Antioxidant Protection by Biliverdin Reductase *
Article Snippet: The PCR product was resolved on a 1.5% agarose gel and purified using a gel purification kit obtained from Qiagen (Valencia, CA). .. The pGEM-T easy-BVR construct was propagated, purified with the QIAPREP spin miniprep kit (Qiagen), and digested with BamHI (Fermentas, Glen Burnie, MD) to excise the BVR cDNA. pcDNA3 vector (Invitrogen) was also digested with BamHI and treated with calf intestinal alkaline phosphatase (Invitrogen).

Article Title: Identification of a Naegleria fowleri Membrane Protein Reactive with Anti-Human CD59 Antibody
Article Snippet: .. Ten micrograms of gDNA was digested with EcoRI, BamHI, or HindIII (Invitrogen) overnight at 37°C, separated by electrophoresis through a 0.8% agarose gel, and transferred to a positively charged nylon membrane (Roche Applied Science, Indianapolis, IN). .. The DNA was cross-linked to the nylon membrane with a UV Stratalinker (Stratagene, La Jolla, CA).

In Vitro:

Article Title: qDSB-Seq is a general method for genome-wide quantification of DNA double-strand breaks using sequencing
Article Snippet: Paragraph title: qDSB-Seq with in vitro digestion ... Samples were treated with NotI (NEB, Thermo Scientific), SrfI (NEB), AsiSI (NEB), or BamHI (Thermo Scientific) for 1 h at 37 °C.

Transgenic Assay:

Article Title: Morphological and Transcriptomic Analysis of a Beetle Chemosensory System Reveals a Gnathal Olfactory Center
Article Snippet: Paragraph title: Tribolium castaneum rearing and transgenic lines ... For the partial Orco -Gal4 line, a donor plasmid was generated by cloning a blunted and BamHI (Fermentas, Vilnius, Lithuania) digested PCR < product containing Gal4delta -SV40pA (amplified with primers Gal4deltafor and SV40rev from plasmid CH#757, see Additional file ) into the BamHI and EcoRV (Fermentas) digested pSLfa1180 vector [ ].

Staining:

Article Title: Morphological and Transcriptomic Analysis of a Beetle Chemosensory System Reveals a Gnathal Olfactory Center
Article Snippet: For the partial Orco -Gal4 line, a donor plasmid was generated by cloning a blunted and BamHI (Fermentas, Vilnius, Lithuania) digested PCR < product containing Gal4delta -SV40pA (amplified with primers Gal4deltafor and SV40rev from plasmid CH#757, see Additional file ) into the BamHI and EcoRV (Fermentas) digested pSLfa1180 vector [ ]. .. The tissue-specific expression of Gal4 in the Orco -Gal4 line was determined by crossing it with an UAS -tGFP [ ] line and performing IHC on the antennae with α-tGFP and α-Orco antibody or by staining of the whole brain with α-tGFP and an α-synapsin counterstaining.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher bamhi
    A: pFastBac1 and pBlueScript-ORF2-NSP4 Genes is Double Digested With <t>BamHI</t> and <t>SalI</t> RESTRICTION ENZYMES A: The linearized pFastBac1 and ORF2-NSP4 respectively appeared at 4775 and 2000 bp. Lane 1: pFastBac1 is double digested with BamHI/SalI ; Lane 2: pBlueScript-ORF2-NSP4 is double digested with BamHI/SalI.B : ORF2-NSP4 gene was cloned in pFastBac1. Lane 1 - 2: pFastBac1-ORF2-NSP4; and Lane3 - 4: pFastBac1. C: the position site of ORF2-NSP4 was confirmed by single and double digestion and the length of subcloned genes after single digestion was 6775 bp while after double digestion was 4775 and 2000 bp. Lane 1 - 2: pFastBac1-ORF2-NSP4 single digestion BamHI ; Lane 3 - 4: pFastBac1-ORF2-NSP4 single digestion SalI; and Lane 5-6: pFastBac1-ORF2-NSP4 double digestion BamHI/SalI .
    Bamhi, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 930 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi/product/Thermo Fisher
    Average 90 stars, based on 930 article reviews
    Price from $9.99 to $1999.99
    bamhi - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    93
    Thermo Fisher bamhi restriction site
    Digital imprinting of dsRNA recognition and processing on a ds[RNA-DNA] matrix. Shown in (a) and (d) is the sequence of the 39-bp ds[RNA-DNA] (12-bp of dsRNA, 27-bp of dsDNA), containing an A. aeolicus <t>RNase</t> III processing site positioned in the middle of the dsRNA segment (|dsRNA 0 〉. The dsRNA sequence corresponds to the duplex stem in the A. aeolicus 23S rRNA precursor 38 . The red rectangles indicate sites of enzyme contact 38 , and the scissile phosphodiesters are indicated by the red arrows. (a) Input 1 (red): RNase III cleavage of the target site would create a surface-attached, 23-bp ds[RNA-DNA] with a 2-nt, 3′-overhang terminus (calculated length ~7.1 nm). Input 2 (magenta), uses the RNase III E110A mutant, which retains dsRNA-binding ability 31 39 . This input does not alter the height, and is essentially identical to the control experiment that omits RNase III (Input 3: green) (see also Table 1 ). (b) The H OUT /H IN value indicates that Output 1 corresponds to a ds[RNA-DNA] that is processed by RNase III (red dashed line), whereas Outputs 2 and 3 correspond to an unaltered dsDNA-dsRNA segment (black dashed line). (c) schematically depicts the output matrices [1–3], in which [1] consists of a monolayer of duplexes comprising the unaltered |dsDNA 0 〉 segment and a cleaved |dsRNA 0 〉 segment. The structures in (d) highlight the <t>BamHI</t> recognition sequence (enclosed in blue rectangles). BamHI action would create a surface-bound, 4-bp product possessing a 4-nt 3′-overhang (calculated length ~1.4 nm). In (e), three distinct ‘imprints’ are generated when BamHI is included (Inputs 1+–3+). For Input 1+, the ds[RNA-DNA] is processed at the BamHI site (blue dashed line), when RNase III also is present. For Input 3+, BamHI displays only limited catalytic action in the absence of RNase III, while for Input 2+, BamHI is inhibited in the presence of the E110A RNase III mutant (note error bars for Outputs 2+ and 3+). (f) schematically depicts the output matrices [1–3+], in which [1+] consists of a monolayer of duplexes comprising the cleaved |dsDNA 0 〉 segment, and [3+] consists of a mixed monolayer of cleaved |dsDNA 0 〉 segments and intact duplexes. Data are means, including the standard deviations.
    Bamhi Restriction Site, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi restriction site/product/Thermo Fisher
    Average 93 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    bamhi restriction site - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    N/A
    5 G ↓G A T C C 3 3 C C T A G ↑G 5 Invitrogen Anza 5 BamHI is a restriction enzyme that cuts DNA at this recognition
      Buy from Supplier

