his6 pdcd5 flag  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Millipore his6 pdcd5 flag
    <t>PDCD5</t> inhibits β-tubulin folding. A , rate of association or dissociation from CCT complexes was measured by pulse-chase immunoprecipitations of CCTϵ from HEK-293T cells transfected with <t>PDCD5-FLAG.</t> The rate of association of CCTα and -γ subunits ( black , t ½ = 112 ± 18 min) and PDCD5 ( red , t ½ = 44 ± 2 min) was calculated along with the rate of dissociation for tubulin ( blue , t ½ = 39 ± 1 min). B , binding of β-tubulin to PDCD5 was measured by co-immunoprecipitation from HEK-293T cells transfected with FLAG-PDCD5 or empty vector. C , effect of CCT knockdown on β-tubulin binding to PDCD5 was measured by co-immunoprecipitation from HEK-293T cells treated with CCTζ siRNA or a control siRNA and later transfected with FLAG-PDCD5. The ratio of the β-tubulin band to the PDCD5 band was calculated and normalized to the control. D , folding of the indicated proteins by CCT was measured by pulse-chase co-immunoprecipitations from HEK-293T cells treated with PDCD5 siRNA or negative control as indicated (see “Experimental Procedures”). E and F , effect of PDCD5 knockdown ( E ) or overexpression ( F ) on β-tubulin binding to CCT was measured by co-immunoprecipitation with CCTϵ and immunoblotting as indicated. The ratio of the β-tubulin band to the CCTϵ band was calculated and normalized to the control. In all experiments, bars represent the average ± S.E. from at least three experiments. Representative gels or blots are shown below each graph. PDCD5 knockdown averaged between 65 and 80% as measured by immunoblotting.
    His6 Pdcd5 Flag, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 179 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/his6 pdcd5 flag/product/Millipore
    Average 86 stars, based on 179 article reviews
    Price from $9.99 to $1999.99
    his6 pdcd5 flag - by Bioz Stars, 2020-07
    86/100 stars

    Images

    1) Product Images from "Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding *Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding * ♦"

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding *Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding * ♦

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M113.542159

    PDCD5 inhibits β-tubulin folding. A , rate of association or dissociation from CCT complexes was measured by pulse-chase immunoprecipitations of CCTϵ from HEK-293T cells transfected with PDCD5-FLAG. The rate of association of CCTα and -γ subunits ( black , t ½ = 112 ± 18 min) and PDCD5 ( red , t ½ = 44 ± 2 min) was calculated along with the rate of dissociation for tubulin ( blue , t ½ = 39 ± 1 min). B , binding of β-tubulin to PDCD5 was measured by co-immunoprecipitation from HEK-293T cells transfected with FLAG-PDCD5 or empty vector. C , effect of CCT knockdown on β-tubulin binding to PDCD5 was measured by co-immunoprecipitation from HEK-293T cells treated with CCTζ siRNA or a control siRNA and later transfected with FLAG-PDCD5. The ratio of the β-tubulin band to the PDCD5 band was calculated and normalized to the control. D , folding of the indicated proteins by CCT was measured by pulse-chase co-immunoprecipitations from HEK-293T cells treated with PDCD5 siRNA or negative control as indicated (see “Experimental Procedures”). E and F , effect of PDCD5 knockdown ( E ) or overexpression ( F ) on β-tubulin binding to CCT was measured by co-immunoprecipitation with CCTϵ and immunoblotting as indicated. The ratio of the β-tubulin band to the CCTϵ band was calculated and normalized to the control. In all experiments, bars represent the average ± S.E. from at least three experiments. Representative gels or blots are shown below each graph. PDCD5 knockdown averaged between 65 and 80% as measured by immunoblotting.
    Figure Legend Snippet: PDCD5 inhibits β-tubulin folding. A , rate of association or dissociation from CCT complexes was measured by pulse-chase immunoprecipitations of CCTϵ from HEK-293T cells transfected with PDCD5-FLAG. The rate of association of CCTα and -γ subunits ( black , t ½ = 112 ± 18 min) and PDCD5 ( red , t ½ = 44 ± 2 min) was calculated along with the rate of dissociation for tubulin ( blue , t ½ = 39 ± 1 min). B , binding of β-tubulin to PDCD5 was measured by co-immunoprecipitation from HEK-293T cells transfected with FLAG-PDCD5 or empty vector. C , effect of CCT knockdown on β-tubulin binding to PDCD5 was measured by co-immunoprecipitation from HEK-293T cells treated with CCTζ siRNA or a control siRNA and later transfected with FLAG-PDCD5. The ratio of the β-tubulin band to the PDCD5 band was calculated and normalized to the control. D , folding of the indicated proteins by CCT was measured by pulse-chase co-immunoprecipitations from HEK-293T cells treated with PDCD5 siRNA or negative control as indicated (see “Experimental Procedures”). E and F , effect of PDCD5 knockdown ( E ) or overexpression ( F ) on β-tubulin binding to CCT was measured by co-immunoprecipitation with CCTϵ and immunoblotting as indicated. The ratio of the β-tubulin band to the CCTϵ band was calculated and normalized to the control. In all experiments, bars represent the average ± S.E. from at least three experiments. Representative gels or blots are shown below each graph. PDCD5 knockdown averaged between 65 and 80% as measured by immunoblotting.

    Techniques Used: Pulse Chase, Transfection, Binding Assay, Immunoprecipitation, Plasmid Preparation, Negative Control, Over Expression

    PhLP1 and PDCD5 bind CCT independently of each other. PDCD5 was either overexpressed ( A ) or knocked down ( B ), along with PhLP1-Myc overexpression in HEK-293T cells. Cell lysates were immunoprecipitated with anti-CCTϵ ( A ) or anti-Myc ( B ) and blotted as indicated. PhLP1 was either overexpressed ( C ) or knocked down ( D ), along with PDCD5-FLAG overexpression in HEK-293T cells. Cell lysates were immunoprecipitated with anti-CCTϵ ( C ) or anti-FLAG ( D ) and blotted as indicated. Bars represent the average ± S.E. from at least three experiments. Cell lysates were blotted for PDCD5-FLAG, endogenous PDCD5, PhLP1-Myc, or endogenous PhLP1 as indicated to verify the overexpression and knockdowns. Representative blots are shown below the graphs.
    Figure Legend Snippet: PhLP1 and PDCD5 bind CCT independently of each other. PDCD5 was either overexpressed ( A ) or knocked down ( B ), along with PhLP1-Myc overexpression in HEK-293T cells. Cell lysates were immunoprecipitated with anti-CCTϵ ( A ) or anti-Myc ( B ) and blotted as indicated. PhLP1 was either overexpressed ( C ) or knocked down ( D ), along with PDCD5-FLAG overexpression in HEK-293T cells. Cell lysates were immunoprecipitated with anti-CCTϵ ( C ) or anti-FLAG ( D ) and blotted as indicated. Bars represent the average ± S.E. from at least three experiments. Cell lysates were blotted for PDCD5-FLAG, endogenous PDCD5, PhLP1-Myc, or endogenous PhLP1 as indicated to verify the overexpression and knockdowns. Representative blots are shown below the graphs.

    Techniques Used: Over Expression, Immunoprecipitation

    PDCD5 forms a complex with PhLP1 and CCT. A , binding of PDCD5 to phosducin family members was measured by co-immunoprecipitation from HEK-293T cells transfected with PDCD5-FLAG along with Myc-tagged phosducin family members as indicated. After 48 h, cells were lysed, immunoprecipitated with an anti-Myc antibody, and immunoblotted for PDCD5-FLAG. B , binding of purified PDCD5 to PhLP1 or CK2-phosphorylated PhLP1 was assessed by co-immunoprecipitation in vitro . Phosphorylated PhLP1, unphosphorylated PhLP1, or no PhLP1 was incubated with PDCD5, immunoprecipitated with an Myc antibody, and blotted as indicated. C , simultaneous binding of PDCD5 and PhLP1 was measured by co-immunoprecipitation. HEK-293T cells were transfected with PDCD5-FLAG or empty vector, immunoprecipitated with FLAG, and blotted for endogenous PhLP1 and CCTϵ ( left panel ). Endogenous CCTϵ was also immunoprecipitated and blotted for endogenous PhLP1 and PDCD5-FLAG ( right panel ). A nontargeting Myc antibody served as a negative control. D , effect of CCT knockdown on PDCD5 binding to PhLP1 was measured by co-immunoprecipitation of PhLP1-Myc from HEK-293T cells treated with CCTζ siRNA or a control siRNA and later transfected with FLAG-PDCD5 and PhLP1-Myc. The ratio of the PDCD5 band to the PhLP1 band was calculated and normalized to the control. Bars represent the average ± S.E. of the mean from at least three experiments. Representative blots are shown below the graphs. E , formation of a PhLP1·PDCD5·CCT complex was demonstrated in double immunoprecipitation experiments from HEK-293T cells transfected with PDCD5-FLAG along with PhLP1-TEV-Myc or empty vector.
    Figure Legend Snippet: PDCD5 forms a complex with PhLP1 and CCT. A , binding of PDCD5 to phosducin family members was measured by co-immunoprecipitation from HEK-293T cells transfected with PDCD5-FLAG along with Myc-tagged phosducin family members as indicated. After 48 h, cells were lysed, immunoprecipitated with an anti-Myc antibody, and immunoblotted for PDCD5-FLAG. B , binding of purified PDCD5 to PhLP1 or CK2-phosphorylated PhLP1 was assessed by co-immunoprecipitation in vitro . Phosphorylated PhLP1, unphosphorylated PhLP1, or no PhLP1 was incubated with PDCD5, immunoprecipitated with an Myc antibody, and blotted as indicated. C , simultaneous binding of PDCD5 and PhLP1 was measured by co-immunoprecipitation. HEK-293T cells were transfected with PDCD5-FLAG or empty vector, immunoprecipitated with FLAG, and blotted for endogenous PhLP1 and CCTϵ ( left panel ). Endogenous CCTϵ was also immunoprecipitated and blotted for endogenous PhLP1 and PDCD5-FLAG ( right panel ). A nontargeting Myc antibody served as a negative control. D , effect of CCT knockdown on PDCD5 binding to PhLP1 was measured by co-immunoprecipitation of PhLP1-Myc from HEK-293T cells treated with CCTζ siRNA or a control siRNA and later transfected with FLAG-PDCD5 and PhLP1-Myc. The ratio of the PDCD5 band to the PhLP1 band was calculated and normalized to the control. Bars represent the average ± S.E. of the mean from at least three experiments. Representative blots are shown below the graphs. E , formation of a PhLP1·PDCD5·CCT complex was demonstrated in double immunoprecipitation experiments from HEK-293T cells transfected with PDCD5-FLAG along with PhLP1-TEV-Myc or empty vector.

    Techniques Used: Binding Assay, Immunoprecipitation, Transfection, Purification, In Vitro, Incubation, Plasmid Preparation, Negative Control

    2) Product Images from "The Human Polyoma JC Virus Agnoprotein Acts as a Viroporin"

    Article Title: The Human Polyoma JC Virus Agnoprotein Acts as a Viroporin

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1000801

    The N-terminus of agnoprotein is necessary for targeting to the ER. (A) Hydrophobicity plot of JCV agnoprotein. The plot was drawn using the Lyte-Doolittle method of calculating hydrophilicity over a window length of seven [54] . (B) The N-terminal region of agnoprotein is characterized by the presence of positively charged residues. Schematic representation of GST-EGFP fusion constructs of wild type (WT) agnoprotein and its various mutants. The green boxes indicate the basic amino acid clusters, which could be important for determining the orientation to the membrane. A gray box indicates a hydrophobic amino acid stretch. (C) Immunoblot analyses of GST-EGFP–fused agnoprotein and its mutants prepared from the ER-nuclear fraction of transfected HEK293 cells prepared by sucrose density centrifugation as described in the Materials and Methods . WT and N46 mutant were detected in the ER-rich fractions, whereas the C6 mutant and GST-EGFP were not.
    Figure Legend Snippet: The N-terminus of agnoprotein is necessary for targeting to the ER. (A) Hydrophobicity plot of JCV agnoprotein. The plot was drawn using the Lyte-Doolittle method of calculating hydrophilicity over a window length of seven [54] . (B) The N-terminal region of agnoprotein is characterized by the presence of positively charged residues. Schematic representation of GST-EGFP fusion constructs of wild type (WT) agnoprotein and its various mutants. The green boxes indicate the basic amino acid clusters, which could be important for determining the orientation to the membrane. A gray box indicates a hydrophobic amino acid stretch. (C) Immunoblot analyses of GST-EGFP–fused agnoprotein and its mutants prepared from the ER-nuclear fraction of transfected HEK293 cells prepared by sucrose density centrifugation as described in the Materials and Methods . WT and N46 mutant were detected in the ER-rich fractions, whereas the C6 mutant and GST-EGFP were not.

    Techniques Used: Construct, Transfection, Centrifugation, Mutagenesis

    Agnoprotein also localizes at the plasma membranes as an integral membrane protein. (A) Homogenates from 293AG cells which are agnoprotein-inducible cell lines with doxycycline (DOX) treatment were subjected to subcellular fractionation as described in the Materials and Methods . The cytosolic and microsomal fractions were analyzed by immunoblot analysis using antibodies to agnoprotein, calnexin (ER marker), BiP (ER marker), and α-tubulin (cytosolic marker). (B) Microsomes were incubated for 30 min on ice with homogenization buffer alone (−), or with buffer containing 1 M KCl, or 2 M urea. The microsomes were also treated with buffer containing 0.2 M sodium carbonate (pH 11.0). Following treatment, the microsomes were separated into supernatant (S) and pellet (P) fractions by ultracentrifugation. (C) Microsomes were also subjected to Triton X-114 phase separation, and aqueous phase (A, lane 1), detergent phase (D, lane 2), and insoluble aggregates (P, lane 3) were obtained. (D and E) HeLa (D) and SVG-A (E) cells were transfected with pERedNLS-Agno or control vectors. Cell surface agnoprotein on living cells was detected by incubation with antibody against the agnoprotein C-terminal region, followed by staining with Alexa 488-labeled anti-rabbit IgG antibody. DsRed signals in the nuclei represent a marker of transfection. (F) Flow cytometry analysis of cell surface expression of agnoprotein in 293T cells transfected with pCXSN-Agno (WT, left panel) or vector control (Mock, right panel). The black solid line represents anti-agnoprotein antibody staining and the light gray shade represents control rabbit IgG staining, followed by staining with FITC-labeled anti-rabbit IgG antibody.
    Figure Legend Snippet: Agnoprotein also localizes at the plasma membranes as an integral membrane protein. (A) Homogenates from 293AG cells which are agnoprotein-inducible cell lines with doxycycline (DOX) treatment were subjected to subcellular fractionation as described in the Materials and Methods . The cytosolic and microsomal fractions were analyzed by immunoblot analysis using antibodies to agnoprotein, calnexin (ER marker), BiP (ER marker), and α-tubulin (cytosolic marker). (B) Microsomes were incubated for 30 min on ice with homogenization buffer alone (−), or with buffer containing 1 M KCl, or 2 M urea. The microsomes were also treated with buffer containing 0.2 M sodium carbonate (pH 11.0). Following treatment, the microsomes were separated into supernatant (S) and pellet (P) fractions by ultracentrifugation. (C) Microsomes were also subjected to Triton X-114 phase separation, and aqueous phase (A, lane 1), detergent phase (D, lane 2), and insoluble aggregates (P, lane 3) were obtained. (D and E) HeLa (D) and SVG-A (E) cells were transfected with pERedNLS-Agno or control vectors. Cell surface agnoprotein on living cells was detected by incubation with antibody against the agnoprotein C-terminal region, followed by staining with Alexa 488-labeled anti-rabbit IgG antibody. DsRed signals in the nuclei represent a marker of transfection. (F) Flow cytometry analysis of cell surface expression of agnoprotein in 293T cells transfected with pCXSN-Agno (WT, left panel) or vector control (Mock, right panel). The black solid line represents anti-agnoprotein antibody staining and the light gray shade represents control rabbit IgG staining, followed by staining with FITC-labeled anti-rabbit IgG antibody.

    Techniques Used: Fractionation, Marker, Incubation, Homogenization, Transfection, Staining, Labeling, Flow Cytometry, Cytometry, Expressing, Plasmid Preparation

    Agnoprotein facilitates virion release and enhances viral propagation. (A) The agnoprotein deletion mutant virus (ΔAgnoJCV) fails to promote viral propagation. Viral growth was monitored by indirect immunofluorescence of VP1. Results shown in the graph were created by determining the average proportion of VP1-positive cells in 3 to 10 microscopy fields counted. Significance of changes were analyzed by student's t -test and indicated by an asterisk (*p
    Figure Legend Snippet: Agnoprotein facilitates virion release and enhances viral propagation. (A) The agnoprotein deletion mutant virus (ΔAgnoJCV) fails to promote viral propagation. Viral growth was monitored by indirect immunofluorescence of VP1. Results shown in the graph were created by determining the average proportion of VP1-positive cells in 3 to 10 microscopy fields counted. Significance of changes were analyzed by student's t -test and indicated by an asterisk (*p

    Techniques Used: Mutagenesis, Immunofluorescence, Microscopy

    Agnoprotein localized at the ER. (A) Agnoprotein localizes in the ER. Confocal microscopy showed the colocalization of agnoprotein (Agno) and Calreticulin (ER marker) in JCV infected SVG-A cells. The boxed areas in the upper panel are shown at higher magnification in the lower panel. (B) The dominant co-localization of agnoprotein and BiP (ER marker) in JCV infected cells was shown by iodexanol density gradient analysis. (C and D) The intracellular localization of agnoprotein was analyzed at various times after infection by confocal microscopy. Almost all agnoprotein distribute as the ER pattern (C left panel), and there were a few cells with the diffuse pattern (C right panel) at the early stages of infection. The percentage of cells with the diffuse pattern was found to increase in a time-dependent manner (D). Scale bars, 10 µm.
    Figure Legend Snippet: Agnoprotein localized at the ER. (A) Agnoprotein localizes in the ER. Confocal microscopy showed the colocalization of agnoprotein (Agno) and Calreticulin (ER marker) in JCV infected SVG-A cells. The boxed areas in the upper panel are shown at higher magnification in the lower panel. (B) The dominant co-localization of agnoprotein and BiP (ER marker) in JCV infected cells was shown by iodexanol density gradient analysis. (C and D) The intracellular localization of agnoprotein was analyzed at various times after infection by confocal microscopy. Almost all agnoprotein distribute as the ER pattern (C left panel), and there were a few cells with the diffuse pattern (C right panel) at the early stages of infection. The percentage of cells with the diffuse pattern was found to increase in a time-dependent manner (D). Scale bars, 10 µm.

    Techniques Used: Confocal Microscopy, Marker, Infection

    “RK” residues of Agnoprotein are necessary for viroporin activity. (A) HygB permeability assays with HeLa cells transfected with control vector (Mock), pCFPNLS-Agno (Agno), pCFPNLS-N46 (N46), or pCFPNLS-RK8AA (RK8AA). (B) Viral growth was monitored by indirect immunofluorescence of VP1 (*p
    Figure Legend Snippet: “RK” residues of Agnoprotein are necessary for viroporin activity. (A) HygB permeability assays with HeLa cells transfected with control vector (Mock), pCFPNLS-Agno (Agno), pCFPNLS-N46 (N46), or pCFPNLS-RK8AA (RK8AA). (B) Viral growth was monitored by indirect immunofluorescence of VP1 (*p

    Techniques Used: Activity Assay, Permeability, Transfection, Plasmid Preparation, Immunofluorescence

    Agnoprotein forms homo-oligomers. (A) 293T cells were transfected with Myc-agnoprotein/Flag-agnoprotein or Myc-agnoprotein alone. Cell lysates were subjected to immunoprecipitation with antibodies to Flag (IP: Flag). (B) SVG-A cells uninfected or infected with JCV [JCV (−) or JCV (+), respectively] were reacted with DSS cross-linker at the indicated concentration (0, 0.5, 1, 2, or 5 mM). Triton X-100 soluble extracts were resolved by SDS-PAGE, and monomer (arrowhead) and oligomers (arrows) of agnoprotein were detected by immunoblot analysis using anti-agnoprotein antibody. (C and D) Intermolecular FRET in SVG-A cells expressing agnoprotein fused with CFP (CFP-Agno) or YFP (YFP-Agno). Pseudocolour images represent normalized values (FRET N ), with the intensity of each color indicating the mean intensity of FRET and the total spillover from the relevant FRET partners as indicated at the bottom of the photographs. The upper (1.6) and lower (0.9) limits of the ratio range are shown at the right. Numbers of samples: CFP + YFP, n = 53; CFP-Agno + YFP-Agno, n = 59 (**p
    Figure Legend Snippet: Agnoprotein forms homo-oligomers. (A) 293T cells were transfected with Myc-agnoprotein/Flag-agnoprotein or Myc-agnoprotein alone. Cell lysates were subjected to immunoprecipitation with antibodies to Flag (IP: Flag). (B) SVG-A cells uninfected or infected with JCV [JCV (−) or JCV (+), respectively] were reacted with DSS cross-linker at the indicated concentration (0, 0.5, 1, 2, or 5 mM). Triton X-100 soluble extracts were resolved by SDS-PAGE, and monomer (arrowhead) and oligomers (arrows) of agnoprotein were detected by immunoblot analysis using anti-agnoprotein antibody. (C and D) Intermolecular FRET in SVG-A cells expressing agnoprotein fused with CFP (CFP-Agno) or YFP (YFP-Agno). Pseudocolour images represent normalized values (FRET N ), with the intensity of each color indicating the mean intensity of FRET and the total spillover from the relevant FRET partners as indicated at the bottom of the photographs. The upper (1.6) and lower (0.9) limits of the ratio range are shown at the right. Numbers of samples: CFP + YFP, n = 53; CFP-Agno + YFP-Agno, n = 59 (**p

    Techniques Used: Transfection, Immunoprecipitation, Infection, Concentration Assay, SDS Page, Expressing

    Agnoprotein impairs membrane integrity. (A) HeLa cells were transfected with pCXSN-Agno (Agno) or pCXSN (Mock) and assayed by flow cytometry for MC540 binding. NT: not transfected. (B) HeLa cells were either transfected with control vector (Mock) or pCFPNLS-Agno (Agno) for 72 h. The cells were pretreated with or without HygB (400 µg/ml), radiolabeled with [ 35 S] Met-Cys, and incubated in the absence (+) or presence (−) of HygB for 2 h. The cell extracts were harvested, and the marker protein was immunoprecipitated with an anti-GFP antibody and analyzed by SDS-PAGE. (C) The results of (B) were quantified by Image Gauge V3.2 software. The bar graph represents the protein synthesis ratio in the presence to the absence of HygB, and corresponds to an average of triplicates ± S.D. Significance was analyzed by Student's t -test and is indicated by asterisk (*p
    Figure Legend Snippet: Agnoprotein impairs membrane integrity. (A) HeLa cells were transfected with pCXSN-Agno (Agno) or pCXSN (Mock) and assayed by flow cytometry for MC540 binding. NT: not transfected. (B) HeLa cells were either transfected with control vector (Mock) or pCFPNLS-Agno (Agno) for 72 h. The cells were pretreated with or without HygB (400 µg/ml), radiolabeled with [ 35 S] Met-Cys, and incubated in the absence (+) or presence (−) of HygB for 2 h. The cell extracts were harvested, and the marker protein was immunoprecipitated with an anti-GFP antibody and analyzed by SDS-PAGE. (C) The results of (B) were quantified by Image Gauge V3.2 software. The bar graph represents the protein synthesis ratio in the presence to the absence of HygB, and corresponds to an average of triplicates ± S.D. Significance was analyzed by Student's t -test and is indicated by asterisk (*p

    Techniques Used: Transfection, Flow Cytometry, Cytometry, Binding Assay, Plasmid Preparation, Incubation, Marker, Immunoprecipitation, SDS Page, Software

    3) Product Images from "Chlamydomonas reinhardtii Has Multiple Prolyl 4-Hydroxylases, One of Which Is Essential for Proper Cell Wall Assembly [W]"

    Article Title: Chlamydomonas reinhardtii Has Multiple Prolyl 4-Hydroxylases, One of Which Is Essential for Proper Cell Wall Assembly [W]

    Journal:

    doi: 10.1105/tpc.106.042739

    Expression and Analysis of Recombinant Cr-P4H-1A and Cr-P4H-1B
    Figure Legend Snippet: Expression and Analysis of Recombinant Cr-P4H-1A and Cr-P4H-1B

    Techniques Used: Expressing, Recombinant

    Expression of Recombinant Cr-P4H-1A and Cr-P4H-1B Polypeptides in Insect Cells or in E. coli and Their Purification.
    Figure Legend Snippet: Expression of Recombinant Cr-P4H-1A and Cr-P4H-1B Polypeptides in Insect Cells or in E. coli and Their Purification.

