Structured Review

TaKaRa bamhi restriction sites
Bamhi Restriction Sites, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 47 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bamhi restriction sites/product/TaKaRa
Average 93 stars, based on 47 article reviews
Price from $9.99 to $1999.99
bamhi restriction sites - by Bioz Stars, 2020-07
93/100 stars

Images

Related Articles

Clone Assay:

Article Title: HMGA2 Moderately Increases Fetal Hemoglobin Expression in Human Adult Erythroblasts
Article Snippet: .. The HMGA2 coding region with added XhoI and BamHI restriction sites for directional cloning was amplified by PCR from human genomic DNA with the following PCR primer pairs: HG2A 5'XhoI: 5' ACCCTCGAGTATGAGCGCACGCGGTGAGGG 3' ; V1HG2A 3'BamHI: 5' CCGGATCCCTAGTCCTCTTCGGCAGACTCTTGTGAGGAT 3' using CloneAmp HiFi PCR Premix (Clontech). .. The HMGA2 PCR product was digested with XhoI and BamHI restriction enzymes (New England Biolabs, Ipswich, MA) following manufacturer’s protocol and cleaned up with MinElute Reaction Cleanup Kit (Qiagen, Valencia, CA), followed by cloning into the pLVX-SPTA1-IRES-Puro vector to generate a pLVX-SPTA1-HMGA2-IRES-Puro plasmid.

Article Title: Fibroblast Migration Is Regulated by Myristoylated Alanine-Rich C-Kinase Substrate (MARCKS) Protein
Article Snippet: .. MANS and UMANS were cloned into the EcoRI and BamHI restriction sites of pEGFP-N1 (Clonetech, Mountain View, CA); colonies were screened by colony PCR using pEGFP-N1 sequencing primers and positive colonies were sequenced (MWG, Huntsville, AL). .. Qiagnen’s EndoFree Maxi Kit (Qiagen, Valencia, CA) was used to prepare purified plasmid that was endotoxin free.

Article Title: Gelsolin activity controls efficient early HIV-1 infection
Article Snippet: .. The amplified gelsolin product was cloned into pEGFP-N1 (Clontech, Palo Alto, CA) between the EcoRI and BamHI restriction sites (Takara Bio Inc., Japan). .. Control pEGFP-N1 (Clontech) was used to express free EGFP in permissive lymphocytes.

Article Title: Interaction of NCOR/SMRT Repressor Complexes with Papillomavirus E8^E2C Proteins Inhibits Viral Replication
Article Snippet: .. To generate pIRESpuro 31E8^E2C-HA, pIRESpuro 31E8^E2C KWK mt-HA, pIRESp 16E8^E2C-HA and pIRESpuro 16E8^E2C KWK mt-HA, the respective coding sequences were PCR-amplified to add NheI and BamHI restriction sites and then cloned into pIRESpuro3 (Clontech). .. Plasmid pSG 3xflag-16 E1co was generated by replacing an ApaI/EcoRV fragment of pSG16 E1co [ ] with an N-terminal 3xFlag epitope E1 fusion fragment (Life Technologies).

Article Title: Unusual Topological Arrangement of Structural Motifs in the Baboon Reovirus Fusion-Associated Small Transmembrane Protein
Article Snippet: .. Authentic p15 and the G2A construct were also each cloned in frame with green fluorescent protein (GFP), separated by a six-glycine spacer, using the HindIII and BamHI restriction sites of the pEGFP-N1 vector (Clontech). .. The sequence of all constructs was confirmed by cycle sequencing using the Thermo Sequenase Radiolabeled Terminator Cycle Sequencing kit (United States Biochemical) according to the manufacturer's instructions.

