bacterial expression vector pet15b  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    Millipore bacterial expression vector pet15b
    Construction of plasmids and purification of M2 proteins. (A) The synthetic M2eC or 3M2eC genes without hydrophobic region (amino acids 26–55) from PR8 virus were cloned into <t>pET15b</t> vector (B). The recombinant proteins expressed in E. coli were purified by His-tag affinity chromatography and detected by Western blot using M2e-specific monoclonal Ab, 14C2.
    Bacterial Expression Vector Pet15b, supplied by Millipore, used in various techniques. Bioz Stars score: 97/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial expression vector pet15b/product/Millipore
    Average 97 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    bacterial expression vector pet15b - by Bioz Stars, 2020-01
    97/100 stars

    Images

    1) Product Images from "Sublingual Immunization with M2-Based Vaccine Induces Broad Protective Immunity against Influenza"

    Article Title: Sublingual Immunization with M2-Based Vaccine Induces Broad Protective Immunity against Influenza

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027953

    Construction of plasmids and purification of M2 proteins. (A) The synthetic M2eC or 3M2eC genes without hydrophobic region (amino acids 26–55) from PR8 virus were cloned into pET15b vector (B). The recombinant proteins expressed in E. coli were purified by His-tag affinity chromatography and detected by Western blot using M2e-specific monoclonal Ab, 14C2.
    Figure Legend Snippet: Construction of plasmids and purification of M2 proteins. (A) The synthetic M2eC or 3M2eC genes without hydrophobic region (amino acids 26–55) from PR8 virus were cloned into pET15b vector (B). The recombinant proteins expressed in E. coli were purified by His-tag affinity chromatography and detected by Western blot using M2e-specific monoclonal Ab, 14C2.

    Techniques Used: Purification, Clone Assay, Plasmid Preparation, Recombinant, Affinity Chromatography, Western Blot

    Related Articles

    Clone Assay:

    Article Title: Structure of acid deoxyribonuclease
    Article Snippet: One clone with the expected B. thailandensis DNase II sequence was selected for sub-cloning purposes. .. After digestion of pGEM-T Easy plasmid with Nco I and Xho I, the excised fragments were separated and purified as above and sub-cloned into the bacterial expression vector pET15b (Novagen, San Diego, CA, USA) using the vector's Nco I and Xho I cloning sites. .. The recombinant plasmid was transformed into BL21 (DE3) pLysS Escherichia coli competent cells (Novagen, San Diego, CA, USA).

    Article Title: Toxoplasma DJ-1 Regulates Organelle Secretion by a Direct Interaction with Calcium-Dependent Protein Kinase 1
    Article Snippet: The Toxoplasma gondii DJ-1 gene (TgDJ-1) ( ) was PCR amplified using primers that introduced a 5′ NdeI restriction site and a 3′ BamHI site. .. The amplified insertion was digested with NdeI and BamHI and cloned between these restriction sites in the bacterial expression vector pET15b (Novagen). .. The C104S and C127S point mutations were made using standard site-directed mutagenesis with mutagenic primers.

    Article Title: Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters
    Article Snippet: All constructs were prepared using an HSET cDNA corresponding to Gen Bank Accession Number BC121041. .. For motor domain (amino acids 305–673)-containing constructs, plasmids were prepared in the baculovirus vector pFASTBAC-HTa (Life Technologies) for use with the insect cell expression system, whereas all noncatalytic constructs (i.e., containing only the tail and stalk) were cloned into the bacterial expression vector pET15b (Novagen). .. Amino acid sequences of the tail, stalk, and motor domains of HSET/KIFC1 (Homo sapiens kinesin-14) were determined by sequence alignment to Ncd (Drosophila melanogaster kinesin-14) using as a guide, and used to design pET15b-HTa-EGFP-HSETΔMotor and pFASTBAC-HTa-EGFP-HSETΔTail.

    Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration
    Article Snippet: cDNAs corresponding to Arl4A/C/D and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA), which was also used for expressing untagged Arl4C. .. The cDNAs were also subcloned into the mammalian expression vector pcDNA 3.1 (Invitrogen) or the bacterial expression vector pET15b (Novagen, Madison, WI) and pBTM116 to obtain myc-tagged, His-tagged, or LexA-tagged Arl4 A/C/D and their various mutants. pcDNA 3.1 harboring FLNa-myc was provided by Jeffrey J.Y.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: Paragraph title: Cloning and expression of EqCXCL16 in Escherichia coli . ... The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    Article Title:
    Article Snippet: However, the effect of such dimerization-disrupting mutations on the biological activity of S100A4 is presently unknown. .. Wild type S100A4 cDNA was cloned into the NdeI/BamHI sites of bacterial expression vector pET15b (Novagen) and recombinant protein produced in Escherichia coli C41 ( ). .. The fraction containing the S100A4 recombinant protein was dialyzed against phosphate-buffered saline (PBS), and the purity of the S100A4 was checked by SDS-15% (w/v) polyacrylamide gel electrophoresis.

    Article Title: Functional convergence of structurally distinct thioesterases from cyanobacteria and plants involved in phylloquinone biosynthesis
    Article Snippet: The structural relationship between the 4-HBTs and DHNATs confirms a previous phylogenetic analysis (Widhalm et al. , 2012 ) suggesting that the division between these two clades of hotdog-fold thioesterases preceded the evolution of the stringent substrate specificity of these enzymes. .. The genes for Slr0204 and AtDHNAT1 were cloned from their respective organisms into the bacterial expression vector pET15b (Novagen) between the Nde I and Xho I restriction sites. .. These constructs produce recombinant proteins bearing an N-terminal hexahistidine tag that can be removed by cleavage with thrombin, leaving the residual sequence GSH– at the N-termini of the mature proteins.

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding
    Article Snippet: C-terminally c-Myc-tagged human PhLP1 in pcDNA3.1/Myc-His B vector was described previously ( ). .. For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR. .. The integrity of all constructs was confirmed by sequence analysis.

    Article Title: Evolution of New Enzymatic Function by Structural Modulation of Cysteine Reactivity in Pseudomonas fluorescen
    Article Snippet: The coding sequence for ICH was PCR-amplified from the genomic DNA of P. fluorescens Migula strain Pf-5 (American Type Culture Collection number BAA-477D) using primers that incorporated a 5′ NdeI restriction site and a 3′ XhoI restriction site. .. The ICH gene was cloned between the NdeI and XhoI restriction sites of the bacterial expression vector pET15b (Novagen, Darmstadt, Germany) such that the expressed protein carries an N-terminal, thrombin-cleavable hexahistidine tag. .. After thrombin cleavage, the final recombinant ICH protein has three vector-derived amino acids at the N terminus (GSH), resulting in a 231-amino acid protein with a calculated molecular mass of 24,158 Da.

    Article Title: Identification of Novel Small Molecule Inhibitors of 4-diphosphocytidyl-2-C-methyl-D-erythritol (CDP-ME) kinase of Gram-negative bacteria
    Article Snippet: Paragraph title: Cloning, over-expression and purification of recombinant E. coli and Y. pestis CDP-ME kinases ... The PCR products were sub-cloned into the bacterial expression vector pET15b ( Novagen ).

    Article Title: Folded or Not? Tracking Bet v 1 Conformation in Recombinant Allergen Preparations
    Article Snippet: Serum from a non-allergic subject was used as negative control for the specific IgE measurements. .. The open reading frame of Bet v 1a optimized for codon usage of Escherichia coli was purchased from Geneart (Life Technologies, Thermo Fisher Scientific, Waltham, MA, U.S.A.) and cloned into bacterial expression vector pET15b (Novagen, Merck, Darmstadt, Germany) using the Clontech InFusion Kit (Mountain View, CA, U.S.A.). .. Bet v 1a variant rBet v 1aS112P/R145P was generated with the QuickChange Multi Lighting mutagenesis kit (Agilent Technologies, Inc., Santa Clara, CA, U.S.A.) using the Bet v 1a ORF in pET15b_Bet v 1a as DNA template and two mutagenic primers Bet v 1S112P (acaccggatggtggtcccattctgaaaattagc) and Bet v 1R145P (ggtgaaaccctgctgcctgcagttgaaagctat) according to manufacturer’s instructions.

    Article Title:
    Article Snippet: For expression as GST-fusion protein in Escherichia coli and N-terminal FLAG-fusion protein in mammalian cells, ARNO was cloned into pGEX-4T (GE Healthcare) and pCMV-Tag2 (Stratagene) vectors, respectively. .. For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI).