    Techniques Used: Expressing, Recombinant, Purification

    Analysis of the Hydroxylation of the Pro Residues in (Pro-Pro-Gly) 10 by Cr-P4H-1A.
    Figure Legend Snippet: Analysis of the Hydroxylation of the Pro Residues in (Pro-Pro-Gly) 10 by Cr-P4H-1A.

    Techniques Used:

    CD Analysis of the Temperature Stability of the Recombinant Cr-P4H-1A Polypeptide.
    Figure Legend Snippet: CD Analysis of the Temperature Stability of the Recombinant Cr-P4H-1A Polypeptide.

    Techniques Used: Recombinant

    4) Product Images from "Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer"

    Article Title: Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer

    Journal: Cancers

    doi: 10.3390/cancers6042012

    Stat3β monoclonal antibodies specifically immunoprecipitate Stat3β from protein lysates. Stat3β Mab 516G10H9 (1:30) and Stat3α Ab (D1A5) were added to 200 µg of protein from either untransfected Stat3 −/− murine embryonic fibroblasts (MEFs) or cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP, incubated overnight at 4 °C. The lysates were then incubated with protein G-agarose beads for 30 min at 4 °C and after centrifugation, the beads boiled in loading dye and the eluted proteins subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, upper panel). An equivalent volume of cell lysates (20 µL) used in each reaction were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, lower panel) to indicate the amount of protein input.
    Figure Legend Snippet: Stat3β monoclonal antibodies specifically immunoprecipitate Stat3β from protein lysates. Stat3β Mab 516G10H9 (1:30) and Stat3α Ab (D1A5) were added to 200 µg of protein from either untransfected Stat3 −/− murine embryonic fibroblasts (MEFs) or cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP, incubated overnight at 4 °C. The lysates were then incubated with protein G-agarose beads for 30 min at 4 °C and after centrifugation, the beads boiled in loading dye and the eluted proteins subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, upper panel). An equivalent volume of cell lysates (20 µL) used in each reaction were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, lower panel) to indicate the amount of protein input.

    Techniques Used: Transfection, Incubation, Centrifugation, SDS Page

    Stat3β overexpression correlates with Stat3 phosphorylation in breast cancer cell lines. In panel ( A ), lysates (100 µg protein) from normal breast epithelial cells MCF-12A, and breast cancer cell lines MCF-7, T47D, BT-474, MDA-MB 453, HCC1954, MDA-MB-231, MDA-MB-468, and BT549 cells were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total pStat3 (Tyr-705, clone D3A7), tStat3 (clone 124H6), Stat3α (clone D1A5), Stat3β (1488 G6G5) and GAPDH. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 10–11). Stat3β and GAPDH levels were quantified by densitometry and the GAPDH-normalized pStat3 levels plotted as a function of their corresponding Stat3β levels ( B , Spearman r = 0.7667, p
    Figure Legend Snippet: Stat3β overexpression correlates with Stat3 phosphorylation in breast cancer cell lines. In panel ( A ), lysates (100 µg protein) from normal breast epithelial cells MCF-12A, and breast cancer cell lines MCF-7, T47D, BT-474, MDA-MB 453, HCC1954, MDA-MB-231, MDA-MB-468, and BT549 cells were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total pStat3 (Tyr-705, clone D3A7), tStat3 (clone 124H6), Stat3α (clone D1A5), Stat3β (1488 G6G5) and GAPDH. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 10–11). Stat3β and GAPDH levels were quantified by densitometry and the GAPDH-normalized pStat3 levels plotted as a function of their corresponding Stat3β levels ( B , Spearman r = 0.7667, p

    Techniques Used: Over Expression, Multiple Displacement Amplification, SDS Page, Transfection

    Coomassie stain of the purified Stat3β specific monoclonal antibodies. Ammonium-sulphate precipitated proteins were passed through protein G columns. The protein G-adsorbed antibodies were eluted and pooled together (pool 1). The flow through was again passed through the column to recover all unadsorbed antibodies and were similarly eluted and pooled (pool 2). Exactly 2 μL and 4 μL of pool 1 (lanes 2 and 3) and 2 μL and 4 μL of pool 2 (lanes 4 and 5) of pure antibodies were boiled with SDS-containing loading dye and ran on PAGE along with molecular weight markers (lane 1) and increasing amounts (1 µg, 2 µg, 3 µg) of control protein Bovine Serum Albumin (BSA, lanes 7–9) and stained with coomassie. Representative gels run as described above, for the three antibodies 516 G10H9 (upper panel), 954 E9E7 (middle panel) and 1488 G6G5 are shown.
    Figure Legend Snippet: Coomassie stain of the purified Stat3β specific monoclonal antibodies. Ammonium-sulphate precipitated proteins were passed through protein G columns. The protein G-adsorbed antibodies were eluted and pooled together (pool 1). The flow through was again passed through the column to recover all unadsorbed antibodies and were similarly eluted and pooled (pool 2). Exactly 2 μL and 4 μL of pool 1 (lanes 2 and 3) and 2 μL and 4 μL of pool 2 (lanes 4 and 5) of pure antibodies were boiled with SDS-containing loading dye and ran on PAGE along with molecular weight markers (lane 1) and increasing amounts (1 µg, 2 µg, 3 µg) of control protein Bovine Serum Albumin (BSA, lanes 7–9) and stained with coomassie. Representative gels run as described above, for the three antibodies 516 G10H9 (upper panel), 954 E9E7 (middle panel) and 1488 G6G5 are shown.

    Techniques Used: Staining, Purification, Flow Cytometry, Polyacrylamide Gel Electrophoresis, Molecular Weight

    Stat3β monoclonal antibodies are specific for the CT7 epitope found exclusively on Stat3β. Truncated pure Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were purified from bacterial supernatants as described in the Methods section. Decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed ( A ) with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as ( B ) Stat3α (Clone D1A5), two total Stat3 antibodies, one raised against a C-terminal peptide (clone 124H6) and one raised against a N-terminal peptide (aa 149–262, clone STAAD22A) and visualized by chemiluminiscence. Protein in a replica gel was also detected using silver staining and shown at the bottom of panel ( B ). In panel ( C ), decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as total Stat3 antibody (clone 124H6) and visualized by chemiluminiscence.
    Figure Legend Snippet: Stat3β monoclonal antibodies are specific for the CT7 epitope found exclusively on Stat3β. Truncated pure Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were purified from bacterial supernatants as described in the Methods section. Decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed ( A ) with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as ( B ) Stat3α (Clone D1A5), two total Stat3 antibodies, one raised against a C-terminal peptide (clone 124H6) and one raised against a N-terminal peptide (aa 149–262, clone STAAD22A) and visualized by chemiluminiscence. Protein in a replica gel was also detected using silver staining and shown at the bottom of panel ( B ). In panel ( C ), decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as total Stat3 antibody (clone 124H6) and visualized by chemiluminiscence.

    Techniques Used: Purification, SDS Page, Silver Staining

    Stat3β monoclonals specifically detect Stat3β protein in cell protein extracts. Plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were transiently transfected into HEK 293T cells. Extracts (100 µg protein) from mock or plasmid transfected (48 h) cells were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for ( A ) Stat3β using the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 and ( B ) Stat3α (Clone D1A5), total Stat3 (clone 124H6) and GAPDH and visualized by chemiluminiscence. Various dilutions (ranging from 1:300 to 1:10,000) of the three Stat3β monoclonal antibodies 516 G10H9 ( C ), 954 E9E7 ( D ) and 1488 G6G5 ( E ) were used to probe 100 µg protein from 293T cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP and visualized by chemiluminiscence.
    Figure Legend Snippet: Stat3β monoclonals specifically detect Stat3β protein in cell protein extracts. Plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were transiently transfected into HEK 293T cells. Extracts (100 µg protein) from mock or plasmid transfected (48 h) cells were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for ( A ) Stat3β using the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 and ( B ) Stat3α (Clone D1A5), total Stat3 (clone 124H6) and GAPDH and visualized by chemiluminiscence. Various dilutions (ranging from 1:300 to 1:10,000) of the three Stat3β monoclonal antibodies 516 G10H9 ( C ), 954 E9E7 ( D ) and 1488 G6G5 ( E ) were used to probe 100 µg protein from 293T cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP and visualized by chemiluminiscence.

    Techniques Used: Transfection, Plasmid Preparation, SDS Page

    Schematic overview of domains of Stat3α and Stat3β and their derivation by normal splicing of the Stat3 gene or alternative splicing, respectively. Use of an alternative 3' splice acceptor site in exon 23 of the Stat3 gene ( A , middle panel) generates the Stat3β isoform ( A , lower panel) with the loss of 50 nucleotides from the exon and a frame shift, to add 21 nucleotides coding seven unique amino acids followed by a stop codon, within the exon 23 ( A , B lower panels). This leads to a truncated Stat3β in place of the normally intron-spliced Stat3α ( A , B upper panels).
    Figure Legend Snippet: Schematic overview of domains of Stat3α and Stat3β and their derivation by normal splicing of the Stat3 gene or alternative splicing, respectively. Use of an alternative 3' splice acceptor site in exon 23 of the Stat3 gene ( A , middle panel) generates the Stat3β isoform ( A , lower panel) with the loss of 50 nucleotides from the exon and a frame shift, to add 21 nucleotides coding seven unique amino acids followed by a stop codon, within the exon 23 ( A , B lower panels). This leads to a truncated Stat3β in place of the normally intron-spliced Stat3α ( A , B upper panels).

    Techniques Used:

    Stat3β monoclonal antibody can detect endogenous Stat3β in lysates from cell lines expressing various levels of Stat3β. Lysates (100 µg of total protein) from cell lines ACHN, COS7, and H4IIE (lanes 1–3) were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for total Stat3 (clone 124H6), Stat3β (516G10H9), Stat3α (Clone D1A5) and GAPDH and visualized by chemiluminiscence. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 5–7).
    Figure Legend Snippet: Stat3β monoclonal antibody can detect endogenous Stat3β in lysates from cell lines expressing various levels of Stat3β. Lysates (100 µg of total protein) from cell lines ACHN, COS7, and H4IIE (lanes 1–3) were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for total Stat3 (clone 124H6), Stat3β (516G10H9), Stat3α (Clone D1A5) and GAPDH and visualized by chemiluminiscence. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 5–7).

    Techniques Used: Expressing, SDS Page, Transfection

    5) Product Images from "Optimization of the Expression of Reteplase in Escherichia coli TOP10 Using Arabinose Promoter"

    Article Title: Optimization of the Expression of Reteplase in Escherichia coli TOP10 Using Arabinose Promoter

    Journal: Jundishapur Journal of Natural Pharmaceutical Products

    doi:

    Electrophoresis of Extracted pET15b Containing Insert and Digested pBAD/gIIIA by Nco1 on 0.8% Agarose Gel Electrophoresis Lanes 1 and 2, digested pBAD/gIIIA by Nco1 (4145 N); lanes 3 and 4, pET15b containing insert digested by Nco1 (6776 N); lane 5: DNA marker.
    Figure Legend Snippet: Electrophoresis of Extracted pET15b Containing Insert and Digested pBAD/gIIIA by Nco1 on 0.8% Agarose Gel Electrophoresis Lanes 1 and 2, digested pBAD/gIIIA by Nco1 (4145 N); lanes 3 and 4, pET15b containing insert digested by Nco1 (6776 N); lane 5: DNA marker.

    Techniques Used: Electrophoresis, Agarose Gel Electrophoresis, Marker

    Electrophoresis of Extracted Plasmids From E. coli DH5α Using Alkaline Lysis Lanes 1 to 6, extracted pBAD/gIIIA from E. coli DH5α ; lanes 7 to 9, extracted Pet15B from E. coliDH5α .
    Figure Legend Snippet: Electrophoresis of Extracted Plasmids From E. coli DH5α Using Alkaline Lysis Lanes 1 to 6, extracted pBAD/gIIIA from E. coli DH5α ; lanes 7 to 9, extracted Pet15B from E. coliDH5α .

    Techniques Used: Electrophoresis, Alkaline Lysis

    6) Product Images from "Calcium/calmodulin-dependent phosphorylation of tumor protein D52 on serine residue 136 may be mediated by CAMK2?6"

    Article Title: Calcium/calmodulin-dependent phosphorylation of tumor protein D52 on serine residue 136 may be mediated by CAMK2?6

    Journal:

    doi: 10.1152/ajpgi.90345.2008

    Identification of CAMK2δ transcript variant (TV) 2 and TV3, but not TV1, in mouse gastric mucosa. A : an initial screen eliminated TV1. cDNA derived from mouse gastric mucosa was used as a template for RT-PCR-based analyses. Three sets of primers
    Figure Legend Snippet: Identification of CAMK2δ transcript variant (TV) 2 and TV3, but not TV1, in mouse gastric mucosa. A : an initial screen eliminated TV1. cDNA derived from mouse gastric mucosa was used as a template for RT-PCR-based analyses. Three sets of primers

    Techniques Used: Variant Assay, Derivative Assay, Reverse Transcription Polymerase Chain Reaction

    7) Product Images from "Crystal Structure Confirmation of JHP933 as a Nucleotidyltransferase Superfamily Protein from Helicobacter pylori Strain J99"

    Article Title: Crystal Structure Confirmation of JHP933 as a Nucleotidyltransferase Superfamily Protein from Helicobacter pylori Strain J99

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0104609

    Active site conservation and substrate binding of JHP933, LinA and LinB. The C atoms of active site residues are shown in ball-and-stick representation and distinctively colored: lime for JHP933, magenta for LinA (4E8J), and cyan for LinB (3JZ0). The substrate Mg 2+ ions, as cyan spheres, AMPCPP and clindamycin, in yellow, are from LinB complex structure.
    Figure Legend Snippet: Active site conservation and substrate binding of JHP933, LinA and LinB. The C atoms of active site residues are shown in ball-and-stick representation and distinctively colored: lime for JHP933, magenta for LinA (4E8J), and cyan for LinB (3JZ0). The substrate Mg 2+ ions, as cyan spheres, AMPCPP and clindamycin, in yellow, are from LinB complex structure.

    Techniques Used: Binding Assay

    Sequence and secondary structure comparison of JHP933 with structurally related LinA. The secondary structures of JHP93 (top row) are labeled in lime and LinA from S. haemolyticu (bottom row) in magenta. The conserved active site motifs involved in catalysis ([DE]h[DE]h, h[DE]h) and substrate binding (hG) of NTase superfamily are shadowed in gray.
    Figure Legend Snippet: Sequence and secondary structure comparison of JHP933 with structurally related LinA. The secondary structures of JHP93 (top row) are labeled in lime and LinA from S. haemolyticu (bottom row) in magenta. The conserved active site motifs involved in catalysis ([DE]h[DE]h, h[DE]h) and substrate binding (hG) of NTase superfamily are shadowed in gray.

    Techniques Used: Sequencing, Labeling, Binding Assay

    Putative substrate binding site of JHP933. Ribbon diagram and surface representation of JHP933 are colored in lime, the modelled substrate lincomycin of the superimposed LinA/lincomycin complex is shown in ball-and-stick representation and colored in magenta (LinA protein not shown).
    Figure Legend Snippet: Putative substrate binding site of JHP933. Ribbon diagram and surface representation of JHP933 are colored in lime, the modelled substrate lincomycin of the superimposed LinA/lincomycin complex is shown in ball-and-stick representation and colored in magenta (LinA protein not shown).

    Techniques Used: Binding Assay

    Overall structure of JHP933. Ribbon diagram of the JHP933 structure, N-terminal core domain is colored in lime and C-terminal tail domain in cyan. α-helices are labelled with α, β-strands are labelled with β, and 3 10 helices are labelled with η.
    Figure Legend Snippet: Overall structure of JHP933. Ribbon diagram of the JHP933 structure, N-terminal core domain is colored in lime and C-terminal tail domain in cyan. α-helices are labelled with α, β-strands are labelled with β, and 3 10 helices are labelled with η.

    Techniques Used:

    The superposition of JHP933 and LinA/Lincomycin complex (4E8J) structures. Ribbon diagram of JHP933/LinA, with JHP933 is colored in lime and LinA in magenta, and substrate lincomycin of LinA is shown in ball-and-stick representation.
    Figure Legend Snippet: The superposition of JHP933 and LinA/Lincomycin complex (4E8J) structures. Ribbon diagram of JHP933/LinA, with JHP933 is colored in lime and LinA in magenta, and substrate lincomycin of LinA is shown in ball-and-stick representation.

    Techniques Used:

    8) Product Images from "CSN5/JAB1 Interacts with the Centromeric Components CENP-T and CENP-W and Regulates Their Proteasome-mediated Degradation *"

    Article Title: CSN5/JAB1 Interacts with the Centromeric Components CENP-T and CENP-W and Regulates Their Proteasome-mediated Degradation *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M113.469221

    CENP-W is destabilized by CSN5. A, CSN5 may promote CENP-W degradation. To measure the degradation rate of CENP-W, 293T cells were transfected with FLAG-CENP-W together with GST-CSN5 or GST control. Then, cells were harvested at various time points after
    Figure Legend Snippet: CENP-W is destabilized by CSN5. A, CSN5 may promote CENP-W degradation. To measure the degradation rate of CENP-W, 293T cells were transfected with FLAG-CENP-W together with GST-CSN5 or GST control. Then, cells were harvested at various time points after

    Techniques Used: Transfection

    The complex formation between CENP-T and CENP-W increases their stability. A, co-transfection of CENP-W enhanced the CENP-T stability. 293T cells were transfected with FLAG-CENP-T together with an increasing amount of FLAG-CENP-W plasmid, and then, Western
    Figure Legend Snippet: The complex formation between CENP-T and CENP-W increases their stability. A, co-transfection of CENP-W enhanced the CENP-T stability. 293T cells were transfected with FLAG-CENP-T together with an increasing amount of FLAG-CENP-W plasmid, and then, Western

    Techniques Used: Cotransfection, Transfection, Plasmid Preparation, Western Blot

    Effect of CSN5 deregulation in the recruitment of CENP-T·CENP-W to kinetochore during mitotic prophase. A, experimental structure. Cells were transfected with either GST-CSN5 or CSN5 siRNA (100 n m ) for the indicated duration, and then synchronized
    Figure Legend Snippet: Effect of CSN5 deregulation in the recruitment of CENP-T·CENP-W to kinetochore during mitotic prophase. A, experimental structure. Cells were transfected with either GST-CSN5 or CSN5 siRNA (100 n m ) for the indicated duration, and then synchronized

    Techniques Used: Transfection

    CENP-T·CENP-W may co-exist with CSN5 during the last S period. A, cell fractionation experiment. HeLa-CENP-W stable cells were lysed and applied to the linear glycerol gradient (10–40%). Fractions of 0.7 ml were collected from the bottom
    Figure Legend Snippet: CENP-T·CENP-W may co-exist with CSN5 during the last S period. A, cell fractionation experiment. HeLa-CENP-W stable cells were lysed and applied to the linear glycerol gradient (10–40%). Fractions of 0.7 ml were collected from the bottom

    Techniques Used: Cell Fractionation

    CSN5 interacts with CENP-W. A, interaction between CSN5 and CENP-W. After 293T cells were transfected with GST-CSN5 and FLAG-CENP-W, GST pull-down was performed. B, co-immunoprecipitation with an anti-FLAG antibody using the 293T cells expressing GST-CSN5
    Figure Legend Snippet: CSN5 interacts with CENP-W. A, interaction between CSN5 and CENP-W. After 293T cells were transfected with GST-CSN5 and FLAG-CENP-W, GST pull-down was performed. B, co-immunoprecipitation with an anti-FLAG antibody using the 293T cells expressing GST-CSN5

    Techniques Used: Transfection, Immunoprecipitation, Expressing

    9) Product Images from "CSN5/JAB1 Interacts with the Centromeric Components CENP-T and CENP-W and Regulates Their Proteasome-mediated Degradation *"

    Article Title: CSN5/JAB1 Interacts with the Centromeric Components CENP-T and CENP-W and Regulates Their Proteasome-mediated Degradation *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M113.469221

    CSN5 interacts with CENP-T. A , co-immunoprecipitation between CSN5 and CENP-T. After 293T cells were transfected with GST-CSN5 and FLAG-CENP-T (either C-terminal H2A domain region (amino acids 455–546) or full-length), the cell lysates were subjected
    Figure Legend Snippet: CSN5 interacts with CENP-T. A , co-immunoprecipitation between CSN5 and CENP-T. After 293T cells were transfected with GST-CSN5 and FLAG-CENP-T (either C-terminal H2A domain region (amino acids 455–546) or full-length), the cell lysates were subjected

    Techniques Used: Immunoprecipitation, Transfection

    The complex formation between CENP-T and CENP-W increases their stability. A, co-transfection of CENP-W enhanced the CENP-T stability. 293T cells were transfected with FLAG-CENP-T together with an increasing amount of FLAG-CENP-W plasmid, and then, Western
    Figure Legend Snippet: The complex formation between CENP-T and CENP-W increases their stability. A, co-transfection of CENP-W enhanced the CENP-T stability. 293T cells were transfected with FLAG-CENP-T together with an increasing amount of FLAG-CENP-W plasmid, and then, Western

    Techniques Used: Cotransfection, Transfection, Plasmid Preparation, Western Blot

    CSN5 facilitates CENP-T degradation. A, CENP-T degradation was inhibited by MG132. HeLa-FLAG-CENP-T stable cells were preincubated with or without proteasome inhibitor MG132 (20 μ m ), for 4 h, and then cells were harvested at the indicated time
    Figure Legend Snippet: CSN5 facilitates CENP-T degradation. A, CENP-T degradation was inhibited by MG132. HeLa-FLAG-CENP-T stable cells were preincubated with or without proteasome inhibitor MG132 (20 μ m ), for 4 h, and then cells were harvested at the indicated time

    Techniques Used:

    Effect of CSN5 deregulation in the recruitment of CENP-T·CENP-W to kinetochore during mitotic prophase. A, experimental structure. Cells were transfected with either GST-CSN5 or CSN5 siRNA (100 n m ) for the indicated duration, and then synchronized
    Figure Legend Snippet: Effect of CSN5 deregulation in the recruitment of CENP-T·CENP-W to kinetochore during mitotic prophase. A, experimental structure. Cells were transfected with either GST-CSN5 or CSN5 siRNA (100 n m ) for the indicated duration, and then synchronized

    Techniques Used: Transfection

    CENP-T·CENP-W may co-exist with CSN5 during the last S period. A, cell fractionation experiment. HeLa-CENP-W stable cells were lysed and applied to the linear glycerol gradient (10–40%). Fractions of 0.7 ml were collected from the bottom
    Figure Legend Snippet: CENP-T·CENP-W may co-exist with CSN5 during the last S period. A, cell fractionation experiment. HeLa-CENP-W stable cells were lysed and applied to the linear glycerol gradient (10–40%). Fractions of 0.7 ml were collected from the bottom

    Techniques Used: Cell Fractionation

    10) Product Images from "Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer"

    Article Title: Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer

    Journal: Cancers

    doi: 10.3390/cancers6042012

    Stat3β monoclonal antibodies specifically immunoprecipitate Stat3β from protein lysates. Stat3β Mab 516G10H9 (1:30) and Stat3α Ab (D1A5) were added to 200 µg of protein from either untransfected Stat3 −/− murine embryonic fibroblasts (MEFs) or cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP, incubated overnight at 4 °C. The lysates were then incubated with protein G-agarose beads for 30 min at 4 °C and after centrifugation, the beads boiled in loading dye and the eluted proteins subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, upper panel). An equivalent volume of cell lysates (20 µL) used in each reaction were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, lower panel) to indicate the amount of protein input.
    Figure Legend Snippet: Stat3β monoclonal antibodies specifically immunoprecipitate Stat3β from protein lysates. Stat3β Mab 516G10H9 (1:30) and Stat3α Ab (D1A5) were added to 200 µg of protein from either untransfected Stat3 −/− murine embryonic fibroblasts (MEFs) or cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP, incubated overnight at 4 °C. The lysates were then incubated with protein G-agarose beads for 30 min at 4 °C and after centrifugation, the beads boiled in loading dye and the eluted proteins subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, upper panel). An equivalent volume of cell lysates (20 µL) used in each reaction were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, lower panel) to indicate the amount of protein input.