Article Title: Phosphatase of Regenerating Liver-1 (PRL-1) Regulates Actin Dynamics During Immunological Synapse Assembly and T Cell Effector Function
Article Snippet: .. Expression plasmids, siRNA and cell transfection PRL-1 and PRL-1_ΔCAAX cDNAs were amplified by RT-PCR and cloned at the XhoI and BamHI restriction sites of the pEGFP-C1 vector from Clontech Laboratories (CA, USA). .. The resulting constructs encode the GFP-PRL-1 and GFP-PRL-1-ΔCAAX. mCitrine-PRL-1 (mCit-PRL-1) and mCitrine-PRL-2 (mCit-PRL-2) encoding constructs were kindly provided by Dr. Philippe Bastiaens (Max Planck Institute of Molecular Physiology, Dortmund, Germany).

Transfection:

Article Title: Phosphatase of Regenerating Liver-1 (PRL-1) Regulates Actin Dynamics During Immunological Synapse Assembly and T Cell Effector Function
Article Snippet: .. Expression plasmids, siRNA and cell transfection PRL-1 and PRL-1_ΔCAAX cDNAs were amplified by RT-PCR and cloned at the XhoI and BamHI restriction sites of the pEGFP-C1 vector from Clontech Laboratories (CA, USA). .. The resulting constructs encode the GFP-PRL-1 and GFP-PRL-1-ΔCAAX. mCitrine-PRL-1 (mCit-PRL-1) and mCitrine-PRL-2 (mCit-PRL-2) encoding constructs were kindly provided by Dr. Philippe Bastiaens (Max Planck Institute of Molecular Physiology, Dortmund, Germany).

Amplification:

Article Title: HMGA2 Moderately Increases Fetal Hemoglobin Expression in Human Adult Erythroblasts
Article Snippet: .. The HMGA2 coding region with added XhoI and BamHI restriction sites for directional cloning was amplified by PCR from human genomic DNA with the following PCR primer pairs: HG2A 5'XhoI: 5' ACCCTCGAGTATGAGCGCACGCGGTGAGGG 3' ; V1HG2A 3'BamHI: 5' CCGGATCCCTAGTCCTCTTCGGCAGACTCTTGTGAGGAT 3' using CloneAmp HiFi PCR Premix (Clontech). .. The HMGA2 PCR product was digested with XhoI and BamHI restriction enzymes (New England Biolabs, Ipswich, MA) following manufacturer’s protocol and cleaned up with MinElute Reaction Cleanup Kit (Qiagen, Valencia, CA), followed by cloning into the pLVX-SPTA1-IRES-Puro vector to generate a pLVX-SPTA1-HMGA2-IRES-Puro plasmid.

Article Title: Gelsolin activity controls efficient early HIV-1 infection
Article Snippet: .. The amplified gelsolin product was cloned into pEGFP-N1 (Clontech, Palo Alto, CA) between the EcoRI and BamHI restriction sites (Takara Bio Inc., Japan). .. Control pEGFP-N1 (Clontech) was used to express free EGFP in permissive lymphocytes.

Article Title: Phosphatase of Regenerating Liver-1 (PRL-1) Regulates Actin Dynamics During Immunological Synapse Assembly and T Cell Effector Function
Article Snippet: .. Expression plasmids, siRNA and cell transfection PRL-1 and PRL-1_ΔCAAX cDNAs were amplified by RT-PCR and cloned at the XhoI and BamHI restriction sites of the pEGFP-C1 vector from Clontech Laboratories (CA, USA). .. The resulting constructs encode the GFP-PRL-1 and GFP-PRL-1-ΔCAAX. mCitrine-PRL-1 (mCit-PRL-1) and mCitrine-PRL-2 (mCit-PRL-2) encoding constructs were kindly provided by Dr. Philippe Bastiaens (Max Planck Institute of Molecular Physiology, Dortmund, Germany).