    Article Title: Identification of functionally relevant histidine residues in the apoptotic nuclease CAD
    Article Snippet: Paragraph title: cDNA cloning ... The coding region for hICAD-L (DFF45) was inserted in-frame as an Nco I– Sal I fragment into the Nco I and Xho I sites of the bacterial expression vector pET15b (Novagen).

    Centrifugation:

    Article Title:
    Article Snippet: Wild type S100A4 cDNA was cloned into the NdeI/BamHI sites of bacterial expression vector pET15b (Novagen) and recombinant protein produced in Escherichia coli C41 ( ). .. To remove the His tag, the purified protein was incubated with 100 units/ml thrombin and immobilized on Affi-10 resin (Bio-Rad) for > 12 h with shaking.

    Article Title: Functional convergence of structurally distinct thioesterases from cyanobacteria and plants involved in phylloquinone biosynthesis
    Article Snippet: The genes for Slr0204 and AtDHNAT1 were cloned from their respective organisms into the bacterial expression vector pET15b (Novagen) between the Nde I and Xho I restriction sites. .. The genes for Slr0204 and AtDHNAT1 were cloned from their respective organisms into the bacterial expression vector pET15b (Novagen) between the Nde I and Xho I restriction sites.

    Article Title: Identification of Novel Small Molecule Inhibitors of 4-diphosphocytidyl-2-C-methyl-D-erythritol (CDP-ME) kinase of Gram-negative bacteria
    Article Snippet: The PCR products were sub-cloned into the bacterial expression vector pET15b ( Novagen ). .. Induction of enzyme production was achieved by adding isopropyl β-D-1-thiogalactopyranoside (IPTG) at a final concentration of 1mM to the bacterial cell culture upon reaching OD600 = 0.6 at 37°C.

    Article Title: Folded or Not? Tracking Bet v 1 Conformation in Recombinant Allergen Preparations
    Article Snippet: The open reading frame of Bet v 1a optimized for codon usage of Escherichia coli was purchased from Geneart (Life Technologies, Thermo Fisher Scientific, Waltham, MA, U.S.A.) and cloned into bacterial expression vector pET15b (Novagen, Merck, Darmstadt, Germany) using the Clontech InFusion Kit (Mountain View, CA, U.S.A.). .. A final concentration of 1 mM IPTG was added to induce protein expression.

    Amplification:

    Article Title: Structure of acid deoxyribonuclease
    Article Snippet: Nco I and Xho I restriction sites (in bold font) were added to the end of the amplified products, at 5΄ and 3΄, respectively, for sub-cloning purposes. .. After digestion of pGEM-T Easy plasmid with Nco I and Xho I, the excised fragments were separated and purified as above and sub-cloned into the bacterial expression vector pET15b (Novagen, San Diego, CA, USA) using the vector's Nco I and Xho I cloning sites.

    Article Title: Toxoplasma DJ-1 Regulates Organelle Secretion by a Direct Interaction with Calcium-Dependent Protein Kinase 1
    Article Snippet: The Toxoplasma gondii DJ-1 gene (TgDJ-1) ( ) was PCR amplified using primers that introduced a 5′ NdeI restriction site and a 3′ BamHI site. .. The amplified insertion was digested with NdeI and BamHI and cloned between these restriction sites in the bacterial expression vector pET15b (Novagen). .. The C104S and C127S point mutations were made using standard site-directed mutagenesis with mutagenic primers.

    Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration
    Article Snippet: The cDNAs were also subcloned into the mammalian expression vector pcDNA 3.1 (Invitrogen) or the bacterial expression vector pET15b (Novagen, Madison, WI) and pBTM116 to obtain myc-tagged, His-tagged, or LexA-tagged Arl4 A/C/D and their various mutants. pcDNA 3.1 harboring FLNa-myc was provided by Jeffrey J.Y. .. The cDNAs were also subcloned into the mammalian expression vector pcDNA 3.1 (Invitrogen) or the bacterial expression vector pET15b (Novagen, Madison, WI) and pBTM116 to obtain myc-tagged, His-tagged, or LexA-tagged Arl4 A/C/D and their various mutants. pcDNA 3.1 harboring FLNa-myc was provided by Jeffrey J.Y.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    Article Title: Dynamin GTPase regulation is altered by PH domain mutations found in centronuclear myopathy patients
    Article Snippet: In this context, inappropriate regulation of dynamin's GTPase activity could lead to aberrant nuclear positioning. .. Full-length dynamin constructs were amplified from either pUHD10-3 Dyn1 (human dynamin-1 ba; ) or pCR3.1 (rat dynamin-2 isoforms aa, ab, ba, and bb—gift of M McNiven; ) with 5′ Nde I and 3′ Bam HI restriction sites and subcloned into the bacterial expression vector pET15b (Novagen). .. Resulting dynamin constructs have the N-terminal sequence NH3 + -MGSS(H)6 SSGLVPRGSH preceding the dynamin start methionine.

    Article Title:
    Article Snippet: ARNO and its deletion mutant cDNA sequences were amplified by polymerase chain reaction (PCR) by using ARNO/pACT2 plasmid as a template (obtained from yeast two-hybrid screen) and oligonucleotide primers incorporating restriction sites. .. For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI).

    Article Title: INVOLVEMENT OF ENDOPLASMIC RETICULUM STRESS IN A NOVEL CLASSIC GALACTOSEMIA MODEL
    Article Snippet: Each sample was repeated three times and the mean value and standard deviation were calculated. .. Human inositol monophosphatase I (hIMPaseI) cDNA clone was purchased from Open Biosystems. cDNA was amplified by PCR and subcloned into the bacterial expression vector pET15b (Novagen). .. The hIMPase was over-expressed in Escherichia coli strain BL21(DE3) (Novagen) and purified using nickel-affinity chromatography (Ni-NTA, Qiagen, #1004493).

    Article Title: Identification of Phosphorylation Sites on Phosducin-like Protein by QTOF Mass Spectrometry
    Article Snippet: The product was cut with EcoRI and XbaI restriction endonucleases and was inserted into the pcDNA3.1/myc-HisB vector at the EcoRI and XbaI sites, generating an hPhLP construct with a c-myc epitope tag and a hexahistidine purification tag. .. The hPhLP-myc-His construct was then subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) by polymerase chain reaction amplification with the forward primer 5′–AA CCA ATC ATG ACC ACC CTT GAT GAT AAG TTG C and the reverse primer 5′- A CCA GGA TCC TCA ATG GTG ATG GTG ATG ATG ACC. .. The product was cut with PagI and BamHI restriction endonucleases and inserted into the pET15b vector at the NcoI and BamHI restriction sites.

    Article Title: Identification of functionally relevant histidine residues in the apoptotic nuclease CAD
    Article Snippet: To isolate the cDNA for human ICAD-L/DFF45 (hICAD-L), total RNA was extracted from HeLa cells with a RNeasy Mini Kit (Qiagen) and used for first-strand cDNA synthesis and subsequent amplification of the hICAD-L gene with the Access RT–PCR system (Promega). .. The coding region for hICAD-L (DFF45) was inserted in-frame as an Nco I– Sal I fragment into the Nco I and Xho I sites of the bacterial expression vector pET15b (Novagen).

    Recovery:

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    DNA Ligation:

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. The resultant plasmid construct (p15-16A) was used to transform E. coli NovaBlue (EMD Millipore Novagen, Temecula, CA) using a TransformAid kit (Thermo Scientific, Rockford, IL).

    Synthesized:

    Article Title: Sublingual Immunization with M2-Based Vaccine Induces Broad Protective Immunity against Influenza
    Article Snippet: A gene ( ) encoding three tandem copies of M2e conjugated to C-terminus sequence of M2 protein without residues 26–55 from influenza A/Puerto Rico/8/34 (H1N1) virus was chemically synthesized by Bio S & T Inc. (Canada). .. For the plasmid expressing 3M2eC, the gene was digested with Xho I and BamH I and inserted into the bacterial expression vector pET15b (Novagen, Madison, WI) to express as a fusion of his-tag at the N terminus, resulting in the plasmid pET15b-3M2eC.

    Article Title:
    Article Snippet: For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI). .. ARF6 and ARL4D were cloned into the expression vector pET43a (Novagen). pACYC177/ET3d/yNMT, which encodes yeast ( Saccharomyces cerevisiae ) N -myristoyltransferase ( ) was used to myristoylate ARF6 and ARL4D in Escherichia coli .

    Construct:

    Article Title: Toxoplasma DJ-1 Regulates Organelle Secretion by a Direct Interaction with Calcium-Dependent Protein Kinase 1
    Article Snippet: The amplified insertion was digested with NdeI and BamHI and cloned between these restriction sites in the bacterial expression vector pET15b (Novagen). .. The C104S and C127S point mutations were made using standard site-directed mutagenesis with mutagenic primers.