    Techniques Used: Transfection, Incubation, Centrifugation, SDS Page

    Stat3β overexpression correlates with Stat3 phosphorylation in breast cancer cell lines. In panel ( A ), lysates (100 µg protein) from normal breast epithelial cells MCF-12A, and breast cancer cell lines MCF-7, T47D, BT-474, MDA-MB 453, HCC1954, MDA-MB-231, MDA-MB-468, and BT549 cells were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total pStat3 (Tyr-705, clone D3A7), tStat3 (clone 124H6), Stat3α (clone D1A5), Stat3β (1488 G6G5) and GAPDH. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 10–11). Stat3β and GAPDH levels were quantified by densitometry and the GAPDH-normalized pStat3 levels plotted as a function of their corresponding Stat3β levels ( B , Spearman r = 0.7667, p
    Figure Legend Snippet: Stat3β overexpression correlates with Stat3 phosphorylation in breast cancer cell lines. In panel ( A ), lysates (100 µg protein) from normal breast epithelial cells MCF-12A, and breast cancer cell lines MCF-7, T47D, BT-474, MDA-MB 453, HCC1954, MDA-MB-231, MDA-MB-468, and BT549 cells were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total pStat3 (Tyr-705, clone D3A7), tStat3 (clone 124H6), Stat3α (clone D1A5), Stat3β (1488 G6G5) and GAPDH. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 10–11). Stat3β and GAPDH levels were quantified by densitometry and the GAPDH-normalized pStat3 levels plotted as a function of their corresponding Stat3β levels ( B , Spearman r = 0.7667, p

    Techniques Used: Over Expression, Multiple Displacement Amplification, SDS Page, Transfection

    Stat3β monoclonal antibodies are specific for the CT7 epitope found exclusively on Stat3β. Truncated pure Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were purified from bacterial supernatants as described in the Methods section. Decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed ( A ) with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as ( B ) Stat3α (Clone D1A5), two total Stat3 antibodies, one raised against a C-terminal peptide (clone 124H6) and one raised against a N-terminal peptide (aa 149–262, clone STAAD22A) and visualized by chemiluminiscence. Protein in a replica gel was also detected using silver staining and shown at the bottom of panel ( B ). In panel ( C ), decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as total Stat3 antibody (clone 124H6) and visualized by chemiluminiscence.
    Figure Legend Snippet: Stat3β monoclonal antibodies are specific for the CT7 epitope found exclusively on Stat3β. Truncated pure Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were purified from bacterial supernatants as described in the Methods section. Decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed ( A ) with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as ( B ) Stat3α (Clone D1A5), two total Stat3 antibodies, one raised against a C-terminal peptide (clone 124H6) and one raised against a N-terminal peptide (aa 149–262, clone STAAD22A) and visualized by chemiluminiscence. Protein in a replica gel was also detected using silver staining and shown at the bottom of panel ( B ). In panel ( C ), decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as total Stat3 antibody (clone 124H6) and visualized by chemiluminiscence.

    Techniques Used: Purification, SDS Page, Silver Staining

    Stat3β monoclonals specifically detect Stat3β protein in cell protein extracts. Plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were transiently transfected into HEK 293T cells. Extracts (100 µg protein) from mock or plasmid transfected (48 h) cells were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for ( A ) Stat3β using the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 and ( B ) Stat3α (Clone D1A5), total Stat3 (clone 124H6) and GAPDH and visualized by chemiluminiscence. Various dilutions (ranging from 1:300 to 1:10,000) of the three Stat3β monoclonal antibodies 516 G10H9 ( C ), 954 E9E7 ( D ) and 1488 G6G5 ( E ) were used to probe 100 µg protein from 293T cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP and visualized by chemiluminiscence.
    Figure Legend Snippet: Stat3β monoclonals specifically detect Stat3β protein in cell protein extracts. Plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were transiently transfected into HEK 293T cells. Extracts (100 µg protein) from mock or plasmid transfected (48 h) cells were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for ( A ) Stat3β using the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 and ( B ) Stat3α (Clone D1A5), total Stat3 (clone 124H6) and GAPDH and visualized by chemiluminiscence. Various dilutions (ranging from 1:300 to 1:10,000) of the three Stat3β monoclonal antibodies 516 G10H9 ( C ), 954 E9E7 ( D ) and 1488 G6G5 ( E ) were used to probe 100 µg protein from 293T cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP and visualized by chemiluminiscence.

    Techniques Used: Transfection, Plasmid Preparation, SDS Page

    Schematic overview of domains of Stat3α and Stat3β and their derivation by normal splicing of the Stat3 gene or alternative splicing, respectively. Use of an alternative 3' splice acceptor site in exon 23 of the Stat3 gene ( A , middle panel) generates the Stat3β isoform ( A , lower panel) with the loss of 50 nucleotides from the exon and a frame shift, to add 21 nucleotides coding seven unique amino acids followed by a stop codon, within the exon 23 ( A , B lower panels). This leads to a truncated Stat3β in place of the normally intron-spliced Stat3α ( A , B upper panels).
    Figure Legend Snippet: Schematic overview of domains of Stat3α and Stat3β and their derivation by normal splicing of the Stat3 gene or alternative splicing, respectively. Use of an alternative 3' splice acceptor site in exon 23 of the Stat3 gene ( A , middle panel) generates the Stat3β isoform ( A , lower panel) with the loss of 50 nucleotides from the exon and a frame shift, to add 21 nucleotides coding seven unique amino acids followed by a stop codon, within the exon 23 ( A , B lower panels). This leads to a truncated Stat3β in place of the normally intron-spliced Stat3α ( A , B upper panels).

    Techniques Used:

    Stat3β monoclonal antibody can detect endogenous Stat3β in lysates from cell lines expressing various levels of Stat3β. Lysates (100 µg of total protein) from cell lines ACHN, COS7, and H4IIE (lanes 1–3) were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for total Stat3 (clone 124H6), Stat3β (516G10H9), Stat3α (Clone D1A5) and GAPDH and visualized by chemiluminiscence. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 5–7).
    Figure Legend Snippet: Stat3β monoclonal antibody can detect endogenous Stat3β in lysates from cell lines expressing various levels of Stat3β. Lysates (100 µg of total protein) from cell lines ACHN, COS7, and H4IIE (lanes 1–3) were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for total Stat3 (clone 124H6), Stat3β (516G10H9), Stat3α (Clone D1A5) and GAPDH and visualized by chemiluminiscence. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 5–7).

    Techniques Used: Expressing, SDS Page, Transfection

    11) Product Images from "Preliminary structural studies on the leucine-zipper homology region of the human protein Bap31"

    Article Title: Preliminary structural studies on the leucine-zipper homology region of the human protein Bap31

    Journal: Acta Crystallographica Section F: Structural Biology and Crystallization Communications

    doi: 10.1107/S1744309107008925

    Image of a typical crystal of human Bap31 leucine-zipper homology region grown by the sitting-drop method.
    Figure Legend Snippet: Image of a typical crystal of human Bap31 leucine-zipper homology region grown by the sitting-drop method.

    Techniques Used:

    12) Product Images from "A comprehensive protein–protein interactome for yeast PAS kinase 1 reveals direct inhibition of respiration through the phosphorylation of Cbf1"

    Article Title: A comprehensive protein–protein interactome for yeast PAS kinase 1 reveals direct inhibition of respiration through the phosphorylation of Cbf1

    Journal: Molecular Biology of the Cell

    doi: 10.1091/mbc.E13-10-0631

    A Psk1 Y2H construct with increased protein–protein interaction proficiency. (A) A diagram of previously isolated hyperactive truncations of Psk1 ( Grose et al ., 2009 ) that were screened for their ability to bind protein partners in a Y2H screen. (B) The relative Y2H interaction strength of each Psk1 truncation is shown using Pbp1, a Psk1 binding partner identified in this study by both Y2H and copurification approaches. Y2HGold cells (Clontech) containing the Pbp1 prey (pJG1001) were cotransformed with bait plasmids harboring full-length Psk1 (pJG441), truncated Psk1 (ΔN477Psk1 [pJG1005], pΔN692Psk1 [pJG598], pΔN694Psk1 [pJG1006], pΔN931Psk1 [pJG568]) or empty vector (pJG425). Overnights were grown in SD-Leu-Trp for plasmid maintenance, diluted fivefold serially, and plated on Y2H selective media (SD-Leu-Trp-His-Ade + X-α-Gal), as well as a control plate (SD-Leu-Trp). Plates were incubated at 30°C for 3–4 d until colonies were apparent. The Y2H Gold strain contains four reporters under the control of three different Gal4-responsive promoters (Clontech), allowing selection for histidine (His) or adenine (Ade) biosynthesis, as well as blue colony formation on media containing X-α-Gal.
    Figure Legend Snippet: A Psk1 Y2H construct with increased protein–protein interaction proficiency. (A) A diagram of previously isolated hyperactive truncations of Psk1 ( Grose et al ., 2009 ) that were screened for their ability to bind protein partners in a Y2H screen. (B) The relative Y2H interaction strength of each Psk1 truncation is shown using Pbp1, a Psk1 binding partner identified in this study by both Y2H and copurification approaches. Y2HGold cells (Clontech) containing the Pbp1 prey (pJG1001) were cotransformed with bait plasmids harboring full-length Psk1 (pJG441), truncated Psk1 (ΔN477Psk1 [pJG1005], pΔN692Psk1 [pJG598], pΔN694Psk1 [pJG1006], pΔN931Psk1 [pJG568]) or empty vector (pJG425). Overnights were grown in SD-Leu-Trp for plasmid maintenance, diluted fivefold serially, and plated on Y2H selective media (SD-Leu-Trp-His-Ade + X-α-Gal), as well as a control plate (SD-Leu-Trp). Plates were incubated at 30°C for 3–4 d until colonies were apparent. The Y2H Gold strain contains four reporters under the control of three different Gal4-responsive promoters (Clontech), allowing selection for histidine (His) or adenine (Ade) biosynthesis, as well as blue colony formation on media containing X-α-Gal.

    Techniques Used: Construct, Isolation, Binding Assay, Copurification, Plasmid Preparation, Incubation, Selection

    13) Product Images from "Structural Basis of Phosphoinositide Binding to Kindlin-2 Protein Pleckstrin Homology Domain in Regulating Integrin Activation *"

    Article Title: Structural Basis of Phosphoinositide Binding to Kindlin-2 Protein Pleckstrin Homology Domain in Regulating Integrin Activation *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M111.295352

    Structure-based sequence alignment of K2-PH domain with other selective PH domain structures bound to IP4. Residues involved in binding to different phosphate groups are colored differently: yellow , binding to the 1-phosphate group; red , binding to the
    Figure Legend Snippet: Structure-based sequence alignment of K2-PH domain with other selective PH domain structures bound to IP4. Residues involved in binding to different phosphate groups are colored differently: yellow , binding to the 1-phosphate group; red , binding to the

    Techniques Used: Sequencing, Binding Assay

    Chemical shift perturbation profiles of wild type and mutant K2-PH with IP4. Gray bars indicate line-broadening residues. The perturbation profiles were derived from the HSQC spectra of 0.1 m m 1 H- 15 N-labeled wild type and mutant samples in the absence
    Figure Legend Snippet: Chemical shift perturbation profiles of wild type and mutant K2-PH with IP4. Gray bars indicate line-broadening residues. The perturbation profiles were derived from the HSQC spectra of 0.1 m m 1 H- 15 N-labeled wild type and mutant samples in the absence

    Techniques Used: Mutagenesis, Derivative Assay, Labeling

    K2-PH domain has a positively charged IP4 binding pocket. Residues that have potential contacts with IP4 are highlighted and labeled. The phosphate groups on IP4 are also labeled. The dotted line indicates how the phosphate group 1 can be extended to
    Figure Legend Snippet: K2-PH domain has a positively charged IP4 binding pocket. Residues that have potential contacts with IP4 are highlighted and labeled. The phosphate groups on IP4 are also labeled. The dotted line indicates how the phosphate group 1 can be extended to

    Techniques Used: Binding Assay, Labeling

    14) Product Images from "HIV-1 Transmission by Dendritic Cell-specific ICAM-3-grabbing Nonintegrin (DC-SIGN) Is Regulated by Determinants in the Carbohydrate Recognition Domain That Are Absent in Liver/Lymph Node-SIGN (L-SIGN) *"

    Article Title: HIV-1 Transmission by Dendritic Cell-specific ICAM-3-grabbing Nonintegrin (DC-SIGN) Is Regulated by Determinants in the Carbohydrate Recognition Domain That Are Absent in Liver/Lymph Node-SIGN (L-SIGN) *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M109.030619

    K270W mutation and C-terminal DC-SIGN residues enable HIV-1 transmission by L-SIGN. A , schematic diagram of L-SIGN chimeras containing the K270W mutation and C-terminal DC-SIGN CRD segments. CT , cytoplasmic domain; TM , transmembrane domain; ND , neck domain; RD , repeat domain. B, ICAM-3 adhesion to cells expressing L-SIGN chimeras. Adhesion was measured by FACS using a fluorescent bead assay. One representative experiment of two is shown. C, HIV-1 transmission mediated by cells expressing a subset of L-SIGN chimeras. Transmission of R5-tropic ADA and X4-tropic HXB2 Env pseudotyped vectors, using Raji as virus donor cells and Hut/CCR5 as virus target cells, was performed as described. One representative of three is shown.
    Figure Legend Snippet: K270W mutation and C-terminal DC-SIGN residues enable HIV-1 transmission by L-SIGN. A , schematic diagram of L-SIGN chimeras containing the K270W mutation and C-terminal DC-SIGN CRD segments. CT , cytoplasmic domain; TM , transmembrane domain; ND , neck domain; RD , repeat domain. B, ICAM-3 adhesion to cells expressing L-SIGN chimeras. Adhesion was measured by FACS using a fluorescent bead assay. One representative experiment of two is shown. C, HIV-1 transmission mediated by cells expressing a subset of L-SIGN chimeras. Transmission of R5-tropic ADA and X4-tropic HXB2 Env pseudotyped vectors, using Raji as virus donor cells and Hut/CCR5 as virus target cells, was performed as described. One representative of three is shown.

    Techniques Used: Mutagenesis, Transmission Assay, Expressing, FACS, Fluorescent Bead Assay

    15) Product Images from "Calcium/calmodulin-dependent phosphorylation of tumor protein D52 on serine residue 136 may be mediated by CAMK2?6"

    Article Title: Calcium/calmodulin-dependent phosphorylation of tumor protein D52 on serine residue 136 may be mediated by CAMK2?6

    Journal:

    doi: 10.1152/ajpgi.90345.2008

    Western blot analysis of CAMK2δ6 and subcellular localization of CAMK2δ6 and D52 proteins in HEK293 and T84 cells. A : Western blotting demonstrated that the expressed protein product of TV3 (CAMK2δ6/G) has a migration pattern that
    Figure Legend Snippet: Western blot analysis of CAMK2δ6 and subcellular localization of CAMK2δ6 and D52 proteins in HEK293 and T84 cells. A : Western blotting demonstrated that the expressed protein product of TV3 (CAMK2δ6/G) has a migration pattern that

    Techniques Used: Western Blot, Migration

    Time courses for calcium-dependent D52 S 136 phosphorylation in HEK 293 cells and mouse gastric glands. S 136 phosphorylation was quantified by using affinity-purified pS 136 antibody that was produced by injecting rabbits with 2 phosphopeptides: Ac-CNSPTFK(pS)FEEKVEN-amide
    Figure Legend Snippet: Time courses for calcium-dependent D52 S 136 phosphorylation in HEK 293 cells and mouse gastric glands. S 136 phosphorylation was quantified by using affinity-purified pS 136 antibody that was produced by injecting rabbits with 2 phosphopeptides: Ac-CNSPTFK(pS)FEEKVEN-amide

    Techniques Used: Affinity Purification, Produced

    Effects of selected protein kinase inhibitors on carbachol-stimulated D52 S 136 phosphorylation in HEK293 cells expressing HA-tagged D52. S 136 phosphorylation was analyzed as described in . A : cells were incubated with predicted maximal concentrations
    Figure Legend Snippet: Effects of selected protein kinase inhibitors on carbachol-stimulated D52 S 136 phosphorylation in HEK293 cells expressing HA-tagged D52. S 136 phosphorylation was analyzed as described in . A : cells were incubated with predicted maximal concentrations

    Techniques Used: Expressing, Incubation

    Characterization of D52 kinase activity in rabbit gastric mucosal cells and analysis of tryptic digests of the D52 protein after in vivo/in vitro phosphorylation. A : rabbit gastric mucosal cell extracts were fractionated on a Mono Q column then assayed
    Figure Legend Snippet: Characterization of D52 kinase activity in rabbit gastric mucosal cells and analysis of tryptic digests of the D52 protein after in vivo/in vitro phosphorylation. A : rabbit gastric mucosal cell extracts were fractionated on a Mono Q column then assayed

    Techniques Used: Activity Assay, In Vivo, In Vitro

    Comparison of effects of the CAMK2 inhibitor KN93 on S 136 phosphorylation in intact cells and in vitro. A : in vitro analyses. D52 kinase was partially purified from HEK293 cells by fractionation on a Mono Q column. Peak activity fractions were identified,
    Figure Legend Snippet: Comparison of effects of the CAMK2 inhibitor KN93 on S 136 phosphorylation in intact cells and in vitro. A : in vitro analyses. D52 kinase was partially purified from HEK293 cells by fractionation on a Mono Q column. Peak activity fractions were identified,

    Techniques Used: In Vitro, Purification, Fractionation, Activity Assay

    Effects of site-directed mutagenesis of S136 on calcium-dependent D52 phosphorylation.
    Figure Legend Snippet: Effects of site-directed mutagenesis of S136 on calcium-dependent D52 phosphorylation.

