Structured Review

Promega bamhi hindiii sites
Bamhi Hindiii Sites, supplied by Promega, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bamhi hindiii sites/product/Promega
Average 89 stars, based on 2 article reviews
Price from $9.99 to $1999.99
bamhi hindiii sites - by Bioz Stars, 2020-07
89/100 stars

Images

Related Articles

Clone Assay:

Article Title: Cloning, expression and antiviral activity of IFNγ from the Australian fruit bat, Pteropus alecto.
Article Snippet: .. Expression and purification of bat IFNc in Escherichia coli (rbIFNc) The full length IFNc mature peptide excluding the signal peptide was PCR amplified using primers IFNc9F (5 0 -ACTGGATCCCA GGCTAC ATTTTTAAAAGAAAT-3 0 ) and IFNc10R (5 0 -ACTAAGCTTCTATGCTTT CCAACCACGAAAC-3 0 ) and cloned into the BamHI/HindIII sites of the pGEM-T vector (Promega). .. The DNA sequence coding for the mature IFNc was confirmed by capillary sequencing.

Article Title: Moniliophthora perniciosa Necrosis- and Ethylene-Inducing Protein 2 (MpNep2) as a Metastable Dimer in Solution: Structural and Functional Implications
Article Snippet: .. Protein preparation The MpNep2 sequence was cloned into the pET28a vector (Novagen, San Diego, CA) between BamHI/HindIII sites (Promega Corporation) to yield an HIS-tagged protein. .. After purification, a cloning artifact of 15 residues (GSHMASMTGGQQMGR) remained in the N-terminus region of the MpNep2 sequence.

Amplification:

Article Title: Cloning, expression and antiviral activity of IFNγ from the Australian fruit bat, Pteropus alecto.
Article Snippet: .. Expression and purification of bat IFNc in Escherichia coli (rbIFNc) The full length IFNc mature peptide excluding the signal peptide was PCR amplified using primers IFNc9F (5 0 -ACTGGATCCCA GGCTAC ATTTTTAAAAGAAAT-3 0 ) and IFNc10R (5 0 -ACTAAGCTTCTATGCTTT CCAACCACGAAAC-3 0 ) and cloned into the BamHI/HindIII sites of the pGEM-T vector (Promega). .. The DNA sequence coding for the mature IFNc was confirmed by capillary sequencing.

Purification:

Article Title: Cloning, expression and antiviral activity of IFNγ from the Australian fruit bat, Pteropus alecto.
Article Snippet: .. Expression and purification of bat IFNc in Escherichia coli (rbIFNc) The full length IFNc mature peptide excluding the signal peptide was PCR amplified using primers IFNc9F (5 0 -ACTGGATCCCA GGCTAC ATTTTTAAAAGAAAT-3 0 ) and IFNc10R (5 0 -ACTAAGCTTCTATGCTTT CCAACCACGAAAC-3 0 ) and cloned into the BamHI/HindIII sites of the pGEM-T vector (Promega). .. The DNA sequence coding for the mature IFNc was confirmed by capillary sequencing.

Polymerase Chain Reaction:

Article Title: Cloning, expression and antiviral activity of IFNγ from the Australian fruit bat, Pteropus alecto.
Article Snippet: .. Expression and purification of bat IFNc in Escherichia coli (rbIFNc) The full length IFNc mature peptide excluding the signal peptide was PCR amplified using primers IFNc9F (5 0 -ACTGGATCCCA GGCTAC ATTTTTAAAAGAAAT-3 0 ) and IFNc10R (5 0 -ACTAAGCTTCTATGCTTT CCAACCACGAAAC-3 0 ) and cloned into the BamHI/HindIII sites of the pGEM-T vector (Promega). .. The DNA sequence coding for the mature IFNc was confirmed by capillary sequencing.

Expressing:

Article Title: Cloning, expression and antiviral activity of IFNγ from the Australian fruit bat, Pteropus alecto.
Article Snippet: .. Expression and purification of bat IFNc in Escherichia coli (rbIFNc) The full length IFNc mature peptide excluding the signal peptide was PCR amplified using primers IFNc9F (5 0 -ACTGGATCCCA GGCTAC ATTTTTAAAAGAAAT-3 0 ) and IFNc10R (5 0 -ACTAAGCTTCTATGCTTT CCAACCACGAAAC-3 0 ) and cloned into the BamHI/HindIII sites of the pGEM-T vector (Promega). .. The DNA sequence coding for the mature IFNc was confirmed by capillary sequencing.

Sequencing:

Article Title: Moniliophthora perniciosa Necrosis- and Ethylene-Inducing Protein 2 (MpNep2) as a Metastable Dimer in Solution: Structural and Functional Implications
Article Snippet: .. Protein preparation The MpNep2 sequence was cloned into the pET28a vector (Novagen, San Diego, CA) between BamHI/HindIII sites (Promega Corporation) to yield an HIS-tagged protein. .. After purification, a cloning artifact of 15 residues (GSHMASMTGGQQMGR) remained in the N-terminus region of the MpNep2 sequence.

Plasmid Preparation:

Article Title: Cloning, expression and antiviral activity of IFNγ from the Australian fruit bat, Pteropus alecto.
Article Snippet: .. Expression and purification of bat IFNc in Escherichia coli (rbIFNc) The full length IFNc mature peptide excluding the signal peptide was PCR amplified using primers IFNc9F (5 0 -ACTGGATCCCA GGCTAC ATTTTTAAAAGAAAT-3 0 ) and IFNc10R (5 0 -ACTAAGCTTCTATGCTTT CCAACCACGAAAC-3 0 ) and cloned into the BamHI/HindIII sites of the pGEM-T vector (Promega). .. The DNA sequence coding for the mature IFNc was confirmed by capillary sequencing.

Article Title: Moniliophthora perniciosa Necrosis- and Ethylene-Inducing Protein 2 (MpNep2) as a Metastable Dimer in Solution: Structural and Functional Implications
Article Snippet: .. Protein preparation The MpNep2 sequence was cloned into the pET28a vector (Novagen, San Diego, CA) between BamHI/HindIII sites (Promega Corporation) to yield an HIS-tagged protein. .. After purification, a cloning artifact of 15 residues (GSHMASMTGGQQMGR) remained in the N-terminus region of the MpNep2 sequence.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    Promega hindiii bamhi sites
    Hindiii Bamhi Sites, supplied by Promega, used in various techniques. Bioz Stars score: 89/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hindiii bamhi sites/product/Promega
    Average 89 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    hindiii bamhi sites - by Bioz Stars, 2020-07
    89/100 stars
      Buy from Supplier

    85
    Promega primer gc aagctt ggatcc cgtacgccatcagaccattcacct
    Primer Gc Aagctt Ggatcc Cgtacgccatcagaccattcacct, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer gc aagctt ggatcc cgtacgccatcagaccattcacct/product/Promega
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    primer gc aagctt ggatcc cgtacgccatcagaccattcacct - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    Image Search Results