    Image Search Results


    A: pFastBac1 and pBlueScript-ORF2-NSP4 Genes is Double Digested With BamHI and SalI RESTRICTION ENZYMES A: The linearized pFastBac1 and ORF2-NSP4 respectively appeared at 4775 and 2000 bp. Lane 1: pFastBac1 is double digested with BamHI/SalI ; Lane 2: pBlueScript-ORF2-NSP4 is double digested with BamHI/SalI.B : ORF2-NSP4 gene was cloned in pFastBac1. Lane 1 - 2: pFastBac1-ORF2-NSP4; and Lane3 - 4: pFastBac1. C: the position site of ORF2-NSP4 was confirmed by single and double digestion and the length of subcloned genes after single digestion was 6775 bp while after double digestion was 4775 and 2000 bp. Lane 1 - 2: pFastBac1-ORF2-NSP4 single digestion BamHI ; Lane 3 - 4: pFastBac1-ORF2-NSP4 single digestion SalI; and Lane 5-6: pFastBac1-ORF2-NSP4 double digestion BamHI/SalI .

    Journal: Jundishapur Journal of Microbiology

    Article Title: Designing, Construction and Expression of a Recombinant Fusion Protein Comprising the Hepatitis E Virus ORF2 and Rotavirus NSP4 in the Baculovirus Expression System

    doi: 10.5812/jjm.40303

    Figure Lengend Snippet: A: pFastBac1 and pBlueScript-ORF2-NSP4 Genes is Double Digested With BamHI and SalI RESTRICTION ENZYMES A: The linearized pFastBac1 and ORF2-NSP4 respectively appeared at 4775 and 2000 bp. Lane 1: pFastBac1 is double digested with BamHI/SalI ; Lane 2: pBlueScript-ORF2-NSP4 is double digested with BamHI/SalI.B : ORF2-NSP4 gene was cloned in pFastBac1. Lane 1 - 2: pFastBac1-ORF2-NSP4; and Lane3 - 4: pFastBac1. C: the position site of ORF2-NSP4 was confirmed by single and double digestion and the length of subcloned genes after single digestion was 6775 bp while after double digestion was 4775 and 2000 bp. Lane 1 - 2: pFastBac1-ORF2-NSP4 single digestion BamHI ; Lane 3 - 4: pFastBac1-ORF2-NSP4 single digestion SalI; and Lane 5-6: pFastBac1-ORF2-NSP4 double digestion BamHI/SalI .