    Techniques Used: Mutagenesis

    Immunolocalization of D52 in intestine, stomach, kidney, and brain. Tissues were fixed, permeabilized, and stained as described in methods . After overnight incubation with monoclonal D52 antibody (3C10, 1:50 dilution), D52 was immunolocalized with donkey
    Figure Legend Snippet: Immunolocalization of D52 in intestine, stomach, kidney, and brain. Tissues were fixed, permeabilized, and stained as described in methods . After overnight incubation with monoclonal D52 antibody (3C10, 1:50 dilution), D52 was immunolocalized with donkey

    Techniques Used: Staining, Incubation

    Characterization of D52 kinase in mouse gastric glands. A : D52 kinase activity profile in mouse gastric gland extracts after fractionation on a Mono Q column. Cells were extracted and D52 kinase activity was assayed as described in . Inset shows
    Figure Legend Snippet: Characterization of D52 kinase in mouse gastric glands. A : D52 kinase activity profile in mouse gastric gland extracts after fractionation on a Mono Q column. Cells were extracted and D52 kinase activity was assayed as described in . Inset shows

    Techniques Used: Activity Assay, Fractionation

    Isolation of phosphorylated D52 from rabbit gastric mucosal cells and mass spectrometry (MS) analyses. A , inset , top : regions of preparative 2D gels stained with modified Coomassie blue showing D52 migration patterns in extracts from control (Con) and
    Figure Legend Snippet: Isolation of phosphorylated D52 from rabbit gastric mucosal cells and mass spectrometry (MS) analyses. A , inset , top : regions of preparative 2D gels stained with modified Coomassie blue showing D52 migration patterns in extracts from control (Con) and

    Techniques Used: Isolation, Mass Spectrometry, Staining, Modification, Migration

    Comparison of effects of carbachol (Carb) and ionomycin on 32 P incorporation into T84 cells expressing either hemagglutinin (HA)-tagged D52 or HA-tagged D52 in which S 136 was mutated to alanine. Mutations were introduced by use of pcDNA 3.1 plasmids containing
    Figure Legend Snippet: Comparison of effects of carbachol (Carb) and ionomycin on 32 P incorporation into T84 cells expressing either hemagglutinin (HA)-tagged D52 or HA-tagged D52 in which S 136 was mutated to alanine. Mutations were introduced by use of pcDNA 3.1 plasmids containing

    Techniques Used: Expressing

    Characterization of D52 kinase in HEK293 cells. A : D52 kinase activity profile obtained after fractionation of HEK293 cell extract (100,000 g supernatant) on a Mono Q anion exchange column. Kinase activity in column fractions was analyzed by incubation
    Figure Legend Snippet: Characterization of D52 kinase in HEK293 cells. A : D52 kinase activity profile obtained after fractionation of HEK293 cell extract (100,000 g supernatant) on a Mono Q anion exchange column. Kinase activity in column fractions was analyzed by incubation

    Techniques Used: Activity Assay, Fractionation, Incubation

    16) Product Images from "Sublingual Immunization with M2-Based Vaccine Induces Broad Protective Immunity against Influenza"

    Article Title: Sublingual Immunization with M2-Based Vaccine Induces Broad Protective Immunity against Influenza

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027953

    3M2eC-specific Ab levels in secretions and lung tissues. Mice were immunized with 10 ug of 3M2eC protein plus 2 ug of CT via i.n. or s.l., or with 10 ug of 3M2eC protein plus alum via i.d. or i.m. on day 0, 14, and 28. Saliva, nasal wash and BAL were collected two weeks after last immunization. M2e-specific IgA in the secretions (A) and M2e-specific IgG in BAL (B) were determined by ELISA using 3M2eC protein. (C) Number of M2e-specific IgG or IgA Ab secreting cells in the lung tissue at day 7 after last immunization was determined by ELISPOT using 3M2eC protein. N.D., not detected. The dashed line shows the limit of detection. The results are expressed as the means+S.D. for the group (n = 5). The data are representative of three independent experiments.
    Figure Legend Snippet: 3M2eC-specific Ab levels in secretions and lung tissues. Mice were immunized with 10 ug of 3M2eC protein plus 2 ug of CT via i.n. or s.l., or with 10 ug of 3M2eC protein plus alum via i.d. or i.m. on day 0, 14, and 28. Saliva, nasal wash and BAL were collected two weeks after last immunization. M2e-specific IgA in the secretions (A) and M2e-specific IgG in BAL (B) were determined by ELISA using 3M2eC protein. (C) Number of M2e-specific IgG or IgA Ab secreting cells in the lung tissue at day 7 after last immunization was determined by ELISPOT using 3M2eC protein. N.D., not detected. The dashed line shows the limit of detection. The results are expressed as the means+S.D. for the group (n = 5). The data are representative of three independent experiments.

    Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay, Enzyme-linked Immunospot

    Construction of plasmids and purification of M2 proteins. (A) The synthetic M2eC or 3M2eC genes without hydrophobic region (amino acids 26–55) from PR8 virus were cloned into pET15b vector (B). The recombinant proteins expressed in E. coli were purified by His-tag affinity chromatography and detected by Western blot using M2e-specific monoclonal Ab, 14C2.
    Figure Legend Snippet: Construction of plasmids and purification of M2 proteins. (A) The synthetic M2eC or 3M2eC genes without hydrophobic region (amino acids 26–55) from PR8 virus were cloned into pET15b vector (B). The recombinant proteins expressed in E. coli were purified by His-tag affinity chromatography and detected by Western blot using M2e-specific monoclonal Ab, 14C2.

    Techniques Used: Purification, Clone Assay, Plasmid Preparation, Recombinant, Affinity Chromatography, Western Blot

    Immunogenicity of 3M2eC (A B): BALB/c mice were immunized i.n. with 10 ug of M2eC, 3M2eC, or 3M2eC plus 2 ug of CT on day 0 and 14. Mice received PBS serve as control group. Sera and saliva were collected on day 14 after last immunization. Levels of M2e-specific IgG in sera (A) and IgA in saliva (B) were determined by ELISA. Ab levels induced by different immunization methods (C D): BALB/c mice were administered on day 0 and 14 with 10 ug of 3M2eC protein plus 2 ug of CT for i.n. and s.l. immunizations or plus alum i.d. or i.m. immunizations. Sera were collected on day 14 after the last immunization. Ab and analyzed for M2eC-specific IgG subclasses by ELISA using 3M2eC protein (C) and M2e-specific IgG Ab by ELISA using M2e-expressing Hela cells (D). N.D., not detected. The dashed line shows the limit of detection. The results are expressed as the means+S.D. for the group (n = 5). The data are representative of three independent experiments. Significant differences were expressed as *, P
    Figure Legend Snippet: Immunogenicity of 3M2eC (A B): BALB/c mice were immunized i.n. with 10 ug of M2eC, 3M2eC, or 3M2eC plus 2 ug of CT on day 0 and 14. Mice received PBS serve as control group. Sera and saliva were collected on day 14 after last immunization. Levels of M2e-specific IgG in sera (A) and IgA in saliva (B) were determined by ELISA. Ab levels induced by different immunization methods (C D): BALB/c mice were administered on day 0 and 14 with 10 ug of 3M2eC protein plus 2 ug of CT for i.n. and s.l. immunizations or plus alum i.d. or i.m. immunizations. Sera were collected on day 14 after the last immunization. Ab and analyzed for M2eC-specific IgG subclasses by ELISA using 3M2eC protein (C) and M2e-specific IgG Ab by ELISA using M2e-expressing Hela cells (D). N.D., not detected. The dashed line shows the limit of detection. The results are expressed as the means+S.D. for the group (n = 5). The data are representative of three independent experiments. Significant differences were expressed as *, P

    Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay, Expressing

    Protection against the 2009 pandemic influenza A virus (H1N1). Mice were immunized i.n. or s.l. with 3M2eC (10 ug) plus CT (2 ug) on days 0 and 14 and challenged by i.n. administration of A/CA/04/09 (H1N1) 5 weeks after the last immunization. (A) Virus titers in the lung tissue at day 5 after challenge were determined in embryonated chicken eggs. (B) Body weight was monitored daily after the viral challenge. The results are expressed as the means+S.D. for the group. Significant differences were expressed as *, P
    Figure Legend Snippet: Protection against the 2009 pandemic influenza A virus (H1N1). Mice were immunized i.n. or s.l. with 3M2eC (10 ug) plus CT (2 ug) on days 0 and 14 and challenged by i.n. administration of A/CA/04/09 (H1N1) 5 weeks after the last immunization. (A) Virus titers in the lung tissue at day 5 after challenge were determined in embryonated chicken eggs. (B) Body weight was monitored daily after the viral challenge. The results are expressed as the means+S.D. for the group. Significant differences were expressed as *, P

    Techniques Used: Mouse Assay

    Cross-protection against infections with different influenza virus subtypes. Six-week-old female BALB/c mice (n = 6) were immunized twice with 10 ug of 3M2eC protein plus 2 ug of CT at 2 week intervals via i.n. or s.l., or with 10 ug of 3M2eC protein plus alum by i.d. or i.m.. They were challenged i.n. with 10 LD 50 of mouse adapted PR8 strain (H1N1) at 3 weeks (A and B), A/Aquatic Bird/Korea/W81/05 virus (H5N2) at 3 weeks (C and D) or A/Philippine/2/82 (H3N2) virus at 5 weeks (E and F) after the last immunization. Survival rate and the body weight loss were monitored daily after the challenge. The results are expressed as the means+S.D. for the group.
    Figure Legend Snippet: Cross-protection against infections with different influenza virus subtypes. Six-week-old female BALB/c mice (n = 6) were immunized twice with 10 ug of 3M2eC protein plus 2 ug of CT at 2 week intervals via i.n. or s.l., or with 10 ug of 3M2eC protein plus alum by i.d. or i.m.. They were challenged i.n. with 10 LD 50 of mouse adapted PR8 strain (H1N1) at 3 weeks (A and B), A/Aquatic Bird/Korea/W81/05 virus (H5N2) at 3 weeks (C and D) or A/Philippine/2/82 (H3N2) virus at 5 weeks (E and F) after the last immunization. Survival rate and the body weight loss were monitored daily after the challenge. The results are expressed as the means+S.D. for the group.

    Techniques Used: Mouse Assay

    17) Product Images from "Structural Analysis of Human Cofilin 2/Filamentous Actin Assemblies: Atomic-Resolution Insights from Magic Angle Spinning NMR Spectroscopy"

    Article Title: Structural Analysis of Human Cofilin 2/Filamentous Actin Assemblies: Atomic-Resolution Insights from Magic Angle Spinning NMR Spectroscopy

    Journal: Scientific Reports

    doi: 10.1038/srep44506

    Primary sequences of cofilin/ADF family: human cofilin 2, chick cofilin 2 (PDB 1TVJ), human cofilin 1 (PDB 1Q8G), yeast cofilin (PDB 1COF) and C.elegans actin depolymerizing factor (ADF) (PDB 2MP4). Secondary structure elements are shown above (H denotes α-helices, B – β-strands). Residues previously determined uniquely by solution NMR experiments 12 and cryo-EM studies 13 to be involved in G-actin binding are shown on CFL1 sequence in green and blue, respectively. Residues reported to be involved in G-actin binding in both studies are shown in gray. Residues previously determined by cryo-EM experiments 13 to be involved in the F-actin binding are shown in red. Interface residues determined by dREDOR-based methods are colored in purple on CFL2 sequence. On the primary sequence chemical shift perturbations greater than 2 ppm are indicated by blue asterisk and chemical shift perturbations greater than 4 ppm are indicated by a red asterisk.
    Figure Legend Snippet: Primary sequences of cofilin/ADF family: human cofilin 2, chick cofilin 2 (PDB 1TVJ), human cofilin 1 (PDB 1Q8G), yeast cofilin (PDB 1COF) and C.elegans actin depolymerizing factor (ADF) (PDB 2MP4). Secondary structure elements are shown above (H denotes α-helices, B – β-strands). Residues previously determined uniquely by solution NMR experiments 12 and cryo-EM studies 13 to be involved in G-actin binding are shown on CFL1 sequence in green and blue, respectively. Residues reported to be involved in G-actin binding in both studies are shown in gray. Residues previously determined by cryo-EM experiments 13 to be involved in the F-actin binding are shown in red. Interface residues determined by dREDOR-based methods are colored in purple on CFL2 sequence. On the primary sequence chemical shift perturbations greater than 2 ppm are indicated by blue asterisk and chemical shift perturbations greater than 4 ppm are indicated by a red asterisk.

    Techniques Used: Nuclear Magnetic Resonance, Binding Assay, Sequencing

    ( a ) Structure of F-actin (cyan) decorated with CFL2 (gray) determined by cryo-EM (PDB 3J0S) 13 . Two adjacent protomers of actin are shown as cartoons. ( b ) CFL2 interface residues S3, G4, V6, I12, K19, V20, R21, T25, I29, V36, L40, S41, T63, T69, T91, E93, S94, K95, K96, L99, V100, A105, A109, M115, I116, A123, I124, K127, T129, V137, T148, L153, V158, V159, L161 and G163 obtained from dREDOR-CORD MAS NMR experiments of CFL2/F-actin are shown in blue. Subdomains of actin protomers ( “n” and “n + 2” ) are colored in teal (SD1 n , SD1 n+2 ), green (SD2), and cyan (SD3, SD4). DNase binding loop (orange), N- and C-termini (yellow) are indicated on the actin structure. ( c ) Zoomed in region of ( b ) of CFL2 interfaces residues obtained from dREDOR-CORD MAS NMR experiments of CFL2/F-actin are shown in blue. ( d ) Chemical shift perturbations, 2–4 ppm (yellow) and above 4 ppm (red), between CFL2/F-actin and free CFL2 mapped onto cofilin structure. ( e ) Interface residues determined from cryo-EM studies mapped onto cofilin structure 13 . Residues M1-V5, K19-R21, S94-D98, K112-S119 and G154-V158 are shown in orange.
    Figure Legend Snippet: ( a ) Structure of F-actin (cyan) decorated with CFL2 (gray) determined by cryo-EM (PDB 3J0S) 13 . Two adjacent protomers of actin are shown as cartoons. ( b ) CFL2 interface residues S3, G4, V6, I12, K19, V20, R21, T25, I29, V36, L40, S41, T63, T69, T91, E93, S94, K95, K96, L99, V100, A105, A109, M115, I116, A123, I124, K127, T129, V137, T148, L153, V158, V159, L161 and G163 obtained from dREDOR-CORD MAS NMR experiments of CFL2/F-actin are shown in blue. Subdomains of actin protomers ( “n” and “n + 2” ) are colored in teal (SD1 n , SD1 n+2 ), green (SD2), and cyan (SD3, SD4). DNase binding loop (orange), N- and C-termini (yellow) are indicated on the actin structure. ( c ) Zoomed in region of ( b ) of CFL2 interfaces residues obtained from dREDOR-CORD MAS NMR experiments of CFL2/F-actin are shown in blue. ( d ) Chemical shift perturbations, 2–4 ppm (yellow) and above 4 ppm (red), between CFL2/F-actin and free CFL2 mapped onto cofilin structure. ( e ) Interface residues determined from cryo-EM studies mapped onto cofilin structure 13 . Residues M1-V5, K19-R21, S94-D98, K112-S119 and G154-V158 are shown in orange.

    Techniques Used: Nuclear Magnetic Resonance, Binding Assay

    18) Product Images from "Functional convergence of structurally distinct thioesterases from cyanobacteria and plants involved in phylloquinone biosynthesis"

    Article Title: Functional convergence of structurally distinct thioesterases from cyanobacteria and plants involved in phylloquinone biosynthesis

    Journal: Acta Crystallographica Section D: Biological Crystallography

    doi: 10.1107/S0907444913015771

    Orientation of the modeled DHNA-CoA in Slr0204 and AtDHNAT1. The DHNA-CoA thioesterase dimers are shown with modeled DHNA-CoA. In both proteins, the labile thioester bond is indicated by a black circle. Both Slr0204 ( a ) (blue and orange) and AtDHNAT1
    Figure Legend Snippet: Orientation of the modeled DHNA-CoA in Slr0204 and AtDHNAT1. The DHNA-CoA thioesterase dimers are shown with modeled DHNA-CoA. In both proteins, the labile thioester bond is indicated by a black circle. Both Slr0204 ( a ) (blue and orange) and AtDHNAT1

    Techniques Used:

    Slr0204 and AtDHNAT1 form distinct tetramers. In ( a ), the Slr0204 tetramer is shown with the orange/blue dimer oriented such that the hotdog α-helices point out of the plane of the page (marked by an asterisk). Slr0204 tetramerizes in the ‘facial’
    Figure Legend Snippet: Slr0204 and AtDHNAT1 form distinct tetramers. In ( a ), the Slr0204 tetramer is shown with the orange/blue dimer oriented such that the hotdog α-helices point out of the plane of the page (marked by an asterisk). Slr0204 tetramerizes in the ‘facial’

    Techniques Used: Polyacrylamide Gel Electrophoresis

    The active-site region of AtDHNAT1. ( a ) shows 2 mF o − DF c electron density contoured at 1.0σ (blue) in a region near the predicted DHNA-CoA binding site. A prominent feature in mF o − DF c difference electron density contoured
    Figure Legend Snippet: The active-site region of AtDHNAT1. ( a ) shows 2 mF o − DF c electron density contoured at 1.0σ (blue) in a region near the predicted DHNA-CoA binding site. A prominent feature in mF o − DF c difference electron density contoured

    Techniques Used: Binding Assay

    Slr0204 and AtDHNAT1 are structurally similar to the Pseudomonas and Arthrobacter 4-HBTs. The tetramers of Slr0204 (blue) and Pseudomonas ) are superimposed in ( a ), showing the overall conservation of the facial tetramerization
    Figure Legend Snippet: Slr0204 and AtDHNAT1 are structurally similar to the Pseudomonas and Arthrobacter 4-HBTs. The tetramers of Slr0204 (blue) and Pseudomonas ) are superimposed in ( a ), showing the overall conservation of the facial tetramerization

    Techniques Used:

    Structural comparison of the cyanobacterial and plant DHNA-CoA thioesterase monomers and dimers. In ( a ), ribbon diagrams for the cyanobacterial thioesterase Slr0204 and the plant thioesterase AtDHNAT1 are shown with sequentially numbered strands and lettered
    Figure Legend Snippet: Structural comparison of the cyanobacterial and plant DHNA-CoA thioesterase monomers and dimers. In ( a ), ribbon diagrams for the cyanobacterial thioesterase Slr0204 and the plant thioesterase AtDHNAT1 are shown with sequentially numbered strands and lettered

    Techniques Used:

    DHNA-CoA mediates dimer–dimer contacts in AtDHNAT1 but not in Slr0204. ( a ) shows that the Slr0204 facial tetramer directs the CoA portion of bound DHNA-CoA away from tetramerization interface, while in ( b ) the back-to-back AtDHNAT1 tetramer places
    Figure Legend Snippet: DHNA-CoA mediates dimer–dimer contacts in AtDHNAT1 but not in Slr0204. ( a ) shows that the Slr0204 facial tetramer directs the CoA portion of bound DHNA-CoA away from tetramerization interface, while in ( b ) the back-to-back AtDHNAT1 tetramer places

    Techniques Used:

    19) Product Images from "Conservation of Structure and Immune Antagonist Functions of Filoviral VP35 Homologs Present in Microbat Genomes"

    Article Title: Conservation of Structure and Immune Antagonist Functions of Filoviral VP35 Homologs Present in Microbat Genomes

    Journal: Cell reports

    doi: 10.1016/j.celrep.2018.06.045

    batVP35 Does Not Interfere in EBOV or MARV.
    Figure Legend Snippet: batVP35 Does Not Interfere in EBOV or MARV.

    Techniques Used:

    batVP35 Inhibits IFN-β Production Independently of dsRNA Binding.
    Figure Legend Snippet: batVP35 Inhibits IFN-β Production Independently of dsRNA Binding.

    Techniques Used: Binding Assay

    Inhibitory Activity of batVP35 Requires Full-Length Protein.
    Figure Legend Snippet: Inhibitory Activity of batVP35 Requires Full-Length Protein.

    Techniques Used: Activity Assay

    batVP35 Does Not Inhibit PKR Phosphorylation or miRNA.
    Figure Legend Snippet: batVP35 Does Not Inhibit PKR Phosphorylation or miRNA.

    Techniques Used:

    Conservation of Structure between batVP35 and eVP35 (A and B) batVP35 forms a tetramer.
    Figure Legend Snippet: Conservation of Structure between batVP35 and eVP35 (A and B) batVP35 forms a tetramer.

    Techniques Used:

    20) Product Images from "INVOLVEMENT OF ENDOPLASMIC RETICULUM STRESS IN A NOVEL CLASSIC GALACTOSEMIA MODEL"

    Article Title: INVOLVEMENT OF ENDOPLASMIC RETICULUM STRESS IN A NOVEL CLASSIC GALACTOSEMIA MODEL

    Journal: Molecular genetics and metabolism

    doi: 10.1016/j.ymgme.2007.06.005

    Competitive inhibition of hIMPase1 by excess gal-1-p A. Purification of recombinant human IMPase1. Lanes on SDS-PAGE are as follows: M : molecular weight markers; U : un-induced bacteria crude extract; I: Induced bacteria crude extract; E : Ni 2+ -NTA eluate (induced). B. Lineweaver-Burke plot shows the variation of reaction rates of hIMPase in the presence (solid squares) and absence (clear triangles) of 50 molar excess of gal-1- p. Each data point represents the mean of three separate experiments.
    Figure Legend Snippet: Competitive inhibition of hIMPase1 by excess gal-1-p A. Purification of recombinant human IMPase1. Lanes on SDS-PAGE are as follows: M : molecular weight markers; U : un-induced bacteria crude extract; I: Induced bacteria crude extract; E : Ni 2+ -NTA eluate (induced). B. Lineweaver-Burke plot shows the variation of reaction rates of hIMPase in the presence (solid squares) and absence (clear triangles) of 50 molar excess of gal-1- p. Each data point represents the mean of three separate experiments.

    Techniques Used: Inhibition, Purification, Recombinant, SDS Page, Molecular Weight

    21) Product Images from "Protein interaction mapping identifies RBBP6 as a negative regulator of Ebola virus replication"

    Article Title: Protein interaction mapping identifies RBBP6 as a negative regulator of Ebola virus replication

    Journal: Cell

    doi: 10.1016/j.cell.2018.08.044

    Interaction between EBOV VP30 and human RBBP6. (A) . (B) Flag-VP30 from Zaire ebolavirus (EBOV), Reston virus (RESTV), Lloviu virus (LLOV) and Marburg virus (MARV) co-immunoprecipitate with HA-RBBP6. (C) A schematic representation of domain organization of RBBP6 isoform 1 and 3 (top). RBBP6 functional domains consists of domain with no name (DWNN), zinc knuckle, ring finger domain, proline and arginine-serine rich domains followed by retinoblastoma (Rb) and p53 binding domains. Bottom panel depicts co-immunoprecipitation of flag-tagged VP30 with transiently expressed HA-RBBP6 isoform 1 or 3. HEK293T cells were transfected with HA-RBBP6 alone or in combination with flag-VP30, as indicated followed by IP with anti-HA. (D) Schematic drawing of RBBP6 truncation mutants used in domain mapping studies (top). Anti-HA IP was performed after co-expression of HA-tagged full-length RBBP6 or different truncations in combination with empty vector or flag-VP30. (E) Immunoprecipitation with anti-HA in cell lysates expressing HA-RBBP6 and flag-tagged RNA binding mutants of VP30. 3RA: R26A/R28A/R40A.
    Figure Legend Snippet: Interaction between EBOV VP30 and human RBBP6. (A) . (B) Flag-VP30 from Zaire ebolavirus (EBOV), Reston virus (RESTV), Lloviu virus (LLOV) and Marburg virus (MARV) co-immunoprecipitate with HA-RBBP6. (C) A schematic representation of domain organization of RBBP6 isoform 1 and 3 (top). RBBP6 functional domains consists of domain with no name (DWNN), zinc knuckle, ring finger domain, proline and arginine-serine rich domains followed by retinoblastoma (Rb) and p53 binding domains. Bottom panel depicts co-immunoprecipitation of flag-tagged VP30 with transiently expressed HA-RBBP6 isoform 1 or 3. HEK293T cells were transfected with HA-RBBP6 alone or in combination with flag-VP30, as indicated followed by IP with anti-HA. (D) Schematic drawing of RBBP6 truncation mutants used in domain mapping studies (top). Anti-HA IP was performed after co-expression of HA-tagged full-length RBBP6 or different truncations in combination with empty vector or flag-VP30. (E) Immunoprecipitation with anti-HA in cell lysates expressing HA-RBBP6 and flag-tagged RNA binding mutants of VP30. 3RA: R26A/R28A/R40A.