    Article Title: Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters
    Article Snippet: All constructs were prepared using an HSET cDNA corresponding to Gen Bank Accession Number BC121041. .. For motor domain (amino acids 305–673)-containing constructs, plasmids were prepared in the baculovirus vector pFASTBAC-HTa (Life Technologies) for use with the insect cell expression system, whereas all noncatalytic constructs (i.e., containing only the tail and stalk) were cloned into the bacterial expression vector pET15b (Novagen). .. Amino acid sequences of the tail, stalk, and motor domains of HSET/KIFC1 (Homo sapiens kinesin-14) were determined by sequence alignment to Ncd (Drosophila melanogaster kinesin-14) using as a guide, and used to design pET15b-HTa-EGFP-HSETΔMotor and pFASTBAC-HTa-EGFP-HSETΔTail.

    Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration
    Article Snippet: The cDNAs were also subcloned into the mammalian expression vector pcDNA 3.1 (Invitrogen) or the bacterial expression vector pET15b (Novagen, Madison, WI) and pBTM116 to obtain myc-tagged, His-tagged, or LexA-tagged Arl4 A/C/D and their various mutants. pcDNA 3.1 harboring FLNa-myc was provided by Jeffrey J.Y. .. The PCR products were cloned into pACT2, pGEX, and pcDNA 3.0 vectors for transfection.

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding
    Article Snippet: Paragraph title: Preparation of cDNA Constructs ... For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR.

    Article Title: Evolution of New Enzymatic Function by Structural Modulation of Cysteine Reactivity in Pseudomonas fluorescen
    Article Snippet: The ICH gene was cloned between the NdeI and XhoI restriction sites of the bacterial expression vector pET15b (Novagen, Darmstadt, Germany) such that the expressed protein carries an N-terminal, thrombin-cleavable hexahistidine tag. .. All point mutations (D17V, D17N, D17E, C101S, C101A, T102S, and T102V) were generated by site-directed mutagenesis using Pfu Turbo DNA Polymerase (Stratagene, La Jolla, CA) and appropriate mutagenic primers.

    Article Title: Dynamin GTPase regulation is altered by PH domain mutations found in centronuclear myopathy patients
    Article Snippet: In this context, inappropriate regulation of dynamin's GTPase activity could lead to aberrant nuclear positioning. .. Full-length dynamin constructs were amplified from either pUHD10-3 Dyn1 (human dynamin-1 ba; ) or pCR3.1 (rat dynamin-2 isoforms aa, ab, ba, and bb—gift of M McNiven; ) with 5′ Nde I and 3′ Bam HI restriction sites and subcloned into the bacterial expression vector pET15b (Novagen). .. Resulting dynamin constructs have the N-terminal sequence NH3 + -MGSS(H)6 SSGLVPRGSH preceding the dynamin start methionine.

    Article Title:
    Article Snippet: These constructs were subcloned in pACT2 for yeast two-hybrid assay. .. For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI).

    Article Title: Identification of Phosphorylation Sites on Phosducin-like Protein by QTOF Mass Spectrometry
    Article Snippet: The product was cut with EcoRI and XbaI restriction endonucleases and was inserted into the pcDNA3.1/myc-HisB vector at the EcoRI and XbaI sites, generating an hPhLP construct with a c-myc epitope tag and a hexahistidine purification tag. .. The hPhLP-myc-His construct was then subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) by polymerase chain reaction amplification with the forward primer 5′–AA CCA ATC ATG ACC ACC CTT GAT GAT AAG TTG C and the reverse primer 5′- A CCA GGA TCC TCA ATG GTG ATG GTG ATG ATG ACC. .. The product was cut with PagI and BamHI restriction endonucleases and inserted into the pET15b vector at the NcoI and BamHI restriction sites.

    IA:

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The cDNA amplification was carried out according to a standard laboratory PCR protocol using forward primer cx16-15F (5′-GCG CTCGAG GCGTTGCTGACTCTGCAAGG-3′) and reverse primer cx16-15R (5′-GC GGATCC GCACTGCCACTGTAACTGAT-3′) (IDT, Coralville, IA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    Incubation:

    Article Title:
    Article Snippet: Wild type S100A4 cDNA was cloned into the NdeI/BamHI sites of bacterial expression vector pET15b (Novagen) and recombinant protein produced in Escherichia coli C41 ( ). .. The fraction containing the S100A4 recombinant protein was dialyzed against phosphate-buffered saline (PBS), and the purity of the S100A4 was checked by SDS-15% (w/v) polyacrylamide gel electrophoresis.

    Article Title: Functional convergence of structurally distinct thioesterases from cyanobacteria and plants involved in phylloquinone biosynthesis
    Article Snippet: The genes for Slr0204 and AtDHNAT1 were cloned from their respective organisms into the bacterial expression vector pET15b (Novagen) between the Nde I and Xho I restriction sites. .. The genes for Slr0204 and AtDHNAT1 were cloned from their respective organisms into the bacterial expression vector pET15b (Novagen) between the Nde I and Xho I restriction sites.

    Article Title: Akt Plays a Critical Role in Replication of Nonsegmented Negative-Stranded RNA Viruses
    Article Snippet: Recombinant PIV5 P protein with a hexahistidine tag at the N terminus was generated by subcloning the P gene into the bacterial expression vector pET15b (Novagen) and transforming this plasmid into BL21(DE3)/pLysS cells. .. P protein expression was induced with isopropyl-β- d -thiogalactopyranoside (IPTG) after overnight culture, and His-P was purified from cell lysates using a His-Resin (Novagen) column by following the manufacturer's protocol as described previously ( ).

    Activity Assay:

    Article Title: INVOLVEMENT OF ENDOPLASMIC RETICULUM STRESS IN A NOVEL CLASSIC GALACTOSEMIA MODEL
    Article Snippet: Human inositol monophosphatase I (hIMPaseI) cDNA clone was purchased from Open Biosystems. cDNA was amplified by PCR and subcloned into the bacterial expression vector pET15b (Novagen). .. The hIMPase was over-expressed in Escherichia coli strain BL21(DE3) (Novagen) and purified using nickel-affinity chromatography (Ni-NTA, Qiagen, #1004493).

    Introduce:

    Article Title:
    Article Snippet: To introduce site-specific mutations in ARNO, a two-step recombinant PCR procedure was used. .. For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI).

    Expressing:

    Article Title: Sublingual Immunization with M2-Based Vaccine Induces Broad Protective Immunity against Influenza
    Article Snippet: The gene has an Nde I site between 2nd and 3rd M2e region. .. For the plasmid expressing 3M2eC, the gene was digested with Xho I and BamH I and inserted into the bacterial expression vector pET15b (Novagen, Madison, WI) to express as a fusion of his-tag at the N terminus, resulting in the plasmid pET15b-3M2eC. .. For the construct expressing M2eC protein, which has one M2e domain, the synthesized gene was digested with Nde I and BamH I, and then inserted into pET15b vector.

    Article Title: Structure of acid deoxyribonuclease
    Article Snippet: One clone with the expected B. thailandensis DNase II sequence was selected for sub-cloning purposes. .. After digestion of pGEM-T Easy plasmid with Nco I and Xho I, the excised fragments were separated and purified as above and sub-cloned into the bacterial expression vector pET15b (Novagen, San Diego, CA, USA) using the vector's Nco I and Xho I cloning sites. .. The recombinant plasmid was transformed into BL21 (DE3) pLysS Escherichia coli competent cells (Novagen, San Diego, CA, USA).

    Article Title: Toxoplasma DJ-1 Regulates Organelle Secretion by a Direct Interaction with Calcium-Dependent Protein Kinase 1
    Article Snippet: The Toxoplasma gondii DJ-1 gene (TgDJ-1) ( ) was PCR amplified using primers that introduced a 5′ NdeI restriction site and a 3′ BamHI site. .. The amplified insertion was digested with NdeI and BamHI and cloned between these restriction sites in the bacterial expression vector pET15b (Novagen). .. The C104S and C127S point mutations were made using standard site-directed mutagenesis with mutagenic primers.

    Article Title: Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters
    Article Snippet: All constructs were prepared using an HSET cDNA corresponding to Gen Bank Accession Number BC121041. .. For motor domain (amino acids 305–673)-containing constructs, plasmids were prepared in the baculovirus vector pFASTBAC-HTa (Life Technologies) for use with the insect cell expression system, whereas all noncatalytic constructs (i.e., containing only the tail and stalk) were cloned into the bacterial expression vector pET15b (Novagen). .. Amino acid sequences of the tail, stalk, and motor domains of HSET/KIFC1 (Homo sapiens kinesin-14) were determined by sequence alignment to Ncd (Drosophila melanogaster kinesin-14) using as a guide, and used to design pET15b-HTa-EGFP-HSETΔMotor and pFASTBAC-HTa-EGFP-HSETΔTail.

    Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration
    Article Snippet: cDNAs corresponding to Arl4A/C/D and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA), which was also used for expressing untagged Arl4C. .. The cDNAs were also subcloned into the mammalian expression vector pcDNA 3.1 (Invitrogen) or the bacterial expression vector pET15b (Novagen, Madison, WI) and pBTM116 to obtain myc-tagged, His-tagged, or LexA-tagged Arl4 A/C/D and their various mutants. pcDNA 3.1 harboring FLNa-myc was provided by Jeffrey J.Y. .. Yen (Academia Sinica, Taipei, Taiwan).

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. The resultant plasmid construct (p15-16A) was used to transform E. coli NovaBlue (EMD Millipore Novagen, Temecula, CA) using a TransformAid kit (Thermo Scientific, Rockford, IL).

    Article Title: Expression characteristics of PDEF support a role in breast and prostate cancer progression
    Article Snippet: The actin monoclonal antibody and HRP- conjugated goat anti-rabbit antibody were purchased from Sigma (St. Louis, MO). .. The full-length open reading frame of PDEF cDNA (PDEF-full-length) and the cDNA encoding N-terminal 1 to 104 amino acids (PDEF-1-104) were PCR-amplified and subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) at the Nde I site. .. After confirmation of the orientation and sequence, E. coli BL21(DE3) cells were transformed by the resultant pET15b-PDEF-full-length or pET15b-PDEF-1-104 plasmids.

    Article Title:
    Article Snippet: However, the effect of such dimerization-disrupting mutations on the biological activity of S100A4 is presently unknown. .. Wild type S100A4 cDNA was cloned into the NdeI/BamHI sites of bacterial expression vector pET15b (Novagen) and recombinant protein produced in Escherichia coli C41 ( ). .. The fraction containing the S100A4 recombinant protein was dialyzed against phosphate-buffered saline (PBS), and the purity of the S100A4 was checked by SDS-15% (w/v) polyacrylamide gel electrophoresis.

    Article Title: Functional convergence of structurally distinct thioesterases from cyanobacteria and plants involved in phylloquinone biosynthesis
    Article Snippet: The structural relationship between the 4-HBTs and DHNATs confirms a previous phylogenetic analysis (Widhalm et al. , 2012 ) suggesting that the division between these two clades of hotdog-fold thioesterases preceded the evolution of the stringent substrate specificity of these enzymes. .. The genes for Slr0204 and AtDHNAT1 were cloned from their respective organisms into the bacterial expression vector pET15b (Novagen) between the Nde I and Xho I restriction sites. .. These constructs produce recombinant proteins bearing an N-terminal hexahistidine tag that can be removed by cleavage with thrombin, leaving the residual sequence GSH– at the N-termini of the mature proteins.

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding
    Article Snippet: C-terminally c-Myc-tagged human PhLP1 in pcDNA3.1/Myc-His B vector was described previously ( ). .. For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR. .. The integrity of all constructs was confirmed by sequence analysis.

    Article Title: Evolution of New Enzymatic Function by Structural Modulation of Cysteine Reactivity in Pseudomonas fluorescen
    Article Snippet: The coding sequence for ICH was PCR-amplified from the genomic DNA of P. fluorescens Migula strain Pf-5 (American Type Culture Collection number BAA-477D) using primers that incorporated a 5′ NdeI restriction site and a 3′ XhoI restriction site. .. The ICH gene was cloned between the NdeI and XhoI restriction sites of the bacterial expression vector pET15b (Novagen, Darmstadt, Germany) such that the expressed protein carries an N-terminal, thrombin-cleavable hexahistidine tag. .. After thrombin cleavage, the final recombinant ICH protein has three vector-derived amino acids at the N terminus (GSH), resulting in a 231-amino acid protein with a calculated molecular mass of 24,158 Da.

    Article Title: Identification of Novel Small Molecule Inhibitors of 4-diphosphocytidyl-2-C-methyl-D-erythritol (CDP-ME) kinase of Gram-negative bacteria
    Article Snippet: The genes encoding the bacterial CDP-ME kinases were PCR-amplified from the genomic DNA harvested from E. coli strain DH5α and Y. pestis strain KIM6 using oligonucleotide primers containing the histidine hexamer (His6) sequence at the 5′ end. .. The PCR products were sub-cloned into the bacterial expression vector pET15b ( Novagen ). .. Sequences of the PCR inserts were confirmed by DNA sequencing.

    Article Title: Dynamin GTPase regulation is altered by PH domain mutations found in centronuclear myopathy patients
    Article Snippet: In this context, inappropriate regulation of dynamin's GTPase activity could lead to aberrant nuclear positioning. .. Full-length dynamin constructs were amplified from either pUHD10-3 Dyn1 (human dynamin-1 ba; ) or pCR3.1 (rat dynamin-2 isoforms aa, ab, ba, and bb—gift of M McNiven; ) with 5′ Nde I and 3′ Bam HI restriction sites and subcloned into the bacterial expression vector pET15b (Novagen). .. Resulting dynamin constructs have the N-terminal sequence NH3 + -MGSS(H)6 SSGLVPRGSH preceding the dynamin start methionine.

    Article Title: Folded or Not? Tracking Bet v 1 Conformation in Recombinant Allergen Preparations
    Article Snippet: Serum from a non-allergic subject was used as negative control for the specific IgE measurements. .. The open reading frame of Bet v 1a optimized for codon usage of Escherichia coli was purchased from Geneart (Life Technologies, Thermo Fisher Scientific, Waltham, MA, U.S.A.) and cloned into bacterial expression vector pET15b (Novagen, Merck, Darmstadt, Germany) using the Clontech InFusion Kit (Mountain View, CA, U.S.A.). .. Bet v 1a variant rBet v 1aS112P/R145P was generated with the QuickChange Multi Lighting mutagenesis kit (Agilent Technologies, Inc., Santa Clara, CA, U.S.A.) using the Bet v 1a ORF in pET15b_Bet v 1a as DNA template and two mutagenic primers Bet v 1S112P (acaccggatggtggtcccattctgaaaattagc) and Bet v 1R145P (ggtgaaaccctgctgcctgcagttgaaagctat) according to manufacturer’s instructions.

    Article Title:
    Article Snippet: For expression as GST-fusion protein in Escherichia coli and N-terminal FLAG-fusion protein in mammalian cells, ARNO was cloned into pGEX-4T (GE Healthcare) and pCMV-Tag2 (Stratagene) vectors, respectively. .. For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI). .. ARF6 and ARL4D were cloned into the expression vector pET43a (Novagen). pACYC177/ET3d/yNMT, which encodes yeast ( Saccharomyces cerevisiae ) N -myristoyltransferase ( ) was used to myristoylate ARF6 and ARL4D in Escherichia coli .

    Article Title: INVOLVEMENT OF ENDOPLASMIC RETICULUM STRESS IN A NOVEL CLASSIC GALACTOSEMIA MODEL
    Article Snippet: Each sample was repeated three times and the mean value and standard deviation were calculated. .. Human inositol monophosphatase I (hIMPaseI) cDNA clone was purchased from Open Biosystems. cDNA was amplified by PCR and subcloned into the bacterial expression vector pET15b (Novagen). .. The hIMPase was over-expressed in Escherichia coli strain BL21(DE3) (Novagen) and purified using nickel-affinity chromatography (Ni-NTA, Qiagen, #1004493).

    Article Title: Identification of Phosphorylation Sites on Phosducin-like Protein by QTOF Mass Spectrometry
    Article Snippet: The product was cut with EcoRI and XbaI restriction endonucleases and was inserted into the pcDNA3.1/myc-HisB vector at the EcoRI and XbaI sites, generating an hPhLP construct with a c-myc epitope tag and a hexahistidine purification tag. .. The hPhLP-myc-His construct was then subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) by polymerase chain reaction amplification with the forward primer 5′–AA CCA ATC ATG ACC ACC CTT GAT GAT AAG TTG C and the reverse primer 5′- A CCA GGA TCC TCA ATG GTG ATG GTG ATG ATG ACC. .. The product was cut with PagI and BamHI restriction endonucleases and inserted into the pET15b vector at the NcoI and BamHI restriction sites.

