bamhi xbai sites  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BamHI 10 U µL
    Description:
    5 G ↓G A T C C 3 3 C C T A G ↑G 5 Thermo Scientific BamHI restriction enzyme recognizes G GATCC sites and cuts best at 37°C in its own unique buffer See Reaction Conditions for Restriction Enzymes for a table of enzyme activity conditions for double digestion and heat inactivation for this and other restriction enzymes Note Also available as a FastDigest enzyme for rapid DNA digestion Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes optimized to work in one of the buffers of the Five Buffer System In addition the universal Tango buffer is provided for convenience in double digestions All of the enzymes exhibit 100 activity in the recommended buffer and reaction conditions To ensure consistent performance Thermo Scientific restriction enzyme reaction buffers contain premixed BSA which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations Features• Superior quality stringent quality control and industry leading manufacturing process• Convenient color coded Five Buffer System• Includes universal Tango buffer for double digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism RFLP • SNPNote For methylation sensitivity refer to product specifications
    Catalog Number:
    er0051
    Price:
    None
    Category:
    Proteins Enzymes Peptides
    Applications:
    Cloning|Restriction Enzyme Cloning
    Buy from Supplier


    Structured Review

    Thermo Fisher bamhi xbai sites
    5 G ↓G A T C C 3 3 C C T A G ↑G 5 Thermo Scientific BamHI restriction enzyme recognizes G GATCC sites and cuts best at 37°C in its own unique buffer See Reaction Conditions for Restriction Enzymes for a table of enzyme activity conditions for double digestion and heat inactivation for this and other restriction enzymes Note Also available as a FastDigest enzyme for rapid DNA digestion Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes optimized to work in one of the buffers of the Five Buffer System In addition the universal Tango buffer is provided for convenience in double digestions All of the enzymes exhibit 100 activity in the recommended buffer and reaction conditions To ensure consistent performance Thermo Scientific restriction enzyme reaction buffers contain premixed BSA which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations Features• Superior quality stringent quality control and industry leading manufacturing process• Convenient color coded Five Buffer System• Includes universal Tango buffer for double digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism RFLP • SNPNote For methylation sensitivity refer to product specifications
    https://www.bioz.com/result/bamhi xbai sites/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bamhi xbai sites - by Bioz Stars, 2021-03
    99/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Annexin A5 Promoter Haplotype M2 Is Not a Risk Factor for Recurrent Pregnancy Loss in Northern Europe
    Article Snippet: The ANXA5 promoter region containing the tagSNP 76G/A defining the presence (minor allele A) or absence (major allele G) of M2 risk haplotype was amplified from 50–100 ng of genomic DNA using primers PCRII_fw ( 5’-CGACCACTCACCCAGACTGT-3’ ) and PCRII_rev ( 5’-GGAGACCAACTGGGACGA-3’ ; ) and HOT FIREPol DNA Polymerase (Solis Biodyne). .. The PCR product (294 bp) was subjected to RFLP analysis using BamHI restriction enzyme (Thermo Scientific, USA) that exhibits no sensitivity to DNA methylation and specifically cuts in case of the major allele G at position 76 ( ; ). ..

    DNA Methylation Assay:

    Article Title: Annexin A5 Promoter Haplotype M2 Is Not a Risk Factor for Recurrent Pregnancy Loss in Northern Europe
    Article Snippet: The ANXA5 promoter region containing the tagSNP 76G/A defining the presence (minor allele A) or absence (major allele G) of M2 risk haplotype was amplified from 50–100 ng of genomic DNA using primers PCRII_fw ( 5’-CGACCACTCACCCAGACTGT-3’ ) and PCRII_rev ( 5’-GGAGACCAACTGGGACGA-3’ ; ) and HOT FIREPol DNA Polymerase (Solis Biodyne). .. The PCR product (294 bp) was subjected to RFLP analysis using BamHI restriction enzyme (Thermo Scientific, USA) that exhibits no sensitivity to DNA methylation and specifically cuts in case of the major allele G at position 76 ( ; ). ..