    Techniques Used: Functional Assay, Binding Assay, Immunoprecipitation, Transfection, Expressing, Plasmid Preparation, RNA Binding Assay

    22) Product Images from "Protein interaction mapping identifies RBBP6 as a negative regulator of Ebola virus replication"

    Article Title: Protein interaction mapping identifies RBBP6 as a negative regulator of Ebola virus replication

    Journal: Cell

    doi: 10.1016/j.cell.2018.08.044

    Interaction between EBOV VP30 and human RBBP6. (A) . (B) Flag-VP30 from Zaire ebolavirus (EBOV), Reston virus (RESTV), Lloviu virus (LLOV) and Marburg virus (MARV) co-immunoprecipitate with HA-RBBP6. (C) A schematic representation of domain organization of RBBP6 isoform 1 and 3 (top). RBBP6 functional domains consists of domain with no name (DWNN), zinc knuckle, ring finger domain, proline and arginine-serine rich domains followed by retinoblastoma (Rb) and p53 binding domains. Bottom panel depicts co-immunoprecipitation of flag-tagged VP30 with transiently expressed HA-RBBP6 isoform 1 or 3. HEK293T cells were transfected with HA-RBBP6 alone or in combination with flag-VP30, as indicated followed by IP with anti-HA. (D) Schematic drawing of RBBP6 truncation mutants used in domain mapping studies (top). Anti-HA IP was performed after co-expression of HA-tagged full-length RBBP6 or different truncations in combination with empty vector or flag-VP30. (E) Immunoprecipitation with anti-HA in cell lysates expressing HA-RBBP6 and flag-tagged RNA binding mutants of VP30. 3RA: R26A/R28A/R40A.
    Figure Legend Snippet: Interaction between EBOV VP30 and human RBBP6. (A) . (B) Flag-VP30 from Zaire ebolavirus (EBOV), Reston virus (RESTV), Lloviu virus (LLOV) and Marburg virus (MARV) co-immunoprecipitate with HA-RBBP6. (C) A schematic representation of domain organization of RBBP6 isoform 1 and 3 (top). RBBP6 functional domains consists of domain with no name (DWNN), zinc knuckle, ring finger domain, proline and arginine-serine rich domains followed by retinoblastoma (Rb) and p53 binding domains. Bottom panel depicts co-immunoprecipitation of flag-tagged VP30 with transiently expressed HA-RBBP6 isoform 1 or 3. HEK293T cells were transfected with HA-RBBP6 alone or in combination with flag-VP30, as indicated followed by IP with anti-HA. (D) Schematic drawing of RBBP6 truncation mutants used in domain mapping studies (top). Anti-HA IP was performed after co-expression of HA-tagged full-length RBBP6 or different truncations in combination with empty vector or flag-VP30. (E) Immunoprecipitation with anti-HA in cell lysates expressing HA-RBBP6 and flag-tagged RNA binding mutants of VP30. 3RA: R26A/R28A/R40A.

    Techniques Used: Functional Assay, Binding Assay, Immunoprecipitation, Transfection, Expressing, Plasmid Preparation, RNA Binding Assay

    23) Product Images from "A comprehensive protein–protein interactome for yeast PAS kinase 1 reveals direct inhibition of respiration through the phosphorylation of Cbf1"

    Article Title: A comprehensive protein–protein interactome for yeast PAS kinase 1 reveals direct inhibition of respiration through the phosphorylation of Cbf1

    Journal: Molecular Biology of the Cell

    doi: 10.1091/mbc.E13-10-0631

    A Psk1 Y2H construct with increased protein–protein interaction proficiency. (A) A diagram of previously isolated hyperactive truncations of Psk1 ( Grose et al ., 2009 ) that were screened for their ability to bind protein partners in a Y2H screen. (B) The relative Y2H interaction strength of each Psk1 truncation is shown using Pbp1, a Psk1 binding partner identified in this study by both Y2H and copurification approaches. Y2HGold cells (Clontech) containing the Pbp1 prey (pJG1001) were cotransformed with bait plasmids harboring full-length Psk1 (pJG441), truncated Psk1 (ΔN477Psk1 [pJG1005], pΔN692Psk1 [pJG598], pΔN694Psk1 [pJG1006], pΔN931Psk1 [pJG568]) or empty vector (pJG425). Overnights were grown in SD-Leu-Trp for plasmid maintenance, diluted fivefold serially, and plated on Y2H selective media (SD-Leu-Trp-His-Ade + X-α-Gal), as well as a control plate (SD-Leu-Trp). Plates were incubated at 30°C for 3–4 d until colonies were apparent. The Y2H Gold strain contains four reporters under the control of three different Gal4-responsive promoters (Clontech), allowing selection for histidine (His) or adenine (Ade) biosynthesis, as well as blue colony formation on media containing X-α-Gal.
    Figure Legend Snippet: A Psk1 Y2H construct with increased protein–protein interaction proficiency. (A) A diagram of previously isolated hyperactive truncations of Psk1 ( Grose et al ., 2009 ) that were screened for their ability to bind protein partners in a Y2H screen. (B) The relative Y2H interaction strength of each Psk1 truncation is shown using Pbp1, a Psk1 binding partner identified in this study by both Y2H and copurification approaches. Y2HGold cells (Clontech) containing the Pbp1 prey (pJG1001) were cotransformed with bait plasmids harboring full-length Psk1 (pJG441), truncated Psk1 (ΔN477Psk1 [pJG1005], pΔN692Psk1 [pJG598], pΔN694Psk1 [pJG1006], pΔN931Psk1 [pJG568]) or empty vector (pJG425). Overnights were grown in SD-Leu-Trp for plasmid maintenance, diluted fivefold serially, and plated on Y2H selective media (SD-Leu-Trp-His-Ade + X-α-Gal), as well as a control plate (SD-Leu-Trp). Plates were incubated at 30°C for 3–4 d until colonies were apparent. The Y2H Gold strain contains four reporters under the control of three different Gal4-responsive promoters (Clontech), allowing selection for histidine (His) or adenine (Ade) biosynthesis, as well as blue colony formation on media containing X-α-Gal.

    Techniques Used: Construct, Isolation, Binding Assay, Copurification, Plasmid Preparation, Incubation, Selection

    24) Product Images from "Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer"

    Article Title: Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer

    Journal: Cancers

    doi: 10.3390/cancers6042012

    Stat3β monoclonal antibodies specifically immunoprecipitate Stat3β from protein lysates. Stat3β Mab 516G10H9 (1:30) and Stat3α Ab (D1A5) were added to 200 µg of protein from either untransfected Stat3 −/− murine embryonic fibroblasts (MEFs) or cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP, incubated overnight at 4 °C. The lysates were then incubated with protein G-agarose beads for 30 min at 4 °C and after centrifugation, the beads boiled in loading dye and the eluted proteins subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, upper panel). An equivalent volume of cell lysates (20 µL) used in each reaction were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, lower panel) to indicate the amount of protein input.
    Figure Legend Snippet: Stat3β monoclonal antibodies specifically immunoprecipitate Stat3β from protein lysates. Stat3β Mab 516G10H9 (1:30) and Stat3α Ab (D1A5) were added to 200 µg of protein from either untransfected Stat3 −/− murine embryonic fibroblasts (MEFs) or cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP, incubated overnight at 4 °C. The lysates were then incubated with protein G-agarose beads for 30 min at 4 °C and after centrifugation, the beads boiled in loading dye and the eluted proteins subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, upper panel). An equivalent volume of cell lysates (20 µL) used in each reaction were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, lower panel) to indicate the amount of protein input.

    Techniques Used: Transfection, Incubation, Centrifugation, SDS Page

    Stat3β overexpression correlates with Stat3 phosphorylation in breast cancer cell lines. In panel ( A ), lysates (100 µg protein) from normal breast epithelial cells MCF-12A, and breast cancer cell lines MCF-7, T47D, BT-474, MDA-MB 453, HCC1954, MDA-MB-231, MDA-MB-468, and BT549 cells were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total pStat3 (Tyr-705, clone D3A7), tStat3 (clone 124H6), Stat3α (clone D1A5), Stat3β (1488 G6G5) and GAPDH. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 10–11). Stat3β and GAPDH levels were quantified by densitometry and the GAPDH-normalized pStat3 levels plotted as a function of their corresponding Stat3β levels ( B , Spearman r = 0.7667, p
    Figure Legend Snippet: Stat3β overexpression correlates with Stat3 phosphorylation in breast cancer cell lines. In panel ( A ), lysates (100 µg protein) from normal breast epithelial cells MCF-12A, and breast cancer cell lines MCF-7, T47D, BT-474, MDA-MB 453, HCC1954, MDA-MB-231, MDA-MB-468, and BT549 cells were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total pStat3 (Tyr-705, clone D3A7), tStat3 (clone 124H6), Stat3α (clone D1A5), Stat3β (1488 G6G5) and GAPDH. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 10–11). Stat3β and GAPDH levels were quantified by densitometry and the GAPDH-normalized pStat3 levels plotted as a function of their corresponding Stat3β levels ( B , Spearman r = 0.7667, p

    Techniques Used: Over Expression, Multiple Displacement Amplification, SDS Page, Transfection

    Stat3β monoclonal antibodies are specific for the CT7 epitope found exclusively on Stat3β. Truncated pure Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were purified from bacterial supernatants as described in the Methods section. Decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed ( A ) with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as ( B ) Stat3α (Clone D1A5), two total Stat3 antibodies, one raised against a C-terminal peptide (clone 124H6) and one raised against a N-terminal peptide (aa 149–262, clone STAAD22A) and visualized by chemiluminiscence. Protein in a replica gel was also detected using silver staining and shown at the bottom of panel ( B ). In panel ( C ), decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as total Stat3 antibody (clone 124H6) and visualized by chemiluminiscence.
    Figure Legend Snippet: Stat3β monoclonal antibodies are specific for the CT7 epitope found exclusively on Stat3β. Truncated pure Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were purified from bacterial supernatants as described in the Methods section. Decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed ( A ) with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as ( B ) Stat3α (Clone D1A5), two total Stat3 antibodies, one raised against a C-terminal peptide (clone 124H6) and one raised against a N-terminal peptide (aa 149–262, clone STAAD22A) and visualized by chemiluminiscence. Protein in a replica gel was also detected using silver staining and shown at the bottom of panel ( B ). In panel ( C ), decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as total Stat3 antibody (clone 124H6) and visualized by chemiluminiscence.

    Techniques Used: Purification, SDS Page, Silver Staining

    Stat3β monoclonals specifically detect Stat3β protein in cell protein extracts. Plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were transiently transfected into HEK 293T cells. Extracts (100 µg protein) from mock or plasmid transfected (48 h) cells were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for ( A ) Stat3β using the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 and ( B ) Stat3α (Clone D1A5), total Stat3 (clone 124H6) and GAPDH and visualized by chemiluminiscence. Various dilutions (ranging from 1:300 to 1:10,000) of the three Stat3β monoclonal antibodies 516 G10H9 ( C ), 954 E9E7 ( D ) and 1488 G6G5 ( E ) were used to probe 100 µg protein from 293T cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP and visualized by chemiluminiscence.
    Figure Legend Snippet: Stat3β monoclonals specifically detect Stat3β protein in cell protein extracts. Plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were transiently transfected into HEK 293T cells. Extracts (100 µg protein) from mock or plasmid transfected (48 h) cells were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for ( A ) Stat3β using the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 and ( B ) Stat3α (Clone D1A5), total Stat3 (clone 124H6) and GAPDH and visualized by chemiluminiscence. Various dilutions (ranging from 1:300 to 1:10,000) of the three Stat3β monoclonal antibodies 516 G10H9 ( C ), 954 E9E7 ( D ) and 1488 G6G5 ( E ) were used to probe 100 µg protein from 293T cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP and visualized by chemiluminiscence.

    Techniques Used: Transfection, Plasmid Preparation, SDS Page

    Schematic overview of domains of Stat3α and Stat3β and their derivation by normal splicing of the Stat3 gene or alternative splicing, respectively. Use of an alternative 3' splice acceptor site in exon 23 of the Stat3 gene ( A , middle panel) generates the Stat3β isoform ( A , lower panel) with the loss of 50 nucleotides from the exon and a frame shift, to add 21 nucleotides coding seven unique amino acids followed by a stop codon, within the exon 23 ( A , B lower panels). This leads to a truncated Stat3β in place of the normally intron-spliced Stat3α ( A , B upper panels).
    Figure Legend Snippet: Schematic overview of domains of Stat3α and Stat3β and their derivation by normal splicing of the Stat3 gene or alternative splicing, respectively. Use of an alternative 3' splice acceptor site in exon 23 of the Stat3 gene ( A , middle panel) generates the Stat3β isoform ( A , lower panel) with the loss of 50 nucleotides from the exon and a frame shift, to add 21 nucleotides coding seven unique amino acids followed by a stop codon, within the exon 23 ( A , B lower panels). This leads to a truncated Stat3β in place of the normally intron-spliced Stat3α ( A , B upper panels).

    Techniques Used:

    Stat3β monoclonal antibody can detect endogenous Stat3β in lysates from cell lines expressing various levels of Stat3β. Lysates (100 µg of total protein) from cell lines ACHN, COS7, and H4IIE (lanes 1–3) were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for total Stat3 (clone 124H6), Stat3β (516G10H9), Stat3α (Clone D1A5) and GAPDH and visualized by chemiluminiscence. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 5–7).
    Figure Legend Snippet: Stat3β monoclonal antibody can detect endogenous Stat3β in lysates from cell lines expressing various levels of Stat3β. Lysates (100 µg of total protein) from cell lines ACHN, COS7, and H4IIE (lanes 1–3) were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for total Stat3 (clone 124H6), Stat3β (516G10H9), Stat3α (Clone D1A5) and GAPDH and visualized by chemiluminiscence. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 5–7).

    Techniques Used: Expressing, SDS Page, Transfection

    25) Product Images from "Functional convergence of structurally distinct thioesterases from cyanobacteria and plants involved in phylloquinone biosynthesis"

    Article Title: Functional convergence of structurally distinct thioesterases from cyanobacteria and plants involved in phylloquinone biosynthesis

    Journal: Acta Crystallographica Section D: Biological Crystallography

    doi: 10.1107/S0907444913015771

    Orientation of the modeled DHNA-CoA in Slr0204 and AtDHNAT1. The DHNA-CoA thioesterase dimers are shown with modeled DHNA-CoA. In both proteins, the labile thioester bond is indicated by a black circle. Both Slr0204 ( a ) (blue and orange) and AtDHNAT1
    Figure Legend Snippet: Orientation of the modeled DHNA-CoA in Slr0204 and AtDHNAT1. The DHNA-CoA thioesterase dimers are shown with modeled DHNA-CoA. In both proteins, the labile thioester bond is indicated by a black circle. Both Slr0204 ( a ) (blue and orange) and AtDHNAT1

    Techniques Used:

    Slr0204 and AtDHNAT1 form distinct tetramers. In ( a ), the Slr0204 tetramer is shown with the orange/blue dimer oriented such that the hotdog α-helices point out of the plane of the page (marked by an asterisk). Slr0204 tetramerizes in the ‘facial’
    Figure Legend Snippet: Slr0204 and AtDHNAT1 form distinct tetramers. In ( a ), the Slr0204 tetramer is shown with the orange/blue dimer oriented such that the hotdog α-helices point out of the plane of the page (marked by an asterisk). Slr0204 tetramerizes in the ‘facial’

    Techniques Used: Polyacrylamide Gel Electrophoresis

    Slr0204 and AtDHNAT1 are structurally similar to the Pseudomonas and Arthrobacter 4-HBTs. The tetramers of Slr0204 (blue) and Pseudomonas ) are superimposed in ( a ), showing the overall conservation of the facial tetramerization
    Figure Legend Snippet: Slr0204 and AtDHNAT1 are structurally similar to the Pseudomonas and Arthrobacter 4-HBTs. The tetramers of Slr0204 (blue) and Pseudomonas ) are superimposed in ( a ), showing the overall conservation of the facial tetramerization

    Techniques Used:

    The active-site region of Slr0204. ( a ) shows the region around the active-site Asp16 residue (green), with 2 mF o − DF c electron density contoured at 1.0σ shown in blue. Ordered water molecules are depicted as red spheres and selected
    Figure Legend Snippet: The active-site region of Slr0204. ( a ) shows the region around the active-site Asp16 residue (green), with 2 mF o − DF c electron density contoured at 1.0σ shown in blue. Ordered water molecules are depicted as red spheres and selected

    Techniques Used:

    Structural comparison of the cyanobacterial and plant DHNA-CoA thioesterase monomers and dimers. In ( a ), ribbon diagrams for the cyanobacterial thioesterase Slr0204 and the plant thioesterase AtDHNAT1 are shown with sequentially numbered strands and lettered
    Figure Legend Snippet: Structural comparison of the cyanobacterial and plant DHNA-CoA thioesterase monomers and dimers. In ( a ), ribbon diagrams for the cyanobacterial thioesterase Slr0204 and the plant thioesterase AtDHNAT1 are shown with sequentially numbered strands and lettered

    Techniques Used:

    DHNA-CoA mediates dimer–dimer contacts in AtDHNAT1 but not in Slr0204. ( a ) shows that the Slr0204 facial tetramer directs the CoA portion of bound DHNA-CoA away from tetramerization interface, while in ( b ) the back-to-back AtDHNAT1 tetramer places
    Figure Legend Snippet: DHNA-CoA mediates dimer–dimer contacts in AtDHNAT1 but not in Slr0204. ( a ) shows that the Slr0204 facial tetramer directs the CoA portion of bound DHNA-CoA away from tetramerization interface, while in ( b ) the back-to-back AtDHNAT1 tetramer places

    Techniques Used:

    26) Product Images from "Functional and Biochemical Characterization of Dib1’s Role in pre-Messenger RNA Splicing"

    Article Title: Functional and Biochemical Characterization of Dib1’s Role in pre-Messenger RNA Splicing

    Journal: Journal of molecular biology

    doi: 10.1016/j.jmb.2018.04.027

    Wild-type Dib1 promotes formation of the splicing machinery beyond B complex. Spliceosome assembly of dibl-F85A (A) and dibl-L76A D78A (B). Splicing extracts were subjected to a variety of conditions prior to incorporation into splicing reactions. The
    Figure Legend Snippet: Wild-type Dib1 promotes formation of the splicing machinery beyond B complex. Spliceosome assembly of dibl-F85A (A) and dibl-L76A D78A (B). Splicing extracts were subjected to a variety of conditions prior to incorporation into splicing reactions. The

    Techniques Used:

    Dib1 mutants disrupts splicing but is rescued by exogenous Dib1. Conditions in the assay are indicated. Heated Ex indicates splicing extract was heated at 37°C prior to the splicing reaction. For samples with ATP, ATP was added to a final concentration
    Figure Legend Snippet: Dib1 mutants disrupts splicing but is rescued by exogenous Dib1. Conditions in the assay are indicated. Heated Ex indicates splicing extract was heated at 37°C prior to the splicing reaction. For samples with ATP, ATP was added to a final concentration

    Techniques Used: Concentration Assay

    Structural Analysis of Recombinant Wild-type Dib1 and Dib1 L76A/D78A. CD spectra of wild-type (blue circles) and L76A/D78A (orange diamonds) Dib1 protein were taken from 195nm to 260nm at 30°C. Spectra for wild-type (green squares) and L76A/D78A
    Figure Legend Snippet: Structural Analysis of Recombinant Wild-type Dib1 and Dib1 L76A/D78A. CD spectra of wild-type (blue circles) and L76A/D78A (orange diamonds) Dib1 protein were taken from 195nm to 260nm at 30°C. Spectra for wild-type (green squares) and L76A/D78A

    Techniques Used: Recombinant

    . B. Growth phenotypes of dib1 mutants. Serial dilutions of S. cerevisae harboring dib1 mutants as
    Figure Legend Snippet: . B. Growth phenotypes of dib1 mutants. Serial dilutions of S. cerevisae harboring dib1 mutants as

    Techniques Used:

    Identification of novel mutants in dib1 that stall growth
    Figure Legend Snippet: Identification of novel mutants in dib1 that stall growth

    Techniques Used:

    ]) Colored are Dib1
    Figure Legend Snippet: ]) Colored are Dib1

    Techniques Used:

    27) Product Images from "Akt Plays a Critical Role in Replication of Nonsegmented Negative-Stranded RNA Viruses ▿"

    Article Title: Akt Plays a Critical Role in Replication of Nonsegmented Negative-Stranded RNA Viruses ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.01520-07

    Phosphorylation of recombinant P by Akt1. Recombinant PIV5 P with a six-His tag at its N terminus was purified from bacteria as described in Materials and Methods and used in in vitro kinase assays with activated Akt1. (a) Phosphorylation of the recombinant
    Figure Legend Snippet: Phosphorylation of recombinant P by Akt1. Recombinant PIV5 P with a six-His tag at its N terminus was purified from bacteria as described in Materials and Methods and used in in vitro kinase assays with activated Akt1. (a) Phosphorylation of the recombinant

    Techniques Used: Recombinant, Purification, In Vitro

    28) Product Images from "Protein interaction mapping identifies RBBP6 as a negative regulator of Ebola virus replication"

    Article Title: Protein interaction mapping identifies RBBP6 as a negative regulator of Ebola virus replication

    Journal: Cell

    doi: 10.1016/j.cell.2018.08.044

    Interaction between EBOV VP30 and human RBBP6. (A) . (B) Flag-VP30 from Zaire ebolavirus (EBOV), Reston virus (RESTV), Lloviu virus (LLOV) and Marburg virus (MARV) co-immunoprecipitate with HA-RBBP6. (C) A schematic representation of domain organization of RBBP6 isoform 1 and 3 (top). RBBP6 functional domains consists of domain with no name (DWNN), zinc knuckle, ring finger domain, proline and arginine-serine rich domains followed by retinoblastoma (Rb) and p53 binding domains. Bottom panel depicts co-immunoprecipitation of flag-tagged VP30 with transiently expressed HA-RBBP6 isoform 1 or 3. HEK293T cells were transfected with HA-RBBP6 alone or in combination with flag-VP30, as indicated followed by IP with anti-HA. (D) Schematic drawing of RBBP6 truncation mutants used in domain mapping studies (top). Anti-HA IP was performed after co-expression of HA-tagged full-length RBBP6 or different truncations in combination with empty vector or flag-VP30. (E) Immunoprecipitation with anti-HA in cell lysates expressing HA-RBBP6 and flag-tagged RNA binding mutants of VP30. 3RA: R26A/R28A/R40A.
    Figure Legend Snippet: Interaction between EBOV VP30 and human RBBP6. (A) . (B) Flag-VP30 from Zaire ebolavirus (EBOV), Reston virus (RESTV), Lloviu virus (LLOV) and Marburg virus (MARV) co-immunoprecipitate with HA-RBBP6. (C) A schematic representation of domain organization of RBBP6 isoform 1 and 3 (top). RBBP6 functional domains consists of domain with no name (DWNN), zinc knuckle, ring finger domain, proline and arginine-serine rich domains followed by retinoblastoma (Rb) and p53 binding domains. Bottom panel depicts co-immunoprecipitation of flag-tagged VP30 with transiently expressed HA-RBBP6 isoform 1 or 3. HEK293T cells were transfected with HA-RBBP6 alone or in combination with flag-VP30, as indicated followed by IP with anti-HA. (D) Schematic drawing of RBBP6 truncation mutants used in domain mapping studies (top). Anti-HA IP was performed after co-expression of HA-tagged full-length RBBP6 or different truncations in combination with empty vector or flag-VP30. (E) Immunoprecipitation with anti-HA in cell lysates expressing HA-RBBP6 and flag-tagged RNA binding mutants of VP30. 3RA: R26A/R28A/R40A.