    Article Title: Identification of functionally relevant histidine residues in the apoptotic nuclease CAD
    Article Snippet: To isolate the cDNA for human ICAD-L/DFF45 (hICAD-L), total RNA was extracted from HeLa cells with a RNeasy Mini Kit (Qiagen) and used for first-strand cDNA synthesis and subsequent amplification of the hICAD-L gene with the Access RT–PCR system (Promega). .. The coding region for hICAD-L (DFF45) was inserted in-frame as an Nco I– Sal I fragment into the Nco I and Xho I sites of the bacterial expression vector pET15b (Novagen). .. Hamster caspase 3 cDNA was a kind gift of Dr X. Wang (University of Texas Southwestern Medical Center at Dallas, Dallas, TX).

    Article Title: Defining the Interactions Between Intermediate Filaments and Desmosomes
    Article Snippet: To engineer recombinant desmoglein-tail, we used clone pDGK3C (generous gift of Dr. W.W. Franke) containing bovine Dsg1 cDNA. .. The Sca1–BsaA1 fragment, containing nucleotide residues 1592–3326, were subcloned into the NcoI–BamHI sites of bacterial expression vector Pet15b (Novagen, Inc., Madison, WI). .. This construct encoded 50 amino acids of extracellular and the entire transmembrane and cytoplasmic domains of Dsg1.

    Transformation Assay:

    Article Title: Toxoplasma DJ-1 Regulates Organelle Secretion by a Direct Interaction with Calcium-Dependent Protein Kinase 1
    Article Snippet: The amplified insertion was digested with NdeI and BamHI and cloned between these restriction sites in the bacterial expression vector pET15b (Novagen). .. The C104S and C127S point mutations were made using standard site-directed mutagenesis with mutagenic primers.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. Recombinant plasmid p15-16A (aa 17 to 247) was isolated from ampicillin-resistant clones using a ZR plasmid miniprep kit (Zymo Research, Irvine, CA).

    Article Title: Identification of Phosphorylation Sites on Phosducin-like Protein by QTOF Mass Spectrometry
    Article Snippet: The hPhLP-myc-His construct was then subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) by polymerase chain reaction amplification with the forward primer 5′–AA CCA ATC ATG ACC ACC CTT GAT GAT AAG TTG C and the reverse primer 5′- A CCA GGA TCC TCA ATG GTG ATG GTG ATG ATG ACC. .. The hPhLP-myc-His construct was then subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) by polymerase chain reaction amplification with the forward primer 5′–AA CCA ATC ATG ACC ACC CTT GAT GAT AAG TTG C and the reverse primer 5′- A CCA GGA TCC TCA ATG GTG ATG GTG ATG ATG ACC.

    Over Expression:

    Article Title: Identification of Novel Small Molecule Inhibitors of 4-diphosphocytidyl-2-C-methyl-D-erythritol (CDP-ME) kinase of Gram-negative bacteria
    Article Snippet: Paragraph title: Cloning, over-expression and purification of recombinant E. coli and Y. pestis CDP-ME kinases ... The PCR products were sub-cloned into the bacterial expression vector pET15b ( Novagen ).

    Kinase Assay:

    Article Title: Akt Plays a Critical Role in Replication of Nonsegmented Negative-Stranded RNA Viruses
    Article Snippet: Paragraph title: Akt kinase assay. ... Recombinant PIV5 P protein with a hexahistidine tag at the N terminus was generated by subcloning the P gene into the bacterial expression vector pET15b (Novagen) and transforming this plasmid into BL21(DE3)/pLysS cells.

    Transfection:

    Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration
    Article Snippet: The cDNAs were also subcloned into the mammalian expression vector pcDNA 3.1 (Invitrogen) or the bacterial expression vector pET15b (Novagen, Madison, WI) and pBTM116 to obtain myc-tagged, His-tagged, or LexA-tagged Arl4 A/C/D and their various mutants. pcDNA 3.1 harboring FLNa-myc was provided by Jeffrey J.Y. .. Partial FLNa DNA fragments were amplified by PCR using syntactic oligonucleotide primers containing restriction enzyme sites.

    Sequencing:

    Article Title: Sublingual Immunization with M2-Based Vaccine Induces Broad Protective Immunity against Influenza
    Article Snippet: A gene ( ) encoding three tandem copies of M2e conjugated to C-terminus sequence of M2 protein without residues 26–55 from influenza A/Puerto Rico/8/34 (H1N1) virus was chemically synthesized by Bio S & T Inc. (Canada). .. For the plasmid expressing 3M2eC, the gene was digested with Xho I and BamH I and inserted into the bacterial expression vector pET15b (Novagen, Madison, WI) to express as a fusion of his-tag at the N terminus, resulting in the plasmid pET15b-3M2eC.

    Article Title: Structure of acid deoxyribonuclease
    Article Snippet: One clone with the expected B. thailandensis DNase II sequence was selected for sub-cloning purposes. .. After digestion of pGEM-T Easy plasmid with Nco I and Xho I, the excised fragments were separated and purified as above and sub-cloned into the bacterial expression vector pET15b (Novagen, San Diego, CA, USA) using the vector's Nco I and Xho I cloning sites.

    Article Title: Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters
    Article Snippet: Paragraph title: Construct design and sequence verification ... For motor domain (amino acids 305–673)-containing constructs, plasmids were prepared in the baculovirus vector pFASTBAC-HTa (Life Technologies) for use with the insect cell expression system, whereas all noncatalytic constructs (i.e., containing only the tail and stalk) were cloned into the bacterial expression vector pET15b (Novagen).

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The sequence encoding the entire EqCXCL16 without the first 16 amino acid residues from the signal sequences was amplified from cDNA made from mRNA extracted from equine monocytes using a Smart cDNA synthesis kit (Clontech Laboratories Inc., Mountain View, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    Article Title: Evolution of New Enzymatic Function by Structural Modulation of Cysteine Reactivity in Pseudomonas fluorescen
    Article Snippet: The coding sequence for ICH was PCR-amplified from the genomic DNA of P. fluorescens Migula strain Pf-5 (American Type Culture Collection number BAA-477D) using primers that incorporated a 5′ NdeI restriction site and a 3′ XhoI restriction site. .. The ICH gene was cloned between the NdeI and XhoI restriction sites of the bacterial expression vector pET15b (Novagen, Darmstadt, Germany) such that the expressed protein carries an N-terminal, thrombin-cleavable hexahistidine tag.

    Article Title: Identification of Novel Small Molecule Inhibitors of 4-diphosphocytidyl-2-C-methyl-D-erythritol (CDP-ME) kinase of Gram-negative bacteria
    Article Snippet: The genes encoding the bacterial CDP-ME kinases were PCR-amplified from the genomic DNA harvested from E. coli strain DH5α and Y. pestis strain KIM6 using oligonucleotide primers containing the histidine hexamer (His6) sequence at the 5′ end. .. The PCR products were sub-cloned into the bacterial expression vector pET15b ( Novagen ).

    Article Title: Identification of Phosphorylation Sites on Phosducin-like Protein by QTOF Mass Spectrometry
    Article Snippet: The hPhLP-myc-His construct was then subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) by polymerase chain reaction amplification with the forward primer 5′–AA CCA ATC ATG ACC ACC CTT GAT GAT AAG TTG C and the reverse primer 5′- A CCA GGA TCC TCA ATG GTG ATG GTG ATG ATG ACC. .. The product was cut with PagI and BamHI restriction endonucleases and inserted into the pET15b vector at the NcoI and BamHI restriction sites.

    Article Title: Defining the Interactions Between Intermediate Filaments and Desmosomes
    Article Snippet: PCR was then used to engineer a DraI site at the transmembrane– cytoplasmic junction such that the sequence was changed from GTT AAG to TTT AAA. .. The Sca1–BsaA1 fragment, containing nucleotide residues 1592–3326, were subcloned into the NcoI–BamHI sites of bacterial expression vector Pet15b (Novagen, Inc., Madison, WI).

    Cell Culture:

    Article Title: Identification of Novel Small Molecule Inhibitors of 4-diphosphocytidyl-2-C-methyl-D-erythritol (CDP-ME) kinase of Gram-negative bacteria
    Article Snippet: The PCR products were sub-cloned into the bacterial expression vector pET15b ( Novagen ). .. Sequences of the PCR inserts were confirmed by DNA sequencing.

    Hemagglutination Assay:

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding
    Article Snippet: For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR. .. For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR.

    Generated:

    Article Title: Evolution of New Enzymatic Function by Structural Modulation of Cysteine Reactivity in Pseudomonas fluorescen
    Article Snippet: The ICH gene was cloned between the NdeI and XhoI restriction sites of the bacterial expression vector pET15b (Novagen, Darmstadt, Germany) such that the expressed protein carries an N-terminal, thrombin-cleavable hexahistidine tag. .. ICH sequence numbering throughout this paper is for the untagged native protein amino acid sequence.