    Article Snippet: The pBlue Script II containing fusion truncated ORF2-NSP4 was transformed in E.coli DH5α, cultured in LB agar containing ampicillin (50 mg/L), then plasmid was extracted and double digested by BamHI and SalI restriction enzymes (Thermo Scientific, USA).

    Techniques: Clone Assay

    Identification of methylated recognition sequences in S. acidocaldarius genomic DNA by digestion assays. Restriction enzymes BsuRI (A) and BamHI, DpnI, and MboI (B) were used to highlight the presence/absence of methylated 5′-GGCC-3′ and 5′-GATC-3′ palindromes, respectively, in genomic DNA of S. acidocaldarius . Two types of substrates were digested: genomic DNA (gDNA) and a whole genome amplification of the genomic DNA (WGA). WGA is identical to gDNA in terms of nucleic sequence but it does not contain epigenetic marks (see material and methods). This negative control is only used in (A) . The addition of different restriction enzymes is symbolized by a positive sign “+” while reaction mix without restriction enzyme is represented by a negative sign “–”. Molecular size markers (GeneRuler DNA Ladder, Thermo Scientific) were loaded in both gels (M). Digestion patterns were obtained in 0.8% agarose gel stained with ethidium bromide and visualized under UV light.

    Journal: Frontiers in Microbiology

    Article Title: The DNA Methylome of the Hyperthermoacidophilic Crenarchaeon Sulfolobus acidocaldarius

    doi: 10.3389/fmicb.2018.00137

    Figure Lengend Snippet: Identification of methylated recognition sequences in S. acidocaldarius genomic DNA by digestion assays. Restriction enzymes BsuRI (A) and BamHI, DpnI, and MboI (B) were used to highlight the presence/absence of methylated 5′-GGCC-3′ and 5′-GATC-3′ palindromes, respectively, in genomic DNA of S. acidocaldarius . Two types of substrates were digested: genomic DNA (gDNA) and a whole genome amplification of the genomic DNA (WGA). WGA is identical to gDNA in terms of nucleic sequence but it does not contain epigenetic marks (see material and methods). This negative control is only used in (A) . The addition of different restriction enzymes is symbolized by a positive sign “+” while reaction mix without restriction enzyme is represented by a negative sign “–”. Molecular size markers (GeneRuler DNA Ladder, Thermo Scientific) were loaded in both gels (M). Digestion patterns were obtained in 0.8% agarose gel stained with ethidium bromide and visualized under UV light.

    Article Snippet: Digestion assays Genomic DNA isolated from asynchronous S. acidocaldarius cells was cleaved independently with a specific REase in order to decipher the presence or the absence of m4C or m6A: BsuRI, BamHI, MboI, and DpnI (Thermo Scientific).

    Techniques: Methylation, Whole Genome Amplification, Sequencing, Negative Control, Agarose Gel Electrophoresis, Staining

    Confirmation of Self-Ligated pP15A, kana R by Digestion Lane 2: digestion of pP15A, kana R vector with BamHI ; lane 3, xbaI; Lane 4, double digestion with BamHI-XbaI; Lane 5, undigested pP15A, kana R vector; Lanes 1 and 6, GeneRuler DNA ladder mix (Thermo Scientific, Waltham, MA, USA).

    Journal: Jundishapur Journal of Microbiology

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance

    doi: 10.5812/jjm.29384

    Figure Lengend Snippet: Confirmation of Self-Ligated pP15A, kana R by Digestion Lane 2: digestion of pP15A, kana R vector with BamHI ; lane 3, xbaI; Lane 4, double digestion with BamHI-XbaI; Lane 5, undigested pP15A, kana R vector; Lanes 1 and 6, GeneRuler DNA ladder mix (Thermo Scientific, Waltham, MA, USA).

    Article Snippet: The purified plasmid was confirmed by single and double-digestion reactions by BamHI and XbaI restriction enzymes (Thermo Scientific, Waltham, MA, USA) and after confirmation was used to clone and express the left and right ZFN arrays.