    Techniques Used: Functional Assay, Binding Assay, Immunoprecipitation, Transfection, Expressing, Plasmid Preparation, RNA Binding Assay

    29) Product Images from "Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding *Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding * ♦"

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding *Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding * ♦

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M113.542159

    PhLP1 and PDCD5 bind CCT independently of each other. PDCD5 was either overexpressed ( A ) or knocked down ( B ), along with PhLP1-Myc overexpression in HEK-293T cells. Cell lysates were immunoprecipitated with anti-CCTϵ ( A ) or anti-Myc ( B ) and blotted as indicated. PhLP1 was either overexpressed ( C ) or knocked down ( D ), along with PDCD5-FLAG overexpression in HEK-293T cells. Cell lysates were immunoprecipitated with anti-CCTϵ ( C ) or anti-FLAG ( D ) and blotted as indicated. Bars represent the average ± S.E. from at least three experiments. Cell lysates were blotted for PDCD5-FLAG, endogenous PDCD5, PhLP1-Myc, or endogenous PhLP1 as indicated to verify the overexpression and knockdowns. Representative blots are shown below the graphs.
    Figure Legend Snippet: PhLP1 and PDCD5 bind CCT independently of each other. PDCD5 was either overexpressed ( A ) or knocked down ( B ), along with PhLP1-Myc overexpression in HEK-293T cells. Cell lysates were immunoprecipitated with anti-CCTϵ ( A ) or anti-Myc ( B ) and blotted as indicated. PhLP1 was either overexpressed ( C ) or knocked down ( D ), along with PDCD5-FLAG overexpression in HEK-293T cells. Cell lysates were immunoprecipitated with anti-CCTϵ ( C ) or anti-FLAG ( D ) and blotted as indicated. Bars represent the average ± S.E. from at least three experiments. Cell lysates were blotted for PDCD5-FLAG, endogenous PDCD5, PhLP1-Myc, or endogenous PhLP1 as indicated to verify the overexpression and knockdowns. Representative blots are shown below the graphs.

    Techniques Used: Over Expression, Immunoprecipitation

    PDCD5 forms a complex with PhLP1 and CCT. A , binding of PDCD5 to phosducin family members was measured by co-immunoprecipitation from HEK-293T cells transfected with PDCD5-FLAG along with Myc-tagged phosducin family members as indicated. After 48 h, cells were lysed, immunoprecipitated with an anti-Myc antibody, and immunoblotted for PDCD5-FLAG. B , binding of purified PDCD5 to PhLP1 or CK2-phosphorylated PhLP1 was assessed by co-immunoprecipitation in vitro . Phosphorylated PhLP1, unphosphorylated PhLP1, or no PhLP1 was incubated with PDCD5, immunoprecipitated with an Myc antibody, and blotted as indicated. C , simultaneous binding of PDCD5 and PhLP1 was measured by co-immunoprecipitation. HEK-293T cells were transfected with PDCD5-FLAG or empty vector, immunoprecipitated with FLAG, and blotted for endogenous PhLP1 and CCTϵ ( left panel ). Endogenous CCTϵ was also immunoprecipitated and blotted for endogenous PhLP1 and PDCD5-FLAG ( right panel ). A nontargeting Myc antibody served as a negative control. D , effect of CCT knockdown on PDCD5 binding to PhLP1 was measured by co-immunoprecipitation of PhLP1-Myc from HEK-293T cells treated with CCTζ siRNA or a control siRNA and later transfected with FLAG-PDCD5 and PhLP1-Myc. The ratio of the PDCD5 band to the PhLP1 band was calculated and normalized to the control. Bars represent the average ± S.E. of the mean from at least three experiments. Representative blots are shown below the graphs. E , formation of a PhLP1·PDCD5·CCT complex was demonstrated in double immunoprecipitation experiments from HEK-293T cells transfected with PDCD5-FLAG along with PhLP1-TEV-Myc or empty vector.
    Figure Legend Snippet: PDCD5 forms a complex with PhLP1 and CCT. A , binding of PDCD5 to phosducin family members was measured by co-immunoprecipitation from HEK-293T cells transfected with PDCD5-FLAG along with Myc-tagged phosducin family members as indicated. After 48 h, cells were lysed, immunoprecipitated with an anti-Myc antibody, and immunoblotted for PDCD5-FLAG. B , binding of purified PDCD5 to PhLP1 or CK2-phosphorylated PhLP1 was assessed by co-immunoprecipitation in vitro . Phosphorylated PhLP1, unphosphorylated PhLP1, or no PhLP1 was incubated with PDCD5, immunoprecipitated with an Myc antibody, and blotted as indicated. C , simultaneous binding of PDCD5 and PhLP1 was measured by co-immunoprecipitation. HEK-293T cells were transfected with PDCD5-FLAG or empty vector, immunoprecipitated with FLAG, and blotted for endogenous PhLP1 and CCTϵ ( left panel ). Endogenous CCTϵ was also immunoprecipitated and blotted for endogenous PhLP1 and PDCD5-FLAG ( right panel ). A nontargeting Myc antibody served as a negative control. D , effect of CCT knockdown on PDCD5 binding to PhLP1 was measured by co-immunoprecipitation of PhLP1-Myc from HEK-293T cells treated with CCTζ siRNA or a control siRNA and later transfected with FLAG-PDCD5 and PhLP1-Myc. The ratio of the PDCD5 band to the PhLP1 band was calculated and normalized to the control. Bars represent the average ± S.E. of the mean from at least three experiments. Representative blots are shown below the graphs. E , formation of a PhLP1·PDCD5·CCT complex was demonstrated in double immunoprecipitation experiments from HEK-293T cells transfected with PDCD5-FLAG along with PhLP1-TEV-Myc or empty vector.

    Techniques Used: Binding Assay, Immunoprecipitation, Transfection, Purification, In Vitro, Incubation, Plasmid Preparation, Negative Control

    30) Product Images from "Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer"

    Article Title: Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer

    Journal: Cancers

    doi: 10.3390/cancers6042012

    Stat3β monoclonal antibodies specifically immunoprecipitate Stat3β from protein lysates. Stat3β Mab 516G10H9 (1:30) and Stat3α Ab (D1A5) were added to 200 µg of protein from either untransfected Stat3 −/− murine embryonic fibroblasts (MEFs) or cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP, incubated overnight at 4 °C. The lysates were then incubated with protein G-agarose beads for 30 min at 4 °C and after centrifugation, the beads boiled in loading dye and the eluted proteins subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, upper panel). An equivalent volume of cell lysates (20 µL) used in each reaction were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, lower panel) to indicate the amount of protein input.
    Figure Legend Snippet: Stat3β monoclonal antibodies specifically immunoprecipitate Stat3β from protein lysates. Stat3β Mab 516G10H9 (1:30) and Stat3α Ab (D1A5) were added to 200 µg of protein from either untransfected Stat3 −/− murine embryonic fibroblasts (MEFs) or cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP, incubated overnight at 4 °C. The lysates were then incubated with protein G-agarose beads for 30 min at 4 °C and after centrifugation, the beads boiled in loading dye and the eluted proteins subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, upper panel). An equivalent volume of cell lysates (20 µL) used in each reaction were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total Stat3 (clone 124H6, lower panel) to indicate the amount of protein input.

    Techniques Used: Transfection, Incubation, Centrifugation, SDS Page

    Stat3β overexpression correlates with Stat3 phosphorylation in breast cancer cell lines. In panel ( A ), lysates (100 µg protein) from normal breast epithelial cells MCF-12A, and breast cancer cell lines MCF-7, T47D, BT-474, MDA-MB 453, HCC1954, MDA-MB-231, MDA-MB-468, and BT549 cells were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total pStat3 (Tyr-705, clone D3A7), tStat3 (clone 124H6), Stat3α (clone D1A5), Stat3β (1488 G6G5) and GAPDH. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 10–11). Stat3β and GAPDH levels were quantified by densitometry and the GAPDH-normalized pStat3 levels plotted as a function of their corresponding Stat3β levels ( B , Spearman r = 0.7667, p
    Figure Legend Snippet: Stat3β overexpression correlates with Stat3 phosphorylation in breast cancer cell lines. In panel ( A ), lysates (100 µg protein) from normal breast epithelial cells MCF-12A, and breast cancer cell lines MCF-7, T47D, BT-474, MDA-MB 453, HCC1954, MDA-MB-231, MDA-MB-468, and BT549 cells were subjected to SDS-PAGE, transferred to nitrocellulose membrane and probed for total pStat3 (Tyr-705, clone D3A7), tStat3 (clone 124H6), Stat3α (clone D1A5), Stat3β (1488 G6G5) and GAPDH. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 10–11). Stat3β and GAPDH levels were quantified by densitometry and the GAPDH-normalized pStat3 levels plotted as a function of their corresponding Stat3β levels ( B , Spearman r = 0.7667, p

    Techniques Used: Over Expression, Multiple Displacement Amplification, SDS Page, Transfection

    Coomassie stain of the purified Stat3β specific monoclonal antibodies. Ammonium-sulphate precipitated proteins were passed through protein G columns. The protein G-adsorbed antibodies were eluted and pooled together (pool 1). The flow through was again passed through the column to recover all unadsorbed antibodies and were similarly eluted and pooled (pool 2). Exactly 2 μL and 4 μL of pool 1 (lanes 2 and 3) and 2 μL and 4 μL of pool 2 (lanes 4 and 5) of pure antibodies were boiled with SDS-containing loading dye and ran on PAGE along with molecular weight markers (lane 1) and increasing amounts (1 µg, 2 µg, 3 µg) of control protein Bovine Serum Albumin (BSA, lanes 7–9) and stained with coomassie. Representative gels run as described above, for the three antibodies 516 G10H9 (upper panel), 954 E9E7 (middle panel) and 1488 G6G5 are shown.
    Figure Legend Snippet: Coomassie stain of the purified Stat3β specific monoclonal antibodies. Ammonium-sulphate precipitated proteins were passed through protein G columns. The protein G-adsorbed antibodies were eluted and pooled together (pool 1). The flow through was again passed through the column to recover all unadsorbed antibodies and were similarly eluted and pooled (pool 2). Exactly 2 μL and 4 μL of pool 1 (lanes 2 and 3) and 2 μL and 4 μL of pool 2 (lanes 4 and 5) of pure antibodies were boiled with SDS-containing loading dye and ran on PAGE along with molecular weight markers (lane 1) and increasing amounts (1 µg, 2 µg, 3 µg) of control protein Bovine Serum Albumin (BSA, lanes 7–9) and stained with coomassie. Representative gels run as described above, for the three antibodies 516 G10H9 (upper panel), 954 E9E7 (middle panel) and 1488 G6G5 are shown.

    Techniques Used: Staining, Purification, Flow Cytometry, Polyacrylamide Gel Electrophoresis, Molecular Weight

    Stat3β monoclonal antibodies are specific for the CT7 epitope found exclusively on Stat3β. Truncated pure Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were purified from bacterial supernatants as described in the Methods section. Decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed ( A ) with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as ( B ) Stat3α (Clone D1A5), two total Stat3 antibodies, one raised against a C-terminal peptide (clone 124H6) and one raised against a N-terminal peptide (aa 149–262, clone STAAD22A) and visualized by chemiluminiscence. Protein in a replica gel was also detected using silver staining and shown at the bottom of panel ( B ). In panel ( C ), decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as total Stat3 antibody (clone 124H6) and visualized by chemiluminiscence.
    Figure Legend Snippet: Stat3β monoclonal antibodies are specific for the CT7 epitope found exclusively on Stat3β. Truncated pure Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were purified from bacterial supernatants as described in the Methods section. Decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3α (amino acids 127–770), truncated Stat3β (amino acids 127–722) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed ( A ) with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as ( B ) Stat3α (Clone D1A5), two total Stat3 antibodies, one raised against a C-terminal peptide (clone 124H6) and one raised against a N-terminal peptide (aa 149–262, clone STAAD22A) and visualized by chemiluminiscence. Protein in a replica gel was also detected using silver staining and shown at the bottom of panel ( B ). In panel ( C ), decreasing amounts (100 ng, 30 ng, 10 ng, 3 ng, 1 ng, 0.3 ng) of truncated Stat3β (amino acids 127–722) and truncated Stat3β devoid of CT7 (amino acids 127–717) were loaded onto consecutive wells and subjected to SDS-PAGE, transferred to nitrocellulose membranes and probed with the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 as well as total Stat3 antibody (clone 124H6) and visualized by chemiluminiscence.

    Techniques Used: Purification, SDS Page, Silver Staining

    Stat3β monoclonals specifically detect Stat3β protein in cell protein extracts. Plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were transiently transfected into HEK 293T cells. Extracts (100 µg protein) from mock or plasmid transfected (48 h) cells were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for ( A ) Stat3β using the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 and ( B ) Stat3α (Clone D1A5), total Stat3 (clone 124H6) and GAPDH and visualized by chemiluminiscence. Various dilutions (ranging from 1:300 to 1:10,000) of the three Stat3β monoclonal antibodies 516 G10H9 ( C ), 954 E9E7 ( D ) and 1488 G6G5 ( E ) were used to probe 100 µg protein from 293T cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP and visualized by chemiluminiscence.
    Figure Legend Snippet: Stat3β monoclonals specifically detect Stat3β protein in cell protein extracts. Plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were transiently transfected into HEK 293T cells. Extracts (100 µg protein) from mock or plasmid transfected (48 h) cells were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for ( A ) Stat3β using the three monoclonal antibodies 516 G10H9, 954 E9E7 and 1488 G6G5 and ( B ) Stat3α (Clone D1A5), total Stat3 (clone 124H6) and GAPDH and visualized by chemiluminiscence. Various dilutions (ranging from 1:300 to 1:10,000) of the three Stat3β monoclonal antibodies 516 G10H9 ( C ), 954 E9E7 ( D ) and 1488 G6G5 ( E ) were used to probe 100 µg protein from 293T cells transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP and visualized by chemiluminiscence.

    Techniques Used: Transfection, Plasmid Preparation, SDS Page

    Schematic overview of domains of Stat3α and Stat3β and their derivation by normal splicing of the Stat3 gene or alternative splicing, respectively. Use of an alternative 3' splice acceptor site in exon 23 of the Stat3 gene ( A , middle panel) generates the Stat3β isoform ( A , lower panel) with the loss of 50 nucleotides from the exon and a frame shift, to add 21 nucleotides coding seven unique amino acids followed by a stop codon, within the exon 23 ( A , B lower panels). This leads to a truncated Stat3β in place of the normally intron-spliced Stat3α ( A , B upper panels).
    Figure Legend Snippet: Schematic overview of domains of Stat3α and Stat3β and their derivation by normal splicing of the Stat3 gene or alternative splicing, respectively. Use of an alternative 3' splice acceptor site in exon 23 of the Stat3 gene ( A , middle panel) generates the Stat3β isoform ( A , lower panel) with the loss of 50 nucleotides from the exon and a frame shift, to add 21 nucleotides coding seven unique amino acids followed by a stop codon, within the exon 23 ( A , B lower panels). This leads to a truncated Stat3β in place of the normally intron-spliced Stat3α ( A , B upper panels).

    Techniques Used:

    Stat3β monoclonal antibody can detect endogenous Stat3β in lysates from cell lines expressing various levels of Stat3β. Lysates (100 µg of total protein) from cell lines ACHN, COS7, and H4IIE (lanes 1–3) were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for total Stat3 (clone 124H6), Stat3β (516G10H9), Stat3α (Clone D1A5) and GAPDH and visualized by chemiluminiscence. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 5–7).
    Figure Legend Snippet: Stat3β monoclonal antibody can detect endogenous Stat3β in lysates from cell lines expressing various levels of Stat3β. Lysates (100 µg of total protein) from cell lines ACHN, COS7, and H4IIE (lanes 1–3) were separated by SDS-PAGE, transferred to nitrocellulose membrane and replicate blots probed for total Stat3 (clone 124H6), Stat3β (516G10H9), Stat3α (Clone D1A5) and GAPDH and visualized by chemiluminiscence. Lysates (30 µg of protein) from 293T cells, mock transfected (transfection reagent alone) or transiently transfected with plasmids encoding fusion proteins Stat3α-GFP and Stat3β-GFP were used as controls (lanes 5–7).

    Techniques Used: Expressing, SDS Page, Transfection

    31) Product Images from "Autoantibodies to Vimentin Cause Accelerated Rejection of Cardiac Allografts"

    Article Title: Autoantibodies to Vimentin Cause Accelerated Rejection of Cardiac Allografts

    Journal: The American Journal of Pathology

    doi: 10.2353/ajpath.2007.060728

    Accelerated rejection of cardiac allografts in vimentin-immunized mice. Kaplan-Meier survival graft shows accelerated rejection of 129/sv allografts placed in vim/CFA (Allo vim, n = 18) recipients compared with allografts placed in hel/CFA-immunized (Allo hel, n = 10) recipients ( P
    Figure Legend Snippet: Accelerated rejection of cardiac allografts in vimentin-immunized mice. Kaplan-Meier survival graft shows accelerated rejection of 129/sv allografts placed in vim/CFA (Allo vim, n = 18) recipients compared with allografts placed in hel/CFA-immunized (Allo hel, n = 10) recipients ( P

    Techniques Used: Mouse Assay

    Deposition of C3d in cardiac allografts. Photomicrograph of frozen section of 129/sv cardiac allograft placed in vim/CFA- ( A ) or hel/CFA- ( B ) immunized recipients taken at time of rejection, stained with FITC-conjugated rabbit anti-human C3d. Quantification of C3d deposits at days 2 to 8 and time of acute rejection (AR) revealed more C3d deposition in allografts placed in vimentin-immunized C57BL/6 recipients compared with allografts placed in hel-immunized recipients ( C ). Quantification is expressed as pixel units on the y axis. ** P
    Figure Legend Snippet: Deposition of C3d in cardiac allografts. Photomicrograph of frozen section of 129/sv cardiac allograft placed in vim/CFA- ( A ) or hel/CFA- ( B ) immunized recipients taken at time of rejection, stained with FITC-conjugated rabbit anti-human C3d. Quantification of C3d deposits at days 2 to 8 and time of acute rejection (AR) revealed more C3d deposition in allografts placed in vimentin-immunized C57BL/6 recipients compared with allografts placed in hel-immunized recipients ( C ). Quantification is expressed as pixel units on the y axis. ** P

    Techniques Used: Staining

    Quantification of T cells and CD41 platelets. Quantification of CD3 + ( A ), CD4 + ( B ), and CD8 + ( C ) T cells and CD41 + platelets ( D ) infiltrating 129/sv allografts in C57BL/6 recipients immunized with vim/CFA (allo vim), hel/CFA (allo hel), or C57BL/6 isografts placed in vim/CFA (syn vim)-immunized mice at various times after transplantation. Results expressed as cells/hpf, mean ± SD ( n = 4 mice/group). * P
    Figure Legend Snippet: Quantification of T cells and CD41 platelets. Quantification of CD3 + ( A ), CD4 + ( B ), and CD8 + ( C ) T cells and CD41 + platelets ( D ) infiltrating 129/sv allografts in C57BL/6 recipients immunized with vim/CFA (allo vim), hel/CFA (allo hel), or C57BL/6 isografts placed in vim/CFA (syn vim)-immunized mice at various times after transplantation. Results expressed as cells/hpf, mean ± SD ( n = 4 mice/group). * P

    Techniques Used: Mouse Assay, Transplantation Assay

    Demonstration of endothelial cell activation and microvascular damage in cardiac allografts from vim/CFA recipients. Photomicrographs of frozen sections of cardiac allografts from vim/CFA ( A and C ) or hel/CFA ( B and D ) recipients stained with mAb to CD41 ( A and B ) or CD62P (P-selectin, C and D ) 6 days after transplantation. Hearts from vim/CFA recipients ( C ) show extensive microvascular expression of P-selectin compared with hearts from hel/CFA recipients ( D ). Hearts from mice at day 4 show similar results to day 6 (not shown).
    Figure Legend Snippet: Demonstration of endothelial cell activation and microvascular damage in cardiac allografts from vim/CFA recipients. Photomicrographs of frozen sections of cardiac allografts from vim/CFA ( A and C ) or hel/CFA ( B and D ) recipients stained with mAb to CD41 ( A and B ) or CD62P (P-selectin, C and D ) 6 days after transplantation. Hearts from vim/CFA recipients ( C ) show extensive microvascular expression of P-selectin compared with hearts from hel/CFA recipients ( D ). Hearts from mice at day 4 show similar results to day 6 (not shown).