    Article Title: Dynamin GTPase regulation is altered by PH domain mutations found in centronuclear myopathy patients
    Article Snippet: Full-length dynamin constructs were amplified from either pUHD10-3 Dyn1 (human dynamin-1 ba; ) or pCR3.1 (rat dynamin-2 isoforms aa, ab, ba, and bb—gift of M McNiven; ) with 5′ Nde I and 3′ Bam HI restriction sites and subcloned into the bacterial expression vector pET15b (Novagen). .. Dynamin-1 PH domain constructs (residues 510–633, PubMed accession code ) were expressed and purified from a pET11a plasmid as described ( ).

    Article Title: Akt Plays a Critical Role in Replication of Nonsegmented Negative-Stranded RNA Viruses
    Article Snippet: The compounds were dissolved in dimethyl sulfoxide (DMSO) and used at the concentrations indicated in the figure legends after virus absorption. .. Recombinant PIV5 P protein with a hexahistidine tag at the N terminus was generated by subcloning the P gene into the bacterial expression vector pET15b (Novagen) and transforming this plasmid into BL21(DE3)/pLysS cells. .. P protein expression was induced with isopropyl-β- d -thiogalactopyranoside (IPTG) after overnight culture, and His-P was purified from cell lysates using a His-Resin (Novagen) column by following the manufacturer's protocol as described previously ( ).

    DNA Sequencing:

    Article Title: Structure of acid deoxyribonuclease
    Article Snippet: After digestion of pGEM-T Easy plasmid with Nco I and Xho I, the excised fragments were separated and purified as above and sub-cloned into the bacterial expression vector pET15b (Novagen, San Diego, CA, USA) using the vector's Nco I and Xho I cloning sites. .. After digestion of pGEM-T Easy plasmid with Nco I and Xho I, the excised fragments were separated and purified as above and sub-cloned into the bacterial expression vector pET15b (Novagen, San Diego, CA, USA) using the vector's Nco I and Xho I cloning sites.

    Article Title: Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters
    Article Snippet: For motor domain (amino acids 305–673)-containing constructs, plasmids were prepared in the baculovirus vector pFASTBAC-HTa (Life Technologies) for use with the insect cell expression system, whereas all noncatalytic constructs (i.e., containing only the tail and stalk) were cloned into the bacterial expression vector pET15b (Novagen). .. For motor domain (amino acids 305–673)-containing constructs, plasmids were prepared in the baculovirus vector pFASTBAC-HTa (Life Technologies) for use with the insect cell expression system, whereas all noncatalytic constructs (i.e., containing only the tail and stalk) were cloned into the bacterial expression vector pET15b (Novagen).

    Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration
    Article Snippet: The cDNAs were also subcloned into the mammalian expression vector pcDNA 3.1 (Invitrogen) or the bacterial expression vector pET15b (Novagen, Madison, WI) and pBTM116 to obtain myc-tagged, His-tagged, or LexA-tagged Arl4 A/C/D and their various mutants. pcDNA 3.1 harboring FLNa-myc was provided by Jeffrey J.Y. .. The PCR products were cloned into pACT2, pGEX, and pcDNA 3.0 vectors for transfection.

    Article Title: Functional convergence of structurally distinct thioesterases from cyanobacteria and plants involved in phylloquinone biosynthesis
    Article Snippet: The genes for Slr0204 and AtDHNAT1 were cloned from their respective organisms into the bacterial expression vector pET15b (Novagen) between the Nde I and Xho I restriction sites. .. These constructs produce recombinant proteins bearing an N-terminal hexahistidine tag that can be removed by cleavage with thrombin, leaving the residual sequence GSH– at the N-termini of the mature proteins.

    Article Title: Evolution of New Enzymatic Function by Structural Modulation of Cysteine Reactivity in Pseudomonas fluorescen
    Article Snippet: The ICH gene was cloned between the NdeI and XhoI restriction sites of the bacterial expression vector pET15b (Novagen, Darmstadt, Germany) such that the expressed protein carries an N-terminal, thrombin-cleavable hexahistidine tag. .. All point mutations (D17V, D17N, D17E, C101S, C101A, T102S, and T102V) were generated by site-directed mutagenesis using Pfu Turbo DNA Polymerase (Stratagene, La Jolla, CA) and appropriate mutagenic primers.

    Y2H Assay:

    Article Title:
    Article Snippet: These constructs were subcloned in pACT2 for yeast two-hybrid assay. .. For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Identification of functionally relevant histidine residues in the apoptotic nuclease CAD
    Article Snippet: To isolate the cDNA for human ICAD-L/DFF45 (hICAD-L), total RNA was extracted from HeLa cells with a RNeasy Mini Kit (Qiagen) and used for first-strand cDNA synthesis and subsequent amplification of the hICAD-L gene with the Access RT–PCR system (Promega). .. The coding region for hICAD-L (DFF45) was inserted in-frame as an Nco I– Sal I fragment into the Nco I and Xho I sites of the bacterial expression vector pET15b (Novagen).

    Recombinant:

    Article Title: Toxoplasma DJ-1 Regulates Organelle Secretion by a Direct Interaction with Calcium-Dependent Protein Kinase 1
    Article Snippet: The amplified insertion was digested with NdeI and BamHI and cloned between these restriction sites in the bacterial expression vector pET15b (Novagen). .. The constructs were transformed into chemically competent E. coli strain BL21(DE3) (Novagen Merck, Darmstadt, Germany,) for protein expression.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    Article Title:
    Article Snippet: However, the effect of such dimerization-disrupting mutations on the biological activity of S100A4 is presently unknown. .. Wild type S100A4 cDNA was cloned into the NdeI/BamHI sites of bacterial expression vector pET15b (Novagen) and recombinant protein produced in Escherichia coli C41 ( ). .. The fraction containing the S100A4 recombinant protein was dialyzed against phosphate-buffered saline (PBS), and the purity of the S100A4 was checked by SDS-15% (w/v) polyacrylamide gel electrophoresis.

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding
    Article Snippet: C-terminally c-Myc-tagged human PhLP1 in pcDNA3.1/Myc-His B vector was described previously ( ). .. For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR. .. The integrity of all constructs was confirmed by sequence analysis.

    Article Title: Identification of Novel Small Molecule Inhibitors of 4-diphosphocytidyl-2-C-methyl-D-erythritol (CDP-ME) kinase of Gram-negative bacteria
    Article Snippet: Paragraph title: Cloning, over-expression and purification of recombinant E. coli and Y. pestis CDP-ME kinases ... The PCR products were sub-cloned into the bacterial expression vector pET15b ( Novagen ).

    Article Title: Folded or Not? Tracking Bet v 1 Conformation in Recombinant Allergen Preparations
    Article Snippet: Paragraph title: Generation and purification of recombinant Bet v 1a ... The open reading frame of Bet v 1a optimized for codon usage of Escherichia coli was purchased from Geneart (Life Technologies, Thermo Fisher Scientific, Waltham, MA, U.S.A.) and cloned into bacterial expression vector pET15b (Novagen, Merck, Darmstadt, Germany) using the Clontech InFusion Kit (Mountain View, CA, U.S.A.).

    Article Title:
    Article Snippet: For expression as GST-fusion protein in Escherichia coli and N-terminal FLAG-fusion protein in mammalian cells, ARNO was cloned into pGEX-4T (GE Healthcare) and pCMV-Tag2 (Stratagene) vectors, respectively. .. For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI). .. ARF6 and ARL4D were cloned into the expression vector pET43a (Novagen). pACYC177/ET3d/yNMT, which encodes yeast ( Saccharomyces cerevisiae ) N -myristoyltransferase ( ) was used to myristoylate ARF6 and ARL4D in Escherichia coli .

    Article Title: Defining the Interactions Between Intermediate Filaments and Desmosomes
    Article Snippet: Paragraph title: Recombinant Proteins ... The Sca1–BsaA1 fragment, containing nucleotide residues 1592–3326, were subcloned into the NcoI–BamHI sites of bacterial expression vector Pet15b (Novagen, Inc., Madison, WI).

    Molecular Weight:

    Article Title: Structure of acid deoxyribonuclease
    Article Snippet: After digestion of pGEM-T Easy plasmid with Nco I and Xho I, the excised fragments were separated and purified as above and sub-cloned into the bacterial expression vector pET15b (Novagen, San Diego, CA, USA) using the vector's Nco I and Xho I cloning sites. .. The recombinant plasmid was transformed into BL21 (DE3) pLysS Escherichia coli competent cells (Novagen, San Diego, CA, USA).