    Techniques: Plasmid Preparation

    Digital imprinting of dsRNA recognition and processing on a ds[RNA-DNA] matrix. Shown in (a) and (d) is the sequence of the 39-bp ds[RNA-DNA] (12-bp of dsRNA, 27-bp of dsDNA), containing an A. aeolicus RNase III processing site positioned in the middle of the dsRNA segment (|dsRNA 0 〉. The dsRNA sequence corresponds to the duplex stem in the A. aeolicus 23S rRNA precursor 38 . The red rectangles indicate sites of enzyme contact 38 , and the scissile phosphodiesters are indicated by the red arrows. (a) Input 1 (red): RNase III cleavage of the target site would create a surface-attached, 23-bp ds[RNA-DNA] with a 2-nt, 3′-overhang terminus (calculated length ~7.1 nm). Input 2 (magenta), uses the RNase III E110A mutant, which retains dsRNA-binding ability 31 39 . This input does not alter the height, and is essentially identical to the control experiment that omits RNase III (Input 3: green) (see also Table 1 ). (b) The H OUT /H IN value indicates that Output 1 corresponds to a ds[RNA-DNA] that is processed by RNase III (red dashed line), whereas Outputs 2 and 3 correspond to an unaltered dsDNA-dsRNA segment (black dashed line). (c) schematically depicts the output matrices [1–3], in which [1] consists of a monolayer of duplexes comprising the unaltered |dsDNA 0 〉 segment and a cleaved |dsRNA 0 〉 segment. The structures in (d) highlight the BamHI recognition sequence (enclosed in blue rectangles). BamHI action would create a surface-bound, 4-bp product possessing a 4-nt 3′-overhang (calculated length ~1.4 nm). In (e), three distinct ‘imprints’ are generated when BamHI is included (Inputs 1+–3+). For Input 1+, the ds[RNA-DNA] is processed at the BamHI site (blue dashed line), when RNase III also is present. For Input 3+, BamHI displays only limited catalytic action in the absence of RNase III, while for Input 2+, BamHI is inhibited in the presence of the E110A RNase III mutant (note error bars for Outputs 2+ and 3+). (f) schematically depicts the output matrices [1–3+], in which [1+] consists of a monolayer of duplexes comprising the cleaved |dsDNA 0 〉 segment, and [3+] consists of a mixed monolayer of cleaved |dsDNA 0 〉 segments and intact duplexes. Data are means, including the standard deviations.

    Journal: Scientific Reports

    Article Title: Digital Imprinting of RNA Recognition and Processing on a Self-Assembled Nucleic Acid Matrix

    doi: 10.1038/srep02550

    Figure Lengend Snippet: Digital imprinting of dsRNA recognition and processing on a ds[RNA-DNA] matrix. Shown in (a) and (d) is the sequence of the 39-bp ds[RNA-DNA] (12-bp of dsRNA, 27-bp of dsDNA), containing an A. aeolicus RNase III processing site positioned in the middle of the dsRNA segment (|dsRNA 0 〉. The dsRNA sequence corresponds to the duplex stem in the A. aeolicus 23S rRNA precursor 38 . The red rectangles indicate sites of enzyme contact 38 , and the scissile phosphodiesters are indicated by the red arrows. (a) Input 1 (red): RNase III cleavage of the target site would create a surface-attached, 23-bp ds[RNA-DNA] with a 2-nt, 3′-overhang terminus (calculated length ~7.1 nm). Input 2 (magenta), uses the RNase III E110A mutant, which retains dsRNA-binding ability 31 39 . This input does not alter the height, and is essentially identical to the control experiment that omits RNase III (Input 3: green) (see also Table 1 ). (b) The H OUT /H IN value indicates that Output 1 corresponds to a ds[RNA-DNA] that is processed by RNase III (red dashed line), whereas Outputs 2 and 3 correspond to an unaltered dsDNA-dsRNA segment (black dashed line). (c) schematically depicts the output matrices [1–3], in which [1] consists of a monolayer of duplexes comprising the unaltered |dsDNA 0 〉 segment and a cleaved |dsRNA 0 〉 segment. The structures in (d) highlight the BamHI recognition sequence (enclosed in blue rectangles). BamHI action would create a surface-bound, 4-bp product possessing a 4-nt 3′-overhang (calculated length ~1.4 nm). In (e), three distinct ‘imprints’ are generated when BamHI is included (Inputs 1+–3+). For Input 1+, the ds[RNA-DNA] is processed at the BamHI site (blue dashed line), when RNase III also is present. For Input 3+, BamHI displays only limited catalytic action in the absence of RNase III, while for Input 2+, BamHI is inhibited in the presence of the E110A RNase III mutant (note error bars for Outputs 2+ and 3+). (f) schematically depicts the output matrices [1–3+], in which [1+] consists of a monolayer of duplexes comprising the cleaved |dsDNA 0 〉 segment, and [3+] consists of a mixed monolayer of cleaved |dsDNA 0 〉 segments and intact duplexes. Data are means, including the standard deviations.