    Techniques Used: Activation Assay, Staining, Transplantation Assay, Expressing, Mouse Assay

    Rejection of allografts in vim/CFA IgH6 mice. Kaplan-Meier graft survival of 129/sv allografts placed in IgH6 immunized with vim/CFA (vim) or hel/CFA (hel) ( A ) demonstrates no difference in survival. Quantification of CD3 ( B ) and CD8 ( C ) T cells in cardiac allografts from immunized (vim) and hel mice (hel) showed increased CD3 and CD8 T cells in hearts of vim/CFA recipients at time of rejection. Cells expressed as numbers/hpf, mean ±SD ( n = 4/group). * P
    Figure Legend Snippet: Rejection of allografts in vim/CFA IgH6 mice. Kaplan-Meier graft survival of 129/sv allografts placed in IgH6 immunized with vim/CFA (vim) or hel/CFA (hel) ( A ) demonstrates no difference in survival. Quantification of CD3 ( B ) and CD8 ( C ) T cells in cardiac allografts from immunized (vim) and hel mice (hel) showed increased CD3 and CD8 T cells in hearts of vim/CFA recipients at time of rejection. Cells expressed as numbers/hpf, mean ±SD ( n = 4/group). * P

    Techniques Used: Mouse Assay

    Confocal laser scanning microscopy of cryostat sections of allografted heart from vimentin-immunized recipient at time of rejection. Antibody combinations are described in Materials and Methods. In A , sections stained for leukocytes (CD45-APC), C3d (Cascade Blue, pseudostained for white to represent the C3d signal), vimentin (Alexa 594), and apoptosis (terminal deoxynucleotidyl transferase dUTP nick-end labeling-FITC). The composite shows co-localization of vimentin and C3d expression on apoptosing infiltrating recipient leukocytes. In B , sections were stained for C3d (Cascade Blue), endothelial cells, CD31 (Alexa 546), and vimentin (Alexa 594). The composite shows co-localization of vimentin and C3d on endothelial cells. In C , sections were stained for vimentin (Alexa 594), leukocytes (CD45-APC, pseudostained for white to represent the CD45 signal), platelets (CD41-FITC), and C3d (Cascade Blue). The composite shows co-localization of vimentin and C3d expression on platelet (CD41 + )-leukocyte (CD45 + ) conjugates (dotted areas). Isolated deposits of vimentin-negative unactivated platelets did not demonstrate C3d staining on their surfaces ( arrowheads ). Apoptosis was demonstrated by terminal deoxynucleotidyl transferase dUTP nick-end labeling staining.
    Figure Legend Snippet: Confocal laser scanning microscopy of cryostat sections of allografted heart from vimentin-immunized recipient at time of rejection. Antibody combinations are described in Materials and Methods. In A , sections stained for leukocytes (CD45-APC), C3d (Cascade Blue, pseudostained for white to represent the C3d signal), vimentin (Alexa 594), and apoptosis (terminal deoxynucleotidyl transferase dUTP nick-end labeling-FITC). The composite shows co-localization of vimentin and C3d expression on apoptosing infiltrating recipient leukocytes. In B , sections were stained for C3d (Cascade Blue), endothelial cells, CD31 (Alexa 546), and vimentin (Alexa 594). The composite shows co-localization of vimentin and C3d on endothelial cells. In C , sections were stained for vimentin (Alexa 594), leukocytes (CD45-APC, pseudostained for white to represent the CD45 signal), platelets (CD41-FITC), and C3d (Cascade Blue). The composite shows co-localization of vimentin and C3d expression on platelet (CD41 + )-leukocyte (CD45 + ) conjugates (dotted areas). Isolated deposits of vimentin-negative unactivated platelets did not demonstrate C3d staining on their surfaces ( arrowheads ). Apoptosis was demonstrated by terminal deoxynucleotidyl transferase dUTP nick-end labeling staining.

    Techniques Used: Confocal Laser Scanning Microscopy, Staining, TUNEL Assay, Expressing, Isolation

    Antibody and cytokine production in vimentin-immunized mice. C57BL/6 mice were immunized with 400 μg of vimentin emulsified in CFA followed by a booster of 400 μg of vimentin alone 1 week later. Controls received 100 μl of 6 mol/L urea (vehicle) in CFA. ELISA was used to determine titers of IgG ( A ) and IgM ( B ) AVA at 2 to 12 weeks after the first injection. IgG subclasses of AVA were determined in C . Points represent means and standard deviations of four mice per group. * P
    Figure Legend Snippet: Antibody and cytokine production in vimentin-immunized mice. C57BL/6 mice were immunized with 400 μg of vimentin emulsified in CFA followed by a booster of 400 μg of vimentin alone 1 week later. Controls received 100 μl of 6 mol/L urea (vehicle) in CFA. ELISA was used to determine titers of IgG ( A ) and IgM ( B ) AVA at 2 to 12 weeks after the first injection. IgG subclasses of AVA were determined in C . Points represent means and standard deviations of four mice per group. * P

    Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay, Antiviral Assay, Injection

    Levels of AVA in serum, transplanted hearts, and own hearts of vim/CFA-immunized mice. Time course of IgG AVA in serum of C57BL/6 mice immunized with vim/CFA and either receiving a 129/sv cardiac allograft (Tx) or not transplanted (No Tx), mean ± SD from five sera/group ( A ) (* P
    Figure Legend Snippet: Levels of AVA in serum, transplanted hearts, and own hearts of vim/CFA-immunized mice. Time course of IgG AVA in serum of C57BL/6 mice immunized with vim/CFA and either receiving a 129/sv cardiac allograft (Tx) or not transplanted (No Tx), mean ± SD from five sera/group ( A ) (* P

    Techniques Used: Antiviral Assay, Mouse Assay

    Passive transfer (PT) of immunized serum restores accelerated rejection. Kaplan-Meier survival curve of 129/sv allografts placed in IgH6 mice, which received serum from immunized (Vim PT) or unimmunized rabbits (Us PT) ( A ). Quantification of C3d in hearts at times of rejection is shown in the histogram ( B ), and the photomicrograph shows immunocytochemical localization of C3d in frozen section of heart placed in vim/CFA recipient at the time of rejection. ** P
    Figure Legend Snippet: Passive transfer (PT) of immunized serum restores accelerated rejection. Kaplan-Meier survival curve of 129/sv allografts placed in IgH6 mice, which received serum from immunized (Vim PT) or unimmunized rabbits (Us PT) ( A ). Quantification of C3d in hearts at times of rejection is shown in the histogram ( B ), and the photomicrograph shows immunocytochemical localization of C3d in frozen section of heart placed in vim/CFA recipient at the time of rejection. ** P

    Techniques Used: Mouse Assay

    32) Product Images from "Preliminary structural studies on the leucine-zipper homology region of the human protein Bap31"

    Article Title: Preliminary structural studies on the leucine-zipper homology region of the human protein Bap31

    Journal: Acta Crystallographica Section F: Structural Biology and Crystallization Communications

    doi: 10.1107/S1744309107008925

    Image of a typical crystal of human Bap31 leucine-zipper homology region grown by the sitting-drop method.
    Figure Legend Snippet: Image of a typical crystal of human Bap31 leucine-zipper homology region grown by the sitting-drop method.

    Techniques Used:

    33) Product Images from "The PYRIN domain: A member of the death domain-fold superfamily"

    Article Title: The PYRIN domain: A member of the death domain-fold superfamily

    Journal: Protein Science : A Publication of the Protein Society

    doi:

    Far-UV CD spectra of the CARD7 PYRIN domain (filled circles), FADD DD (open circles), TNFR1 DD (open squares), and caspase-1 CARD (open triangles).
    Figure Legend Snippet: Far-UV CD spectra of the CARD7 PYRIN domain (filled circles), FADD DD (open circles), TNFR1 DD (open squares), and caspase-1 CARD (open triangles).

    Techniques Used:

    34) Product Images from "Sublingual Immunization with M2-Based Vaccine Induces Broad Protective Immunity against Influenza"

    Article Title: Sublingual Immunization with M2-Based Vaccine Induces Broad Protective Immunity against Influenza

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027953

    Construction of plasmids and purification of M2 proteins. (A) The synthetic M2eC or 3M2eC genes without hydrophobic region (amino acids 26–55) from PR8 virus were cloned into pET15b vector (B). The recombinant proteins expressed in E. coli were purified by His-tag affinity chromatography and detected by Western blot using M2e-specific monoclonal Ab, 14C2.
    Figure Legend Snippet: Construction of plasmids and purification of M2 proteins. (A) The synthetic M2eC or 3M2eC genes without hydrophobic region (amino acids 26–55) from PR8 virus were cloned into pET15b vector (B). The recombinant proteins expressed in E. coli were purified by His-tag affinity chromatography and detected by Western blot using M2e-specific monoclonal Ab, 14C2.

    Techniques Used: Purification, Clone Assay, Plasmid Preparation, Recombinant, Affinity Chromatography, Western Blot

    35) Product Images from "Structural insights into RNA encapsidation and helical assembly of the Toscana virus nucleoprotein"

    Article Title: Structural insights into RNA encapsidation and helical assembly of the Toscana virus nucleoprotein

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku229

    Conformational changes in the RNA-binding tunnel. ( A ) Superposition of an apo (brown) and RNA-bound (blue) N monomer (bound RNA is not shown). In these two structures, the amino-terminal arm is displaced relative to the core domain. ( B ) Cartoon representation showing the Tyr32–Lys79–Lys204 triad, which is situated in the RNA tunnel in the apo structure. ( C ) Stacking of Tyr32 against the guanine base of G2 and binding of Lys79 and Lys204 to the phosphate backbone of the RNA creates an open RNA-binding tunnel, as shown in the RNP structure. ( D ) ITC-binding curve of the 9-mer RNA oligo1 to the following N mutants: Y32A ( K d = 1.6 μM ± 0.2 μM, n = 0.46 ± 0.01); K79A ( K d = 220 nM ± 30 nM, n = 0.42 ± 0.01); Y32A–K79A ( K d = 6 μM ± 2 μM, n = 0.43 ± 0.05); K204A ( K d = 250 nM ± 10 nM, n = 0.41 ± 0.01). ( E ) EM microscopy of reconstituted RNP particles of the Toscana virus Y32A, K79A, Y32A–K79A and K204A mutants, as described in Figure 1C . ( F ) Minireplicon assay of RVFV with the indicated N mutants. Cells were transfected with constructs for RVFV L, a model minigenome expressing a reporter gene, RVFV N, and the indicated N mutants. The reporter values of the minireplicon system reflect the activity of the recombinant RNPs reconstituted from expressed cDNA sequences.
    Figure Legend Snippet: Conformational changes in the RNA-binding tunnel. ( A ) Superposition of an apo (brown) and RNA-bound (blue) N monomer (bound RNA is not shown). In these two structures, the amino-terminal arm is displaced relative to the core domain. ( B ) Cartoon representation showing the Tyr32–Lys79–Lys204 triad, which is situated in the RNA tunnel in the apo structure. ( C ) Stacking of Tyr32 against the guanine base of G2 and binding of Lys79 and Lys204 to the phosphate backbone of the RNA creates an open RNA-binding tunnel, as shown in the RNP structure. ( D ) ITC-binding curve of the 9-mer RNA oligo1 to the following N mutants: Y32A ( K d = 1.6 μM ± 0.2 μM, n = 0.46 ± 0.01); K79A ( K d = 220 nM ± 30 nM, n = 0.42 ± 0.01); Y32A–K79A ( K d = 6 μM ± 2 μM, n = 0.43 ± 0.05); K204A ( K d = 250 nM ± 10 nM, n = 0.41 ± 0.01). ( E ) EM microscopy of reconstituted RNP particles of the Toscana virus Y32A, K79A, Y32A–K79A and K204A mutants, as described in Figure 1C . ( F ) Minireplicon assay of RVFV with the indicated N mutants. Cells were transfected with constructs for RVFV L, a model minigenome expressing a reporter gene, RVFV N, and the indicated N mutants. The reporter values of the minireplicon system reflect the activity of the recombinant RNPs reconstituted from expressed cDNA sequences.

    Techniques Used: RNA Binding Assay, Binding Assay, Microscopy, Transfection, Construct, Expressing, Activity Assay, Recombinant

    36) Product Images from "Characterization of the p22 Subunit of Dynactin Reveals the Localization of Cytoplasmic Dynein and Dynactin to the Midbody of Dividing Cells "

    Article Title: Characterization of the p22 Subunit of Dynactin Reveals the Localization of Cytoplasmic Dynein and Dynactin to the Midbody of Dividing Cells

    Journal: The Journal of Cell Biology

    doi:

    Epifluorescence m icrographs demonstrating immunolocalization of dynein and dynactin to the cleavage furrow and to midbody of dividing cells. A Rat2 cell undergoing cytokinesis is stained for p22 ( a ) and tubulin ( b ). A separate Rat2 cell visualized for both p22 and tubulin staining ( c ). A Ptk2 cell undergoing cytokinesis stained for p22 shows the enrichment of this polypeptide at the cleavage furrow ( d ). Ptk2 cells were double-stained with antitubulin and anti-p22 ( e and f ), anti-p150 Glued ( g and h ), or antidynein heavy chain ( i and j ). Note the prominent localization of both dynein and dynactin at the midbodies revealed by yellow spots. Occasionally, striking rings of p150 Glued around the midbodies were observed ( h , inset ), which seemed to be persistent even after the completion of cytokinesis ( k , arrow ). Bar in c is for a–c ; bar in j is for e–j . Bars, 5 μm.
    Figure Legend Snippet: Epifluorescence m icrographs demonstrating immunolocalization of dynein and dynactin to the cleavage furrow and to midbody of dividing cells. A Rat2 cell undergoing cytokinesis is stained for p22 ( a ) and tubulin ( b ). A separate Rat2 cell visualized for both p22 and tubulin staining ( c ). A Ptk2 cell undergoing cytokinesis stained for p22 shows the enrichment of this polypeptide at the cleavage furrow ( d ). Ptk2 cells were double-stained with antitubulin and anti-p22 ( e and f ), anti-p150 Glued ( g and h ), or antidynein heavy chain ( i and j ). Note the prominent localization of both dynein and dynactin at the midbodies revealed by yellow spots. Occasionally, striking rings of p150 Glued around the midbodies were observed ( h , inset ), which seemed to be persistent even after the completion of cytokinesis ( k , arrow ). Bar in c is for a–c ; bar in j is for e–j . Bars, 5 μm.

    Techniques Used: Staining

    Epifluorescence micrographs of Ptk2 cells overexpressing p22. Ptk2 cells were grown to 75% confluency and transfected with cDNA encoding p22 fused to FLAG epitope at the NH 2 terminus. Cells were fixed in 1 mM EGTA in MeOH and processed for immunocytochemistry. The transfected cells were examined by epifluorescence microscopy using double-label immunocytochemistry with anti-FLAG and anti-p150 Glued ( a and b ), anti-p22 and antidynein intermediate chain antibodies ( c and d ), and anti-p22 and anti-58K antibodies ( e and f ). No clear effects on the distribution of p150 Glued ( a and b ), dynein ( c and d ), or the Golgi apparatus ( e and f ) were observed in p22-overexpressing cells. Bar, 10 μm.
    Figure Legend Snippet: Epifluorescence micrographs of Ptk2 cells overexpressing p22. Ptk2 cells were grown to 75% confluency and transfected with cDNA encoding p22 fused to FLAG epitope at the NH 2 terminus. Cells were fixed in 1 mM EGTA in MeOH and processed for immunocytochemistry. The transfected cells were examined by epifluorescence microscopy using double-label immunocytochemistry with anti-FLAG and anti-p150 Glued ( a and b ), anti-p22 and antidynein intermediate chain antibodies ( c and d ), and anti-p22 and anti-58K antibodies ( e and f ). No clear effects on the distribution of p150 Glued ( a and b ), dynein ( c and d ), or the Golgi apparatus ( e and f ) were observed in p22-overexpressing cells. Bar, 10 μm.

    Techniques Used: Transfection, FLAG-tag, Immunocytochemistry, Epifluorescence Microscopy, Double-label Immunocytochemistry

    37) Product Images from "Dynamin GTPase regulation is altered by PH domain mutations found in centronuclear myopathy patients"

    Article Title: Dynamin GTPase regulation is altered by PH domain mutations found in centronuclear myopathy patients

    Journal: The EMBO Journal

    doi: 10.1038/emboj.2010.187

    Aberrant response of dynamin PH domain variants to stimulation with lipid vesicles. ( A ) GTP hydrolysis by dynamin variants (0.5 μM) was monitored over time in the presence of 0.1 μm extruded lipid vesicles composed of 3% PtdIns(4,5)
    Figure Legend Snippet: Aberrant response of dynamin PH domain variants to stimulation with lipid vesicles. ( A ) GTP hydrolysis by dynamin variants (0.5 μM) was monitored over time in the presence of 0.1 μm extruded lipid vesicles composed of 3% PtdIns(4,5)

    Techniques Used:

    Mutations in the C-terminal α-helix of dynamin's PH domain alter basal GTPase activity. ( A ) Basal rates of GTP hydrolysis by dynamin variants (0.5 μM) were determined as described in Materials and methods. Initial rates from these experiments
    Figure Legend Snippet: Mutations in the C-terminal α-helix of dynamin's PH domain alter basal GTPase activity. ( A ) Basal rates of GTP hydrolysis by dynamin variants (0.5 μM) were determined as described in Materials and methods. Initial rates from these experiments

    Techniques Used: Activity Assay

    Dynamin PH domain mutations alter basal GTPase activity
    Figure Legend Snippet: Dynamin PH domain mutations alter basal GTPase activity

    Techniques Used: Activity Assay

    Basal dynamin GTPase activity correlates with PH domain folding stability. ( A ) Upon unfolding in high concentrations of urea at 37°C, the tryptophan fluorescence emission spectra of purified dynamin PH domain (excitation at 280 nm) is red shifted
    Figure Legend Snippet: Basal dynamin GTPase activity correlates with PH domain folding stability. ( A ) Upon unfolding in high concentrations of urea at 37°C, the tryptophan fluorescence emission spectra of purified dynamin PH domain (excitation at 280 nm) is red shifted

    Techniques Used: Activity Assay, Fluorescence, Purification

    Small-angle X-ray scattering (SAXS) reveals conformational changes associated with PH domain mutations. ( A ) Example scattering data for wild-type and the A618T and S619L PH domain variants (30 μM) in the context of a dimeric dynamin mutant (ΔPRD/I690K/R399A),
    Figure Legend Snippet: Small-angle X-ray scattering (SAXS) reveals conformational changes associated with PH domain mutations. ( A ) Example scattering data for wild-type and the A618T and S619L PH domain variants (30 μM) in the context of a dimeric dynamin mutant (ΔPRD/I690K/R399A),

    Techniques Used: Mutagenesis

    CNM mutations in the α -helix of the dynamin PH domain do not reduce lipid affinity
    Figure Legend Snippet: CNM mutations in the α -helix of the dynamin PH domain do not reduce lipid affinity

    Techniques Used:

    Disease-related mutations in the dynamin PH domain and effects on phosphoinositide binding. ( A ) Dynamin domain architecture is shown (left) as a linear cartoon representation with the location of centronuclear myopathy (CNM) and Charcot–Marie–Tooth
    Figure Legend Snippet: Disease-related mutations in the dynamin PH domain and effects on phosphoinositide binding. ( A ) Dynamin domain architecture is shown (left) as a linear cartoon representation with the location of centronuclear myopathy (CNM) and Charcot–Marie–Tooth

    Techniques Used: Binding Assay

    Hypothetical model of domain organization in SAXS-derived envelopes of a dynamin dimer. ( A ) Two dynamin PH domains (blue−PDB 1DYN) were fit at the two-fold symmetric interface, dynamin GTPase domains (red—PDB 2AKA) were fit at the far
    Figure Legend Snippet: Hypothetical model of domain organization in SAXS-derived envelopes of a dynamin dimer. ( A ) Two dynamin PH domains (blue−PDB 1DYN) were fit at the two-fold symmetric interface, dynamin GTPase domains (red—PDB 2AKA) were fit at the far

    Techniques Used: Derivative Assay

    38) Product Images from "Protein interaction mapping identifies RBBP6 as a negative regulator of Ebola virus replication"

    Article Title: Protein interaction mapping identifies RBBP6 as a negative regulator of Ebola virus replication

    Journal: Cell

    doi: 10.1016/j.cell.2018.08.044

    Interaction between EBOV VP30 and human RBBP6. (A) . (B) Flag-VP30 from Zaire ebolavirus (EBOV), Reston virus (RESTV), Lloviu virus (LLOV) and Marburg virus (MARV) co-immunoprecipitate with HA-RBBP6. (C) A schematic representation of domain organization of RBBP6 isoform 1 and 3 (top). RBBP6 functional domains consists of domain with no name (DWNN), zinc knuckle, ring finger domain, proline and arginine-serine rich domains followed by retinoblastoma (Rb) and p53 binding domains. Bottom panel depicts co-immunoprecipitation of flag-tagged VP30 with transiently expressed HA-RBBP6 isoform 1 or 3. HEK293T cells were transfected with HA-RBBP6 alone or in combination with flag-VP30, as indicated followed by IP with anti-HA. (D) Schematic drawing of RBBP6 truncation mutants used in domain mapping studies (top). Anti-HA IP was performed after co-expression of HA-tagged full-length RBBP6 or different truncations in combination with empty vector or flag-VP30. (E) Immunoprecipitation with anti-HA in cell lysates expressing HA-RBBP6 and flag-tagged RNA binding mutants of VP30. 3RA: R26A/R28A/R40A.
    Figure Legend Snippet: Interaction between EBOV VP30 and human RBBP6. (A) . (B) Flag-VP30 from Zaire ebolavirus (EBOV), Reston virus (RESTV), Lloviu virus (LLOV) and Marburg virus (MARV) co-immunoprecipitate with HA-RBBP6. (C) A schematic representation of domain organization of RBBP6 isoform 1 and 3 (top). RBBP6 functional domains consists of domain with no name (DWNN), zinc knuckle, ring finger domain, proline and arginine-serine rich domains followed by retinoblastoma (Rb) and p53 binding domains. Bottom panel depicts co-immunoprecipitation of flag-tagged VP30 with transiently expressed HA-RBBP6 isoform 1 or 3. HEK293T cells were transfected with HA-RBBP6 alone or in combination with flag-VP30, as indicated followed by IP with anti-HA. (D) Schematic drawing of RBBP6 truncation mutants used in domain mapping studies (top). Anti-HA IP was performed after co-expression of HA-tagged full-length RBBP6 or different truncations in combination with empty vector or flag-VP30. (E) Immunoprecipitation with anti-HA in cell lysates expressing HA-RBBP6 and flag-tagged RNA binding mutants of VP30. 3RA: R26A/R28A/R40A.

    Techniques Used: Functional Assay, Binding Assay, Immunoprecipitation, Transfection, Expressing, Plasmid Preparation, RNA Binding Assay

    39) Product Images from "Functional and Biochemical Characterization of Dib1’s Role in pre-Messenger RNA Splicing"

    Article Title: Functional and Biochemical Characterization of Dib1’s Role in pre-Messenger RNA Splicing

    Journal: Journal of molecular biology

    doi: 10.1016/j.jmb.2018.04.027

    Wild-type Dib1 promotes formation of the splicing machinery beyond B complex. Spliceosome assembly of dibl-F85A (A) and dibl-L76A D78A (B). Splicing extracts were subjected to a variety of conditions prior to incorporation into splicing reactions. The
    Figure Legend Snippet: Wild-type Dib1 promotes formation of the splicing machinery beyond B complex. Spliceosome assembly of dibl-F85A (A) and dibl-L76A D78A (B). Splicing extracts were subjected to a variety of conditions prior to incorporation into splicing reactions. The

    Techniques Used:

    Dib1 mutants disrupts splicing but is rescued by exogenous Dib1. Conditions in the assay are indicated. Heated Ex indicates splicing extract was heated at 37°C prior to the splicing reaction. For samples with ATP, ATP was added to a final concentration
    Figure Legend Snippet: Dib1 mutants disrupts splicing but is rescued by exogenous Dib1. Conditions in the assay are indicated. Heated Ex indicates splicing extract was heated at 37°C prior to the splicing reaction. For samples with ATP, ATP was added to a final concentration

    Techniques Used: Concentration Assay

    Structural Analysis of Recombinant Wild-type Dib1 and Dib1 L76A/D78A. CD spectra of wild-type (blue circles) and L76A/D78A (orange diamonds) Dib1 protein were taken from 195nm to 260nm at 30°C. Spectra for wild-type (green squares) and L76A/D78A
    Figure Legend Snippet: Structural Analysis of Recombinant Wild-type Dib1 and Dib1 L76A/D78A. CD spectra of wild-type (blue circles) and L76A/D78A (orange diamonds) Dib1 protein were taken from 195nm to 260nm at 30°C. Spectra for wild-type (green squares) and L76A/D78A

    Techniques Used: Recombinant

    . B. Growth phenotypes of dib1 mutants. Serial dilutions of S. cerevisae harboring dib1 mutants as
    Figure Legend Snippet: . B. Growth phenotypes of dib1 mutants. Serial dilutions of S. cerevisae harboring dib1 mutants as

    Techniques Used:

    Identification of novel mutants in dib1 that stall growth
    Figure Legend Snippet: Identification of novel mutants in dib1 that stall growth

    Techniques Used:

    ]) Colored are Dib1
    Figure Legend Snippet: ]) Colored are Dib1

    Techniques Used:

    40) Product Images from "Chlamydomonas reinhardtii Has Multiple Prolyl 4-Hydroxylases, One of Which Is Essential for Proper Cell Wall Assembly [W]"

    Article Title: Chlamydomonas reinhardtii Has Multiple Prolyl 4-Hydroxylases, One of Which Is Essential for Proper Cell Wall Assembly [W]

    Journal:

    doi: 10.1105/tpc.106.042739

    Expression and Analysis of Recombinant Cr-P4H-1A and Cr-P4H-1B
    Figure Legend Snippet: Expression and Analysis of Recombinant Cr-P4H-1A and Cr-P4H-1B

    Techniques Used: Expressing, Recombinant

    Expression of Recombinant Cr-P4H-1A and Cr-P4H-1B Polypeptides in Insect Cells or in E. coli and Their Purification.
    Figure Legend Snippet: Expression of Recombinant Cr-P4H-1A and Cr-P4H-1B Polypeptides in Insect Cells or in E. coli and Their Purification.