    Mutagenesis:

    Article Title: Evolution of New Enzymatic Function by Structural Modulation of Cysteine Reactivity in Pseudomonas fluorescen
    Article Snippet: Paragraph title: Cloning and Mutagenesis of P. fluorescens pf-5 ICH ... The ICH gene was cloned between the NdeI and XhoI restriction sites of the bacterial expression vector pET15b (Novagen, Darmstadt, Germany) such that the expressed protein carries an N-terminal, thrombin-cleavable hexahistidine tag.

    Article Title: Dynamin GTPase regulation is altered by PH domain mutations found in centronuclear myopathy patients
    Article Snippet: Full-length dynamin constructs were amplified from either pUHD10-3 Dyn1 (human dynamin-1 ba; ) or pCR3.1 (rat dynamin-2 isoforms aa, ab, ba, and bb—gift of M McNiven; ) with 5′ Nde I and 3′ Bam HI restriction sites and subcloned into the bacterial expression vector pET15b (Novagen). .. Dynamin-1 PH domain constructs (residues 510–633, PubMed accession code ) were expressed and purified from a pET11a plasmid as described ( ).

    Article Title:
    Article Snippet: ARNO and its deletion mutant cDNA sequences were amplified by polymerase chain reaction (PCR) by using ARNO/pACT2 plasmid as a template (obtained from yeast two-hybrid screen) and oligonucleotide primers incorporating restriction sites. .. For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI).

    Article Title: Defining the Interactions Between Intermediate Filaments and Desmosomes
    Article Snippet: To generate pET8c-PG, an NcoI site was engineered at the ATG initiator codon using a G:C mutation at nucleotide 119 of the clone. .. The Sca1–BsaA1 fragment, containing nucleotide residues 1592–3326, were subcloned into the NcoI–BamHI sites of bacterial expression vector Pet15b (Novagen, Inc., Madison, WI).

    Isolation:

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. The resultant plasmid construct (p15-16A) was used to transform E. coli NovaBlue (EMD Millipore Novagen, Temecula, CA) using a TransformAid kit (Thermo Scientific, Rockford, IL).

    Subcloning:

    Article Title: Structure of acid deoxyribonuclease
    Article Snippet: One clone with the expected B. thailandensis DNase II sequence was selected for sub-cloning purposes. .. After digestion of pGEM-T Easy plasmid with Nco I and Xho I, the excised fragments were separated and purified as above and sub-cloned into the bacterial expression vector pET15b (Novagen, San Diego, CA, USA) using the vector's Nco I and Xho I cloning sites.

    Article Title: Akt Plays a Critical Role in Replication of Nonsegmented Negative-Stranded RNA Viruses
    Article Snippet: The compounds were dissolved in dimethyl sulfoxide (DMSO) and used at the concentrations indicated in the figure legends after virus absorption. .. Recombinant PIV5 P protein with a hexahistidine tag at the N terminus was generated by subcloning the P gene into the bacterial expression vector pET15b (Novagen) and transforming this plasmid into BL21(DE3)/pLysS cells. .. P protein expression was induced with isopropyl-β- d -thiogalactopyranoside (IPTG) after overnight culture, and His-P was purified from cell lysates using a His-Resin (Novagen) column by following the manufacturer's protocol as described previously ( ).

    Purification:

    Article Title: Structure of acid deoxyribonuclease
    Article Snippet: One clone with the expected B. thailandensis DNase II sequence was selected for sub-cloning purposes. .. After digestion of pGEM-T Easy plasmid with Nco I and Xho I, the excised fragments were separated and purified as above and sub-cloned into the bacterial expression vector pET15b (Novagen, San Diego, CA, USA) using the vector's Nco I and Xho I cloning sites. .. The recombinant plasmid was transformed into BL21 (DE3) pLysS Escherichia coli competent cells (Novagen, San Diego, CA, USA).

    Article Title: Toxoplasma DJ-1 Regulates Organelle Secretion by a Direct Interaction with Calcium-Dependent Protein Kinase 1
    Article Snippet: Paragraph title: Protein expression and purification. ... The amplified insertion was digested with NdeI and BamHI and cloned between these restriction sites in the bacterial expression vector pET15b (Novagen).

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. The resultant plasmid construct (p15-16A) was used to transform E. coli NovaBlue (EMD Millipore Novagen, Temecula, CA) using a TransformAid kit (Thermo Scientific, Rockford, IL).

    Article Title: Expression characteristics of PDEF support a role in breast and prostate cancer progression
    Article Snippet: The full-length open reading frame of PDEF cDNA (PDEF-full-length) and the cDNA encoding N-terminal 1 to 104 amino acids (PDEF-1-104) were PCR-amplified and subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) at the Nde I site. .. After confirmation of the orientation and sequence, E. coli BL21(DE3) cells were transformed by the resultant pET15b-PDEF-full-length or pET15b-PDEF-1-104 plasmids.

    Article Title:
    Article Snippet: Paragraph title: Expression and Purification of Human S100A4 ... Wild type S100A4 cDNA was cloned into the NdeI/BamHI sites of bacterial expression vector pET15b (Novagen) and recombinant protein produced in Escherichia coli C41 ( ).

    Article Title: Functional convergence of structurally distinct thioesterases from cyanobacteria and plants involved in phylloquinone biosynthesis
    Article Snippet: Paragraph title: 2.1. Protein expression and purification   ... The genes for Slr0204 and AtDHNAT1 were cloned from their respective organisms into the bacterial expression vector pET15b (Novagen) between the Nde I and Xho I restriction sites.

    Article Title: Identification of Novel Small Molecule Inhibitors of 4-diphosphocytidyl-2-C-methyl-D-erythritol (CDP-ME) kinase of Gram-negative bacteria
    Article Snippet: Paragraph title: Cloning, over-expression and purification of recombinant E. coli and Y. pestis CDP-ME kinases ... The PCR products were sub-cloned into the bacterial expression vector pET15b ( Novagen ).

    Article Title: Dynamin GTPase regulation is altered by PH domain mutations found in centronuclear myopathy patients
    Article Snippet: Full-length dynamin constructs were amplified from either pUHD10-3 Dyn1 (human dynamin-1 ba; ) or pCR3.1 (rat dynamin-2 isoforms aa, ab, ba, and bb—gift of M McNiven; ) with 5′ Nde I and 3′ Bam HI restriction sites and subcloned into the bacterial expression vector pET15b (Novagen). .. Resulting dynamin constructs have the N-terminal sequence NH3 + -MGSS(H)6 SSGLVPRGSH preceding the dynamin start methionine.

    Article Title: Folded or Not? Tracking Bet v 1 Conformation in Recombinant Allergen Preparations
    Article Snippet: Paragraph title: Generation and purification of recombinant Bet v 1a ... The open reading frame of Bet v 1a optimized for codon usage of Escherichia coli was purchased from Geneart (Life Technologies, Thermo Fisher Scientific, Waltham, MA, U.S.A.) and cloned into bacterial expression vector pET15b (Novagen, Merck, Darmstadt, Germany) using the Clontech InFusion Kit (Mountain View, CA, U.S.A.).

    Article Title: Akt Plays a Critical Role in Replication of Nonsegmented Negative-Stranded RNA Viruses
    Article Snippet: Recombinant PIV5 P protein with a hexahistidine tag at the N terminus was generated by subcloning the P gene into the bacterial expression vector pET15b (Novagen) and transforming this plasmid into BL21(DE3)/pLysS cells. .. P protein expression was induced with isopropyl-β- d -thiogalactopyranoside (IPTG) after overnight culture, and His-P was purified from cell lysates using a His-Resin (Novagen) column by following the manufacturer's protocol as described previously ( ).

    Article Title: Identification of Phosphorylation Sites on Phosducin-like Protein by QTOF Mass Spectrometry
    Article Snippet: The product was cut with EcoRI and XbaI restriction endonucleases and was inserted into the pcDNA3.1/myc-HisB vector at the EcoRI and XbaI sites, generating an hPhLP construct with a c-myc epitope tag and a hexahistidine purification tag. .. The hPhLP-myc-His construct was then subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) by polymerase chain reaction amplification with the forward primer 5′–AA CCA ATC ATG ACC ACC CTT GAT GAT AAG TTG C and the reverse primer 5′- A CCA GGA TCC TCA ATG GTG ATG GTG ATG ATG ACC.

    Protein Purification:

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding
    Article Snippet: C-terminally c-Myc-tagged human PhLP1 in pcDNA3.1/Myc-His B vector was described previously ( ). .. For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR. .. The integrity of all constructs was confirmed by sequence analysis.