    Article Snippet: Preparation of RNA-DNA chimera sequences A thiolated, 39-nucleotide RNA-DNA chimera sequence containing an RNase III cleavage site within the 27-nt RNA segment and a BamHI restriction site within the 12-nt DNA segment (see Seq1 below), as well as the complementary, non-thiolated [RNA-DNA] sequence (see Seq2 below) were purchased from ThermoFisher Scientific in HPLC-purified form.

    Techniques: Sequencing, Mutagenesis, Binding Assay, Generated

    Density-dependent steric regulation of imprinting a ds[RNA-DNA] matrix. (a) The final heights (H OUT ) of six separate Inputs are dependent upon the initial height (H IN ) of the ds[RNA-DNA] matrix. Input 1 (with RNase III). Input 2 (with E110A). Input 3 (controls, either lacking RNase III or with RNase III without the catalytic cofactor, Mg 2+ ). Input 1+ (with RNase III and BamHI). Input 2+ (with E110A and BamHI). Input 3+ (with BamHI alone). All dashed lines in (a) relate the data points to a linear regression. The data for Output 1 show that RNase III can process the dsRNA segment regardless of ds[RNA-DNA] density, which is related to the initial height (see schematic representation on top). Outputs 2 and 3 are consistent with an unaltered ds[RNA-DNA] chimera (represented by the solid diagonal line: H OUT = H IN ). BamHI gains full access to its site in combination with RNase III (Output 1+) as H OUT 1+ ≪ H OUT 1 , while it is essentially completely blocked in combination with the E110A mutant (Output 2+) as H OUT 2+ ~ H IN . BamHI restriction enzyme efficiency acting alone (Input 3+) must be lower than that of RNase III alone (Input 1), as the height of an matrix consisting of ds[RNA-DNA] molecules cleaved by BamHI would be lower than the height of an matrix cleaved by RNase III, and, in contrast, H OUT 3+ > H OUT 1 for relatively dense matrices (H IN > 10 nm). Data are means, and include standard deviations. (b) Schematic depiction of the effect of different inputs on a highly dense ds[RNA-DNA] matrix, including a steric hindrance-based model that shows how the ‘imprint’ (Output n+) is a step (i.e. digital) function of Input n+ (n = 1,3), as shown in (a).

    Journal: Scientific Reports

    Article Title: Digital Imprinting of RNA Recognition and Processing on a Self-Assembled Nucleic Acid Matrix

    doi: 10.1038/srep02550

    Figure Lengend Snippet: Density-dependent steric regulation of imprinting a ds[RNA-DNA] matrix. (a) The final heights (H OUT ) of six separate Inputs are dependent upon the initial height (H IN ) of the ds[RNA-DNA] matrix. Input 1 (with RNase III). Input 2 (with E110A). Input 3 (controls, either lacking RNase III or with RNase III without the catalytic cofactor, Mg 2+ ). Input 1+ (with RNase III and BamHI). Input 2+ (with E110A and BamHI). Input 3+ (with BamHI alone). All dashed lines in (a) relate the data points to a linear regression. The data for Output 1 show that RNase III can process the dsRNA segment regardless of ds[RNA-DNA] density, which is related to the initial height (see schematic representation on top). Outputs 2 and 3 are consistent with an unaltered ds[RNA-DNA] chimera (represented by the solid diagonal line: H OUT = H IN ). BamHI gains full access to its site in combination with RNase III (Output 1+) as H OUT 1+ ≪ H OUT 1 , while it is essentially completely blocked in combination with the E110A mutant (Output 2+) as H OUT 2+ ~ H IN . BamHI restriction enzyme efficiency acting alone (Input 3+) must be lower than that of RNase III alone (Input 1), as the height of an matrix consisting of ds[RNA-DNA] molecules cleaved by BamHI would be lower than the height of an matrix cleaved by RNase III, and, in contrast, H OUT 3+ > H OUT 1 for relatively dense matrices (H IN > 10 nm). Data are means, and include standard deviations. (b) Schematic depiction of the effect of different inputs on a highly dense ds[RNA-DNA] matrix, including a steric hindrance-based model that shows how the ‘imprint’ (Output n+) is a step (i.e. digital) function of Input n+ (n = 1,3), as shown in (a).

    Article Snippet: Preparation of RNA-DNA chimera sequences A thiolated, 39-nucleotide RNA-DNA chimera sequence containing an RNase III cleavage site within the 27-nt RNA segment and a BamHI restriction site within the 12-nt DNA segment (see Seq1 below), as well as the complementary, non-thiolated [RNA-DNA] sequence (see Seq2 below) were purchased from ThermoFisher Scientific in HPLC-purified form.

    Techniques: Mutagenesis