    Techniques Used: Expressing, Recombinant, Purification

    Related Articles

    Clone Assay:

    Article Title: Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer
    Article Snippet: .. The sequence encoding the Stat3α construct (amino acid 127–770), the Stat3β (amino acid 127–722) and the Stat3βΔCT7 construct (amino acid 127–717) were generated by PCR from original full length Stat3α or Stat3β clones [ ] and cloned into pET15b (Novagen) expression vector and used to transform Escherichia coli strain BL21DE3. .. Protein expression was induced by adding 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) to the bacterial growth at an optical density of 0.6 at 600 nm.

    Article Title: Chlamydomonas reinhardtii Has Multiple Prolyl 4-Hydroxylases, One of Which Is Essential for Proper Cell Wall Assembly [W]
    Article Snippet: .. The PCR primers 5′-GGAATTC CATATG GCGCCTTCAAGCGCCATGAT-3′ ( Nde I site underlined) and 5′-CGC AGATCT TCAATGACGCCCTCCGATGG-3′ or 5′-CGC AGATCT TTAGGTGCACTTCTTGCACGAG ( Bgl II sites underlined) were used to amplify the cDNAs encoding Cr-P4H-1A and Cr-P4H-1B without the signal sequences and with flanking Nde I and Bgl II sites, and the products were cloned into a Nde I -BamH I–digested bacterial expression vector pET15b in frame with an N-terminal His tag (Novagen). .. The expression plasmids were transformed into the E. coli Origami (DE3) strain (Novagen).

    Article Title: Optimization of the Expression of Reteplase in Escherichia coli TOP10 Using Arabinose Promoter
    Article Snippet: .. Materials The pET15b cloning and expression vector were obtained from Novagen Co., USA. .. The pBAD/gIIIA plasmid and bacterial strains E. coli TOP10 and E. coli DH5α were purchased from Pasteur Institute and Cinnagen, Iran, respectively.

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding *Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding * ♦
    Article Snippet: .. For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR. ..

    Article Title: The Human Polyoma JC Virus Agnoprotein Acts as a Viroporin
    Article Snippet: .. The entire coding sequences of VP1 (pET15b-VP1) and agnoprotein (pET15b-His-Agno) were amplified by PCR and cloned into the pET15b expression vector (Novagen, Madison, WI). .. The integrity of vectors were verified by sequencing and transformed into the E. coli BL21 strain (DE3: pLysS) for protein expression (Novagen).

    Amplification:

    Article Title: Calcium/calmodulin-dependent phosphorylation of tumor protein D52 on serine residue 136 may be mediated by CAMK2?6
    Article Snippet: .. His-tagged D52 protein was produced by PCR amplification of rabbit gastric mucosal cell cDNA and bacterial expression in a PET15b expression vector (Novagen, Madison, WI) followed by sequential purification on His-bind nickel chelate resin and Mono Q anion exchange as previously described ( ). .. A cDNA construct for HA-tagged D52 was produced by using the PET15b vector as a template and standard PCR conditions with the following primers: forward, 5′-CCC GAT ATC ATG GGC TAC CCA TAC GAT GTT CCA GAT TAC GCT GAC CGC GGC GAG CAA-3′; reverse complement, 5′-CGC CTC GAG TCA CAG GCC CTC CTG TGT CT-3′.

    Article Title: The Human Polyoma JC Virus Agnoprotein Acts as a Viroporin
    Article Snippet: .. The entire coding sequences of VP1 (pET15b-VP1) and agnoprotein (pET15b-His-Agno) were amplified by PCR and cloned into the pET15b expression vector (Novagen, Madison, WI). .. The integrity of vectors were verified by sequencing and transformed into the E. coli BL21 strain (DE3: pLysS) for protein expression (Novagen).

    Isolation:

    Article Title: Development of a RVFV ELISA that can distinguish infected from vaccinated animals
    Article Snippet: .. Purification of RVFV N and NSs proteins pET20(+)bRVFV NSs, pET20(+)bRVFV N or pET20(+) (empty vector) were transformed into competent BL21 (DE3) E. coli (Novagen) and an isolated colony of each was selected and grown in liquid LB with 100 ug/ml ampicillin until OD600 was between 0.6 and 1.0 then cultures were stored overnight at 4°C. ..

    Sequencing:

    Article Title: Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer
    Article Snippet: .. The sequence encoding the Stat3α construct (amino acid 127–770), the Stat3β (amino acid 127–722) and the Stat3βΔCT7 construct (amino acid 127–717) were generated by PCR from original full length Stat3α or Stat3β clones [ ] and cloned into pET15b (Novagen) expression vector and used to transform Escherichia coli strain BL21DE3. .. Protein expression was induced by adding 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) to the bacterial growth at an optical density of 0.6 at 600 nm.

    Construct:

    Article Title: Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer
    Article Snippet: .. The sequence encoding the Stat3α construct (amino acid 127–770), the Stat3β (amino acid 127–722) and the Stat3βΔCT7 construct (amino acid 127–717) were generated by PCR from original full length Stat3α or Stat3β clones [ ] and cloned into pET15b (Novagen) expression vector and used to transform Escherichia coli strain BL21DE3. .. Protein expression was induced by adding 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) to the bacterial growth at an optical density of 0.6 at 600 nm.

    Purification:

    Article Title: Development of a RVFV ELISA that can distinguish infected from vaccinated animals
    Article Snippet: .. Purification of RVFV N and NSs proteins pET20(+)bRVFV NSs, pET20(+)bRVFV N or pET20(+) (empty vector) were transformed into competent BL21 (DE3) E. coli (Novagen) and an isolated colony of each was selected and grown in liquid LB with 100 ug/ml ampicillin until OD600 was between 0.6 and 1.0 then cultures were stored overnight at 4°C. ..

    Article Title: Crystal Structure Confirmation of JHP933 as a Nucleotidyltransferase Superfamily Protein from Helicobacter pylori Strain J99
    Article Snippet: .. Protein expression, purification, and crystallization The gene encoding the full-length JHP933 from Helicobacter pylori strain J99 (NP_223650, 267 amino acids) was cloned into the modified pET15b vector (Novagen) and over-expressed as selenomethionyl protein in the E. coli strain BL21(DE3) using methionine pathway inhibition at 293 K. Bacterial cells were lysed by ultrasonication on ice in a buffer containing 50 mM Tris (pH 8.0), 300 mM NaCl, 5 mM β-mercaptoethanol, 0.1% Triton-X100 and 5% glycerol. ..

    Article Title: Calcium/calmodulin-dependent phosphorylation of tumor protein D52 on serine residue 136 may be mediated by CAMK2?6
    Article Snippet: .. His-tagged D52 protein was produced by PCR amplification of rabbit gastric mucosal cell cDNA and bacterial expression in a PET15b expression vector (Novagen, Madison, WI) followed by sequential purification on His-bind nickel chelate resin and Mono Q anion exchange as previously described ( ). .. A cDNA construct for HA-tagged D52 was produced by using the PET15b vector as a template and standard PCR conditions with the following primers: forward, 5′-CCC GAT ATC ATG GGC TAC CCA TAC GAT GTT CCA GAT TAC GCT GAC CGC GGC GAG CAA-3′; reverse complement, 5′-CGC CTC GAG TCA CAG GCC CTC CTG TGT CT-3′.

    Protein Purification:

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding *Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding * ♦
    Article Snippet: .. For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR. ..

    Polymerase Chain Reaction:

    Article Title: Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer
    Article Snippet: .. The sequence encoding the Stat3α construct (amino acid 127–770), the Stat3β (amino acid 127–722) and the Stat3βΔCT7 construct (amino acid 127–717) were generated by PCR from original full length Stat3α or Stat3β clones [ ] and cloned into pET15b (Novagen) expression vector and used to transform Escherichia coli strain BL21DE3. .. Protein expression was induced by adding 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) to the bacterial growth at an optical density of 0.6 at 600 nm.

    Article Title: Chlamydomonas reinhardtii Has Multiple Prolyl 4-Hydroxylases, One of Which Is Essential for Proper Cell Wall Assembly [W]
    Article Snippet: .. The PCR primers 5′-GGAATTC CATATG GCGCCTTCAAGCGCCATGAT-3′ ( Nde I site underlined) and 5′-CGC AGATCT TCAATGACGCCCTCCGATGG-3′ or 5′-CGC AGATCT TTAGGTGCACTTCTTGCACGAG ( Bgl II sites underlined) were used to amplify the cDNAs encoding Cr-P4H-1A and Cr-P4H-1B without the signal sequences and with flanking Nde I and Bgl II sites, and the products were cloned into a Nde I -BamH I–digested bacterial expression vector pET15b in frame with an N-terminal His tag (Novagen). .. The expression plasmids were transformed into the E. coli Origami (DE3) strain (Novagen).

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding *Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding * ♦
    Article Snippet: .. For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR. ..

    Article Title: Calcium/calmodulin-dependent phosphorylation of tumor protein D52 on serine residue 136 may be mediated by CAMK2?6
    Article Snippet: .. His-tagged D52 protein was produced by PCR amplification of rabbit gastric mucosal cell cDNA and bacterial expression in a PET15b expression vector (Novagen, Madison, WI) followed by sequential purification on His-bind nickel chelate resin and Mono Q anion exchange as previously described ( ). .. A cDNA construct for HA-tagged D52 was produced by using the PET15b vector as a template and standard PCR conditions with the following primers: forward, 5′-CCC GAT ATC ATG GGC TAC CCA TAC GAT GTT CCA GAT TAC GCT GAC CGC GGC GAG CAA-3′; reverse complement, 5′-CGC CTC GAG TCA CAG GCC CTC CTG TGT CT-3′.

    Article Title: The Human Polyoma JC Virus Agnoprotein Acts as a Viroporin
    Article Snippet: .. The entire coding sequences of VP1 (pET15b-VP1) and agnoprotein (pET15b-His-Agno) were amplified by PCR and cloned into the pET15b expression vector (Novagen, Madison, WI). .. The integrity of vectors were verified by sequencing and transformed into the E. coli BL21 strain (DE3: pLysS) for protein expression (Novagen).

    Generated:

    Article Title: Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer
    Article Snippet: .. The sequence encoding the Stat3α construct (amino acid 127–770), the Stat3β (amino acid 127–722) and the Stat3βΔCT7 construct (amino acid 127–717) were generated by PCR from original full length Stat3α or Stat3β clones [ ] and cloned into pET15b (Novagen) expression vector and used to transform Escherichia coli strain BL21DE3. .. Protein expression was induced by adding 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) to the bacterial growth at an optical density of 0.6 at 600 nm.

    Inhibition:

    Article Title: Crystal Structure Confirmation of JHP933 as a Nucleotidyltransferase Superfamily Protein from Helicobacter pylori Strain J99
    Article Snippet: .. Protein expression, purification, and crystallization The gene encoding the full-length JHP933 from Helicobacter pylori strain J99 (NP_223650, 267 amino acids) was cloned into the modified pET15b vector (Novagen) and over-expressed as selenomethionyl protein in the E. coli strain BL21(DE3) using methionine pathway inhibition at 293 K. Bacterial cells were lysed by ultrasonication on ice in a buffer containing 50 mM Tris (pH 8.0), 300 mM NaCl, 5 mM β-mercaptoethanol, 0.1% Triton-X100 and 5% glycerol. ..

    Expressing:

    Article Title: Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer
    Article Snippet: .. The sequence encoding the Stat3α construct (amino acid 127–770), the Stat3β (amino acid 127–722) and the Stat3βΔCT7 construct (amino acid 127–717) were generated by PCR from original full length Stat3α or Stat3β clones [ ] and cloned into pET15b (Novagen) expression vector and used to transform Escherichia coli strain BL21DE3. .. Protein expression was induced by adding 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) to the bacterial growth at an optical density of 0.6 at 600 nm.

    Article Title: Chlamydomonas reinhardtii Has Multiple Prolyl 4-Hydroxylases, One of Which Is Essential for Proper Cell Wall Assembly [W]
    Article Snippet: .. The PCR primers 5′-GGAATTC CATATG GCGCCTTCAAGCGCCATGAT-3′ ( Nde I site underlined) and 5′-CGC AGATCT TCAATGACGCCCTCCGATGG-3′ or 5′-CGC AGATCT TTAGGTGCACTTCTTGCACGAG ( Bgl II sites underlined) were used to amplify the cDNAs encoding Cr-P4H-1A and Cr-P4H-1B without the signal sequences and with flanking Nde I and Bgl II sites, and the products were cloned into a Nde I -BamH I–digested bacterial expression vector pET15b in frame with an N-terminal His tag (Novagen). .. The expression plasmids were transformed into the E. coli Origami (DE3) strain (Novagen).

    Article Title: Optimization of the Expression of Reteplase in Escherichia coli TOP10 Using Arabinose Promoter
    Article Snippet: .. Materials The pET15b cloning and expression vector were obtained from Novagen Co., USA. .. The pBAD/gIIIA plasmid and bacterial strains E. coli TOP10 and E. coli DH5α were purchased from Pasteur Institute and Cinnagen, Iran, respectively.

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding *Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding * ♦
    Article Snippet: .. For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR. ..

    Article Title: Calcium/calmodulin-dependent phosphorylation of tumor protein D52 on serine residue 136 may be mediated by CAMK2?6
    Article Snippet: .. His-tagged D52 protein was produced by PCR amplification of rabbit gastric mucosal cell cDNA and bacterial expression in a PET15b expression vector (Novagen, Madison, WI) followed by sequential purification on His-bind nickel chelate resin and Mono Q anion exchange as previously described ( ). .. A cDNA construct for HA-tagged D52 was produced by using the PET15b vector as a template and standard PCR conditions with the following primers: forward, 5′-CCC GAT ATC ATG GGC TAC CCA TAC GAT GTT CCA GAT TAC GCT GAC CGC GGC GAG CAA-3′; reverse complement, 5′-CGC CTC GAG TCA CAG GCC CTC CTG TGT CT-3′.

    Article Title: The Human Polyoma JC Virus Agnoprotein Acts as a Viroporin
    Article Snippet: .. The entire coding sequences of VP1 (pET15b-VP1) and agnoprotein (pET15b-His-Agno) were amplified by PCR and cloned into the pET15b expression vector (Novagen, Madison, WI). .. The integrity of vectors were verified by sequencing and transformed into the E. coli BL21 strain (DE3: pLysS) for protein expression (Novagen).

    Modification:

    Article Title: Crystal Structure Confirmation of JHP933 as a Nucleotidyltransferase Superfamily Protein from Helicobacter pylori Strain J99
    Article Snippet: .. Protein expression, purification, and crystallization The gene encoding the full-length JHP933 from Helicobacter pylori strain J99 (NP_223650, 267 amino acids) was cloned into the modified pET15b vector (Novagen) and over-expressed as selenomethionyl protein in the E. coli strain BL21(DE3) using methionine pathway inhibition at 293 K. Bacterial cells were lysed by ultrasonication on ice in a buffer containing 50 mM Tris (pH 8.0), 300 mM NaCl, 5 mM β-mercaptoethanol, 0.1% Triton-X100 and 5% glycerol. ..

    Produced:

    Article Title: Calcium/calmodulin-dependent phosphorylation of tumor protein D52 on serine residue 136 may be mediated by CAMK2?6
    Article Snippet: .. His-tagged D52 protein was produced by PCR amplification of rabbit gastric mucosal cell cDNA and bacterial expression in a PET15b expression vector (Novagen, Madison, WI) followed by sequential purification on His-bind nickel chelate resin and Mono Q anion exchange as previously described ( ). .. A cDNA construct for HA-tagged D52 was produced by using the PET15b vector as a template and standard PCR conditions with the following primers: forward, 5′-CCC GAT ATC ATG GGC TAC CCA TAC GAT GTT CCA GAT TAC GCT GAC CGC GGC GAG CAA-3′; reverse complement, 5′-CGC CTC GAG TCA CAG GCC CTC CTG TGT CT-3′.

    Transformation Assay:

    Article Title: Development of a RVFV ELISA that can distinguish infected from vaccinated animals
    Article Snippet: .. Purification of RVFV N and NSs proteins pET20(+)bRVFV NSs, pET20(+)bRVFV N or pET20(+) (empty vector) were transformed into competent BL21 (DE3) E. coli (Novagen) and an isolated colony of each was selected and grown in liquid LB with 100 ug/ml ampicillin until OD600 was between 0.6 and 1.0 then cultures were stored overnight at 4°C. ..

    Recombinant:

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding *Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding * ♦
    Article Snippet: .. For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR. ..

    Crystallization Assay:

    Article Title: Crystal Structure Confirmation of JHP933 as a Nucleotidyltransferase Superfamily Protein from Helicobacter pylori Strain J99
    Article Snippet: .. Protein expression, purification, and crystallization The gene encoding the full-length JHP933 from Helicobacter pylori strain J99 (NP_223650, 267 amino acids) was cloned into the modified pET15b vector (Novagen) and over-expressed as selenomethionyl protein in the E. coli strain BL21(DE3) using methionine pathway inhibition at 293 K. Bacterial cells were lysed by ultrasonication on ice in a buffer containing 50 mM Tris (pH 8.0), 300 mM NaCl, 5 mM β-mercaptoethanol, 0.1% Triton-X100 and 5% glycerol. ..

    Plasmid Preparation:

    Article Title: Monoclonal Antibodies Specific for STAT3β Reveal Its Contribution to Constitutive STAT3 Phosphorylation in Breast Cancer
    Article Snippet: .. The sequence encoding the Stat3α construct (amino acid 127–770), the Stat3β (amino acid 127–722) and the Stat3βΔCT7 construct (amino acid 127–717) were generated by PCR from original full length Stat3α or Stat3β clones [ ] and cloned into pET15b (Novagen) expression vector and used to transform Escherichia coli strain BL21DE3. .. Protein expression was induced by adding 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) to the bacterial growth at an optical density of 0.6 at 600 nm.

    Article Title: Chlamydomonas reinhardtii Has Multiple Prolyl 4-Hydroxylases, One of Which Is Essential for Proper Cell Wall Assembly [W]
    Article Snippet: .. The PCR primers 5′-GGAATTC CATATG GCGCCTTCAAGCGCCATGAT-3′ ( Nde I site underlined) and 5′-CGC AGATCT TCAATGACGCCCTCCGATGG-3′ or 5′-CGC AGATCT TTAGGTGCACTTCTTGCACGAG ( Bgl II sites underlined) were used to amplify the cDNAs encoding Cr-P4H-1A and Cr-P4H-1B without the signal sequences and with flanking Nde I and Bgl II sites, and the products were cloned into a Nde I -BamH I–digested bacterial expression vector pET15b in frame with an N-terminal His tag (Novagen). .. The expression plasmids were transformed into the E. coli Origami (DE3) strain (Novagen).

    Article Title: Development of a RVFV ELISA that can distinguish infected from vaccinated animals
    Article Snippet: .. Purification of RVFV N and NSs proteins pET20(+)bRVFV NSs, pET20(+)bRVFV N or pET20(+) (empty vector) were transformed into competent BL21 (DE3) E. coli (Novagen) and an isolated colony of each was selected and grown in liquid LB with 100 ug/ml ampicillin until OD600 was between 0.6 and 1.0 then cultures were stored overnight at 4°C. ..

    Article Title: Optimization of the Expression of Reteplase in Escherichia coli TOP10 Using Arabinose Promoter
    Article Snippet: .. Materials The pET15b cloning and expression vector were obtained from Novagen Co., USA. .. The pBAD/gIIIA plasmid and bacterial strains E. coli TOP10 and E. coli DH5α were purchased from Pasteur Institute and Cinnagen, Iran, respectively.

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding *Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding * ♦
    Article Snippet: .. For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR. ..

    Article Title: Calcium/calmodulin-dependent phosphorylation of tumor protein D52 on serine residue 136 may be mediated by CAMK2?6
    Article Snippet: .. His-tagged D52 protein was produced by PCR amplification of rabbit gastric mucosal cell cDNA and bacterial expression in a PET15b expression vector (Novagen, Madison, WI) followed by sequential purification on His-bind nickel chelate resin and Mono Q anion exchange as previously described ( ). .. A cDNA construct for HA-tagged D52 was produced by using the PET15b vector as a template and standard PCR conditions with the following primers: forward, 5′-CCC GAT ATC ATG GGC TAC CCA TAC GAT GTT CCA GAT TAC GCT GAC CGC GGC GAG CAA-3′; reverse complement, 5′-CGC CTC GAG TCA CAG GCC CTC CTG TGT CT-3′.

    Article Title: The Human Polyoma JC Virus Agnoprotein Acts as a Viroporin
    Article Snippet: .. The entire coding sequences of VP1 (pET15b-VP1) and agnoprotein (pET15b-His-Agno) were amplified by PCR and cloned into the pET15b expression vector (Novagen, Madison, WI). .. The integrity of vectors were verified by sequencing and transformed into the E. coli BL21 strain (DE3: pLysS) for protein expression (Novagen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Millipore expression vector pet15b
    Expression Vector Pet15b, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expression vector pet15b/product/Millipore
    Average 92 stars, based on 94 article reviews
    Price from $9.99 to $1999.99
    expression vector pet15b - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    88
    Millipore pet15b bacterial expression vector
    Pet15b Bacterial Expression Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pet15b bacterial expression vector/product/Millipore
    Average 88 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    pet15b bacterial expression vector - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    Image Search Results