    Plasmid Preparation:

    Article Title: Immobilized Cobalt Affinity Chromatography Provides a Novel, Efficient Method for Herpes Simplex Virus Type 1 Gene Vector Purification
    Article Snippet: The synthesized oligonucleotides encoding HAT (HAT amino acid sequence, KDHLIHNVHKEEHAHAHNK [ ]) were designed to be flanked by BglII sticky ends (sense, 5′GATCTGAAGGATCATCTCATCCACAATGTCCACAAAGAGGAGCACGCTCATGCCCACAACAAA-3′; antisense, 3′-ACTTCCTAGTAGAGTAGGTGTTACAGGTGTTTCTCCTCGTGCGAGTACGGGTGTTGTTTCTAG-5′). .. The oligonucleotides (10 pM) were mixed in phosphate-buffered saline (PBS), denatured at 100°C for 10 min, and then annealed for 1 h. BamHI-digested plasmid pTZ18UgBpK− DNA was dephosphorylated, gel purified, and then ligated with the annealed HAT-encoding oligonucleotide mixture, and then the ligation mixture was transformed into Escherichia coli DH5α competent cells (Invitrogen). .. Single colonies from the transformation were cultured, and plasmid DNAs were extracted by use of a Quick plasmid kit (Qiagen, Valencia, Calif.).

    Purification:

    Article Title: Immobilized Cobalt Affinity Chromatography Provides a Novel, Efficient Method for Herpes Simplex Virus Type 1 Gene Vector Purification
    Article Snippet: The synthesized oligonucleotides encoding HAT (HAT amino acid sequence, KDHLIHNVHKEEHAHAHNK [ ]) were designed to be flanked by BglII sticky ends (sense, 5′GATCTGAAGGATCATCTCATCCACAATGTCCACAAAGAGGAGCACGCTCATGCCCACAACAAA-3′; antisense, 3′-ACTTCCTAGTAGAGTAGGTGTTACAGGTGTTTCTCCTCGTGCGAGTACGGGTGTTGTTTCTAG-5′). .. The oligonucleotides (10 pM) were mixed in phosphate-buffered saline (PBS), denatured at 100°C for 10 min, and then annealed for 1 h. BamHI-digested plasmid pTZ18UgBpK− DNA was dephosphorylated, gel purified, and then ligated with the annealed HAT-encoding oligonucleotide mixture, and then the ligation mixture was transformed into Escherichia coli DH5α competent cells (Invitrogen). .. Single colonies from the transformation were cultured, and plasmid DNAs were extracted by use of a Quick plasmid kit (Qiagen, Valencia, Calif.).

    HAT Assay:

    Article Title: Immobilized Cobalt Affinity Chromatography Provides a Novel, Efficient Method for Herpes Simplex Virus Type 1 Gene Vector Purification
    Article Snippet: The synthesized oligonucleotides encoding HAT (HAT amino acid sequence, KDHLIHNVHKEEHAHAHNK [ ]) were designed to be flanked by BglII sticky ends (sense, 5′GATCTGAAGGATCATCTCATCCACAATGTCCACAAAGAGGAGCACGCTCATGCCCACAACAAA-3′; antisense, 3′-ACTTCCTAGTAGAGTAGGTGTTACAGGTGTTTCTCCTCGTGCGAGTACGGGTGTTGTTTCTAG-5′). .. The oligonucleotides (10 pM) were mixed in phosphate-buffered saline (PBS), denatured at 100°C for 10 min, and then annealed for 1 h. BamHI-digested plasmid pTZ18UgBpK− DNA was dephosphorylated, gel purified, and then ligated with the annealed HAT-encoding oligonucleotide mixture, and then the ligation mixture was transformed into Escherichia coli DH5α competent cells (Invitrogen). .. Single colonies from the transformation were cultured, and plasmid DNAs were extracted by use of a Quick plasmid kit (Qiagen, Valencia, Calif.).

    Ligation:

    Article Title: Immobilized Cobalt Affinity Chromatography Provides a Novel, Efficient Method for Herpes Simplex Virus Type 1 Gene Vector Purification
    Article Snippet: The synthesized oligonucleotides encoding HAT (HAT amino acid sequence, KDHLIHNVHKEEHAHAHNK [ ]) were designed to be flanked by BglII sticky ends (sense, 5′GATCTGAAGGATCATCTCATCCACAATGTCCACAAAGAGGAGCACGCTCATGCCCACAACAAA-3′; antisense, 3′-ACTTCCTAGTAGAGTAGGTGTTACAGGTGTTTCTCCTCGTGCGAGTACGGGTGTTGTTTCTAG-5′). .. The oligonucleotides (10 pM) were mixed in phosphate-buffered saline (PBS), denatured at 100°C for 10 min, and then annealed for 1 h. BamHI-digested plasmid pTZ18UgBpK− DNA was dephosphorylated, gel purified, and then ligated with the annealed HAT-encoding oligonucleotide mixture, and then the ligation mixture was transformed into Escherichia coli DH5α competent cells (Invitrogen). .. Single colonies from the transformation were cultured, and plasmid DNAs were extracted by use of a Quick plasmid kit (Qiagen, Valencia, Calif.).