Polymerase Chain Reaction:

Article Title: HMGA2 Moderately Increases Fetal Hemoglobin Expression in Human Adult Erythroblasts
Article Snippet: .. The HMGA2 coding region with added XhoI and BamHI restriction sites for directional cloning was amplified by PCR from human genomic DNA with the following PCR primer pairs: HG2A 5'XhoI: 5' ACCCTCGAGTATGAGCGCACGCGGTGAGGG 3' ; V1HG2A 3'BamHI: 5' CCGGATCCCTAGTCCTCTTCGGCAGACTCTTGTGAGGAT 3' using CloneAmp HiFi PCR Premix (Clontech). .. The HMGA2 PCR product was digested with XhoI and BamHI restriction enzymes (New England Biolabs, Ipswich, MA) following manufacturer’s protocol and cleaned up with MinElute Reaction Cleanup Kit (Qiagen, Valencia, CA), followed by cloning into the pLVX-SPTA1-IRES-Puro vector to generate a pLVX-SPTA1-HMGA2-IRES-Puro plasmid.

Article Title: Fibroblast Migration Is Regulated by Myristoylated Alanine-Rich C-Kinase Substrate (MARCKS) Protein
Article Snippet: .. MANS and UMANS were cloned into the EcoRI and BamHI restriction sites of pEGFP-N1 (Clonetech, Mountain View, CA); colonies were screened by colony PCR using pEGFP-N1 sequencing primers and positive colonies were sequenced (MWG, Huntsville, AL). .. Qiagnen’s EndoFree Maxi Kit (Qiagen, Valencia, CA) was used to prepare purified plasmid that was endotoxin free.

Article Title: Interaction of NCOR/SMRT Repressor Complexes with Papillomavirus E8^E2C Proteins Inhibits Viral Replication
Article Snippet: .. To generate pIRESpuro 31E8^E2C-HA, pIRESpuro 31E8^E2C KWK mt-HA, pIRESp 16E8^E2C-HA and pIRESpuro 16E8^E2C KWK mt-HA, the respective coding sequences were PCR-amplified to add NheI and BamHI restriction sites and then cloned into pIRESpuro3 (Clontech). .. Plasmid pSG 3xflag-16 E1co was generated by replacing an ApaI/EcoRV fragment of pSG16 E1co [ ] with an N-terminal 3xFlag epitope E1 fusion fragment (Life Technologies).

Subcloning:

Article Title: Brucella Peptide Cross-Reactive Major Histocompatibility Complex Class I Presentation Activates SIINFEKL-Specific T Cell Receptor-Expressing T Cells
Article Snippet: .. The primers also contained EcoRI and BamHI restriction sites for subcloning into pECFP-N1 (Clontech) to produce an OVA-CFP fusion protein. ..

Construct:

Article Title: Unusual Topological Arrangement of Structural Motifs in the Baboon Reovirus Fusion-Associated Small Transmembrane Protein
Article Snippet: .. Authentic p15 and the G2A construct were also each cloned in frame with green fluorescent protein (GFP), separated by a six-glycine spacer, using the HindIII and BamHI restriction sites of the pEGFP-N1 vector (Clontech). .. The sequence of all constructs was confirmed by cycle sequencing using the Thermo Sequenase Radiolabeled Terminator Cycle Sequencing kit (United States Biochemical) according to the manufacturer's instructions.

Sequencing:

Article Title: Fibroblast Migration Is Regulated by Myristoylated Alanine-Rich C-Kinase Substrate (MARCKS) Protein
Article Snippet: .. MANS and UMANS were cloned into the EcoRI and BamHI restriction sites of pEGFP-N1 (Clonetech, Mountain View, CA); colonies were screened by colony PCR using pEGFP-N1 sequencing primers and positive colonies were sequenced (MWG, Huntsville, AL). .. Qiagnen’s EndoFree Maxi Kit (Qiagen, Valencia, CA) was used to prepare purified plasmid that was endotoxin free.

