bacterial top10 cells  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Thermo Fisher bacterial top10 cells
    Bacterial Top10 Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial top10 cells/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bacterial top10 cells - by Bioz Stars, 2020-04
    94/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Characterization of Evolutionarily Conserved Trypanosoma cruzi NatC and NatA-N-Terminal Acetyltransferase Complexes
    Article Snippet: Paragraph title: 2.2. Identification, Cloning, and Expression of Suspected TcNatC and TcNatA Subunits ... Bacterial Top10 cells (Invitrogen) transformed with pGEX5-1-TcNaa10 were grown at 37°C until approximately OD600 0.5 and induced with 0.3 mM isopropyl β -D-1-thiogalactopyranoside (IPTG).

    Amplification:

    Article Title: Characterization of Evolutionarily Conserved Trypanosoma cruzi NatC and NatA-N-Terminal Acetyltransferase Complexes
    Article Snippet: The genes were amplified from genomic DNA using the following primers: TcNAA10 Forward: 5′ AA GAATTC ATGCAGATCCGTCGC 3′, TcNAA10 Reverse: 5′AAA CTCGAG TCACTTTTTCGTCTTGCC 3′, TcNAA15 Forward: 5′ATCG GAATTC CGGTAGTGCTTCCTCCGGCG 3′, and TcNAA15 Reverse: 5′ATCG CTCGAG GCGCTGGCCAACACCTCATCA 3′. .. Bacterial Top10 cells (Invitrogen) transformed with pGEX5-1-TcNaa10 were grown at 37°C until approximately OD600 0.5 and induced with 0.3 mM isopropyl β -D-1-thiogalactopyranoside (IPTG).

    Protease Inhibitor:

    Article Title: Characterization of Evolutionarily Conserved Trypanosoma cruzi NatC and NatA-N-Terminal Acetyltransferase Complexes
    Article Snippet: Bacterial Top10 cells (Invitrogen) transformed with pGEX5-1-TcNaa10 were grown at 37°C until approximately OD600 0.5 and induced with 0.3 mM isopropyl β -D-1-thiogalactopyranoside (IPTG). .. Bacterial Top10 cells (Invitrogen) transformed with pGEX5-1-TcNaa10 were grown at 37°C until approximately OD600 0.5 and induced with 0.3 mM isopropyl β -D-1-thiogalactopyranoside (IPTG).

    Expressing:

    Article Title: Characterization of Evolutionarily Conserved Trypanosoma cruzi NatC and NatA-N-Terminal Acetyltransferase Complexes
    Article Snippet: Paragraph title: 2.2. Identification, Cloning, and Expression of Suspected TcNatC and TcNatA Subunits ... Bacterial Top10 cells (Invitrogen) transformed with pGEX5-1-TcNaa10 were grown at 37°C until approximately OD600 0.5 and induced with 0.3 mM isopropyl β -D-1-thiogalactopyranoside (IPTG).

    Transformation Assay:

    Article Title: Characterization of Evolutionarily Conserved Trypanosoma cruzi NatC and NatA-N-Terminal Acetyltransferase Complexes
    Article Snippet: .. Bacterial Top10 cells (Invitrogen) transformed with pGEX5-1-TcNaa10 were grown at 37°C until approximately OD600 0.5 and induced with 0.3 mM isopropyl β -D-1-thiogalactopyranoside (IPTG). .. Cells were grown and processed as described before [ ], except that protease inhibitor (EDTA-free tablet inhibitor from Roche) was used.

    Plasmid Preparation:

    Article Title: Characterization of Evolutionarily Conserved Trypanosoma cruzi NatC and NatA-N-Terminal Acetyltransferase Complexes
    Article Snippet: The genes were subsequently cloned into the pGEX5-1 vector expressing GST (glutathione S-transferase) yielding pGEX5-1-TcNaa10 and pGEX5-1-TcNaa15. .. Bacterial Top10 cells (Invitrogen) transformed with pGEX5-1-TcNaa10 were grown at 37°C until approximately OD600 0.5 and induced with 0.3 mM isopropyl β -D-1-thiogalactopyranoside (IPTG).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher competent e coli bacteria
    Competent E Coli Bacteria, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/competent e coli bacteria/product/Thermo Fisher
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    competent e coli bacteria - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    91
    Thermo Fisher cells escherichia coli
    Cells Escherichia Coli, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cells escherichia coli/product/Thermo Fisher
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cells escherichia coli - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    93
    Thermo Fisher coli top10 cells
    Coli Top10 Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/coli top10 cells/product/Thermo Fisher
    Average 93 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    coli top10 cells - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    Image Search Results