    Transformation Assay:

    Article Title: Immobilized Cobalt Affinity Chromatography Provides a Novel, Efficient Method for Herpes Simplex Virus Type 1 Gene Vector Purification
    Article Snippet: The synthesized oligonucleotides encoding HAT (HAT amino acid sequence, KDHLIHNVHKEEHAHAHNK [ ]) were designed to be flanked by BglII sticky ends (sense, 5′GATCTGAAGGATCATCTCATCCACAATGTCCACAAAGAGGAGCACGCTCATGCCCACAACAAA-3′; antisense, 3′-ACTTCCTAGTAGAGTAGGTGTTACAGGTGTTTCTCCTCGTGCGAGTACGGGTGTTGTTTCTAG-5′). .. The oligonucleotides (10 pM) were mixed in phosphate-buffered saline (PBS), denatured at 100°C for 10 min, and then annealed for 1 h. BamHI-digested plasmid pTZ18UgBpK− DNA was dephosphorylated, gel purified, and then ligated with the annealed HAT-encoding oligonucleotide mixture, and then the ligation mixture was transformed into Escherichia coli DH5α competent cells (Invitrogen). .. Single colonies from the transformation were cultured, and plasmid DNAs were extracted by use of a Quick plasmid kit (Qiagen, Valencia, Calif.).

    Sequencing:

    Article Title: Digital Imprinting of RNA Recognition and Processing on a Self-Assembled Nucleic Acid Matrix
    Article Snippet: For self-assembled monolayer (SAM) preparation, the mica was mechanically stripped from the silicon-SU8-gold sandwich to provide an ultra-flat gold surface (with a roughness of ~0.2 nm, as confirmed by AFM measurements ) that was immediately incubated in a thiol-containing solution (see below). .. Preparation of RNA-DNA chimera sequences A thiolated, 39-nucleotide RNA-DNA chimera sequence containing an RNase III cleavage site within the 27-nt RNA segment and a BamHI restriction site within the 12-nt DNA segment (see Seq1 below), as well as the complementary, non-thiolated [RNA-DNA] sequence (see Seq2 below) were purchased from ThermoFisher Scientific in HPLC-purified form. ..

    High Performance Liquid Chromatography:

    Article Title: Digital Imprinting of RNA Recognition and Processing on a Self-Assembled Nucleic Acid Matrix
    Article Snippet: For self-assembled monolayer (SAM) preparation, the mica was mechanically stripped from the silicon-SU8-gold sandwich to provide an ultra-flat gold surface (with a roughness of ~0.2 nm, as confirmed by AFM measurements ) that was immediately incubated in a thiol-containing solution (see below). .. Preparation of RNA-DNA chimera sequences A thiolated, 39-nucleotide RNA-DNA chimera sequence containing an RNase III cleavage site within the 27-nt RNA segment and a BamHI restriction site within the 12-nt DNA segment (see Seq1 below), as well as the complementary, non-thiolated [RNA-DNA] sequence (see Seq2 below) were purchased from ThermoFisher Scientific in HPLC-purified form. ..

    Activity Assay:

    Article Title: Generation of DNA cleavage specificities of type II restriction endonucleases by reassortment of target recognition domains
    Article Snippet: AloI, PpiI, TstI, and hybrid proteins were overproduced by using the expression vector pET21b(+) (Novagen, Madison, WI). .. BamHI-linearized DNA of pSEAd-7 was provided by Fermentas UAB and used for the determination of DNA cleavage specificity and the specific activity of hybrids. .. Hybrid genes were constructed on the backbone of plasmids pET-Alosup9 (provided by Fermentas UAB), pET-PpiI, and pET-TstIx (see ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher bamhi xbai sites
    Bamhi Xbai Sites, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi xbai sites/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bamhi xbai sites - by Bioz Stars, 2021-03
    99/100 stars
      Buy from Supplier

    Image Search Results