Expressing:

Article Title: Phosphatase of Regenerating Liver-1 (PRL-1) Regulates Actin Dynamics During Immunological Synapse Assembly and T Cell Effector Function
Article Snippet: .. Expression plasmids, siRNA and cell transfection PRL-1 and PRL-1_ΔCAAX cDNAs were amplified by RT-PCR and cloned at the XhoI and BamHI restriction sites of the pEGFP-C1 vector from Clontech Laboratories (CA, USA). .. The resulting constructs encode the GFP-PRL-1 and GFP-PRL-1-ΔCAAX. mCitrine-PRL-1 (mCit-PRL-1) and mCitrine-PRL-2 (mCit-PRL-2) encoding constructs were kindly provided by Dr. Philippe Bastiaens (Max Planck Institute of Molecular Physiology, Dortmund, Germany).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Phosphatase of Regenerating Liver-1 (PRL-1) Regulates Actin Dynamics During Immunological Synapse Assembly and T Cell Effector Function
Article Snippet: .. Expression plasmids, siRNA and cell transfection PRL-1 and PRL-1_ΔCAAX cDNAs were amplified by RT-PCR and cloned at the XhoI and BamHI restriction sites of the pEGFP-C1 vector from Clontech Laboratories (CA, USA). .. The resulting constructs encode the GFP-PRL-1 and GFP-PRL-1-ΔCAAX. mCitrine-PRL-1 (mCit-PRL-1) and mCitrine-PRL-2 (mCit-PRL-2) encoding constructs were kindly provided by Dr. Philippe Bastiaens (Max Planck Institute of Molecular Physiology, Dortmund, Germany).

Plasmid Preparation:

Article Title: Unusual Topological Arrangement of Structural Motifs in the Baboon Reovirus Fusion-Associated Small Transmembrane Protein
Article Snippet: .. Authentic p15 and the G2A construct were also each cloned in frame with green fluorescent protein (GFP), separated by a six-glycine spacer, using the HindIII and BamHI restriction sites of the pEGFP-N1 vector (Clontech). .. The sequence of all constructs was confirmed by cycle sequencing using the Thermo Sequenase Radiolabeled Terminator Cycle Sequencing kit (United States Biochemical) according to the manufacturer's instructions.

Article Title: De novo biosynthesis of sterols and fatty acids in the Trypanosoma brucei procyclic form: Carbon source preferences and metabolic flux redistributions
Article Snippet: .. The IVDH gene (from position 41 to 1234 bp) containing 6 histidine codons at its 3’-extremity was inserted in the NheI and BamHI restriction sites of the pET28 vector to produce the pET28-IVDH plasmid, which was used to transform the E . coli BL21(DE3) strain harboring pGro7 plasmid (Takara Bio Inc., Japan). .. MZ9B culture media (1 liter) supplemented with 34 μg/ml chloramphenicol, 30 μg/ml kanamycin and 0.3 mg/ml L-arabinose (induction of the expression of GroEL-ES complex) was inoculated with 10 ml of overnight culture grown in LB medium and incubated at 37°C until the culture reached 0.6 OD600.

Article Title: Phosphatase of Regenerating Liver-1 (PRL-1) Regulates Actin Dynamics During Immunological Synapse Assembly and T Cell Effector Function
Article Snippet: .. Expression plasmids, siRNA and cell transfection PRL-1 and PRL-1_ΔCAAX cDNAs were amplified by RT-PCR and cloned at the XhoI and BamHI restriction sites of the pEGFP-C1 vector from Clontech Laboratories (CA, USA). .. The resulting constructs encode the GFP-PRL-1 and GFP-PRL-1-ΔCAAX. mCitrine-PRL-1 (mCit-PRL-1) and mCitrine-PRL-2 (mCit-PRL-2) encoding constructs were kindly provided by Dr. Philippe Bastiaens (Max Planck Institute of Molecular Physiology, Dortmund, Germany).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    TaKaRa bamh1 restriction site
    Bamh1 Restriction Site, supplied by TaKaRa, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamh1 restriction site/product/TaKaRa
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bamh1 restriction site - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    Image Search Results