    Article Title: Identification of Novel Small Molecule Inhibitors of 4-diphosphocytidyl-2-C-methyl-D-erythritol (CDP-ME) kinase of Gram-negative bacteria
    Article Snippet: The PCR products were sub-cloned into the bacterial expression vector pET15b ( Novagen ). .. Bacterial cells were then harvested by centrifugation and the pellet was subsequently stored at −80°C.

    Article Title: Identification of Phosphorylation Sites on Phosducin-like Protein by QTOF Mass Spectrometry
    Article Snippet: Paragraph title: Protein Purification ... The hPhLP-myc-His construct was then subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) by polymerase chain reaction amplification with the forward primer 5′–AA CCA ATC ATG ACC ACC CTT GAT GAT AAG TTG C and the reverse primer 5′- A CCA GGA TCC TCA ATG GTG ATG GTG ATG ATG ACC.

    Polymerase Chain Reaction:

    Article Title: Structure of acid deoxyribonuclease
    Article Snippet: PCR-amplified products were separated using agarose and the expected band was gel purified (QIAEX II, Qiagen, Valencia, CA, USA) and cloned initially into pGEM-T Easy vector (Promega, Madison, WI, USA). .. After digestion of pGEM-T Easy plasmid with Nco I and Xho I, the excised fragments were separated and purified as above and sub-cloned into the bacterial expression vector pET15b (Novagen, San Diego, CA, USA) using the vector's Nco I and Xho I cloning sites.

    Article Title: Toxoplasma DJ-1 Regulates Organelle Secretion by a Direct Interaction with Calcium-Dependent Protein Kinase 1
    Article Snippet: The Toxoplasma gondii DJ-1 gene (TgDJ-1) ( ) was PCR amplified using primers that introduced a 5′ NdeI restriction site and a 3′ BamHI site. .. The amplified insertion was digested with NdeI and BamHI and cloned between these restriction sites in the bacterial expression vector pET15b (Novagen).

    Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration
    Article Snippet: The cDNAs were also subcloned into the mammalian expression vector pcDNA 3.1 (Invitrogen) or the bacterial expression vector pET15b (Novagen, Madison, WI) and pBTM116 to obtain myc-tagged, His-tagged, or LexA-tagged Arl4 A/C/D and their various mutants. pcDNA 3.1 harboring FLNa-myc was provided by Jeffrey J.Y. .. The cDNAs were also subcloned into the mammalian expression vector pcDNA 3.1 (Invitrogen) or the bacterial expression vector pET15b (Novagen, Madison, WI) and pBTM116 to obtain myc-tagged, His-tagged, or LexA-tagged Arl4 A/C/D and their various mutants. pcDNA 3.1 harboring FLNa-myc was provided by Jeffrey J.Y.

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The cDNA amplification was carried out according to a standard laboratory PCR protocol using forward primer cx16-15F (5′-GCG CTCGAG GCGTTGCTGACTCTGCAAGG-3′) and reverse primer cx16-15R (5′-GC GGATCC GCACTGCCACTGTAACTGAT-3′) (IDT, Coralville, IA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    Article Title: Expression characteristics of PDEF support a role in breast and prostate cancer progression
    Article Snippet: The actin monoclonal antibody and HRP- conjugated goat anti-rabbit antibody were purchased from Sigma (St. Louis, MO). .. The full-length open reading frame of PDEF cDNA (PDEF-full-length) and the cDNA encoding N-terminal 1 to 104 amino acids (PDEF-1-104) were PCR-amplified and subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) at the Nde I site. .. After confirmation of the orientation and sequence, E. coli BL21(DE3) cells were transformed by the resultant pET15b-PDEF-full-length or pET15b-PDEF-1-104 plasmids.

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding
    Article Snippet: C-terminally c-Myc-tagged human PhLP1 in pcDNA3.1/Myc-His B vector was described previously ( ). .. For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR. .. The integrity of all constructs was confirmed by sequence analysis.

    Article Title: Evolution of New Enzymatic Function by Structural Modulation of Cysteine Reactivity in Pseudomonas fluorescen
    Article Snippet: The coding sequence for ICH was PCR-amplified from the genomic DNA of P. fluorescens Migula strain Pf-5 (American Type Culture Collection number BAA-477D) using primers that incorporated a 5′ NdeI restriction site and a 3′ XhoI restriction site. .. The ICH gene was cloned between the NdeI and XhoI restriction sites of the bacterial expression vector pET15b (Novagen, Darmstadt, Germany) such that the expressed protein carries an N-terminal, thrombin-cleavable hexahistidine tag.

    Article Title: Identification of Novel Small Molecule Inhibitors of 4-diphosphocytidyl-2-C-methyl-D-erythritol (CDP-ME) kinase of Gram-negative bacteria
    Article Snippet: The genes encoding the bacterial CDP-ME kinases were PCR-amplified from the genomic DNA harvested from E. coli strain DH5α and Y. pestis strain KIM6 using oligonucleotide primers containing the histidine hexamer (His6) sequence at the 5′ end. .. The PCR products were sub-cloned into the bacterial expression vector pET15b ( Novagen ). .. Sequences of the PCR inserts were confirmed by DNA sequencing.

    Article Title: Dynamin GTPase regulation is altered by PH domain mutations found in centronuclear myopathy patients
    Article Snippet: Full-length dynamin constructs were amplified from either pUHD10-3 Dyn1 (human dynamin-1 ba; ) or pCR3.1 (rat dynamin-2 isoforms aa, ab, ba, and bb—gift of M McNiven; ) with 5′ Nde I and 3′ Bam HI restriction sites and subcloned into the bacterial expression vector pET15b (Novagen). .. Dynamin-1 PH domain constructs (residues 510–633, PubMed accession code ) were expressed and purified from a pET11a plasmid as described ( ).

    Article Title:
    Article Snippet: To introduce site-specific mutations in ARNO, a two-step recombinant PCR procedure was used. .. For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI).

    Article Title: INVOLVEMENT OF ENDOPLASMIC RETICULUM STRESS IN A NOVEL CLASSIC GALACTOSEMIA MODEL
    Article Snippet: Each sample was repeated three times and the mean value and standard deviation were calculated. .. Human inositol monophosphatase I (hIMPaseI) cDNA clone was purchased from Open Biosystems. cDNA was amplified by PCR and subcloned into the bacterial expression vector pET15b (Novagen). .. The hIMPase was over-expressed in Escherichia coli strain BL21(DE3) (Novagen) and purified using nickel-affinity chromatography (Ni-NTA, Qiagen, #1004493).

    Article Title: Identification of Phosphorylation Sites on Phosducin-like Protein by QTOF Mass Spectrometry
    Article Snippet: The product was cut with EcoRI and XbaI restriction endonucleases and was inserted into the pcDNA3.1/myc-HisB vector at the EcoRI and XbaI sites, generating an hPhLP construct with a c-myc epitope tag and a hexahistidine purification tag. .. The hPhLP-myc-His construct was then subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) by polymerase chain reaction amplification with the forward primer 5′–AA CCA ATC ATG ACC ACC CTT GAT GAT AAG TTG C and the reverse primer 5′- A CCA GGA TCC TCA ATG GTG ATG GTG ATG ATG ACC. .. The product was cut with PagI and BamHI restriction endonucleases and inserted into the pET15b vector at the NcoI and BamHI restriction sites.

    Article Title: Defining the Interactions Between Intermediate Filaments and Desmosomes
    Article Snippet: PCR was then used to engineer a DraI site at the transmembrane– cytoplasmic junction such that the sequence was changed from GTT AAG to TTT AAA. .. The Sca1–BsaA1 fragment, containing nucleotide residues 1592–3326, were subcloned into the NcoI–BamHI sites of bacterial expression vector Pet15b (Novagen, Inc., Madison, WI).

    cDNA Library Assay:

    Article Title: Defining the Interactions Between Intermediate Filaments and Desmosomes
    Article Snippet: The Sca1–BsaA1 fragment, containing nucleotide residues 1592–3326, were subcloned into the NcoI–BamHI sites of bacterial expression vector Pet15b (Novagen, Inc., Madison, WI). .. This construct encoded 50 amino acids of extracellular and the entire transmembrane and cytoplasmic domains of Dsg1.

    Agarose Gel Electrophoresis:

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes.

    Chloramphenicol Acetyltransferase Assay:

    Article Title:
    Article Snippet: To generate ARNOC7A, seven basic charge amino acids in the polybasic c domain were replaced with alanine (386 RKKR ISV KKK QEQP399→386 AAAA ISV AAA QEQP399), by using a 3′ primer in which the basic residues were replaced by alanine codons (5′ CTC GAG TCA GGG CTG CTC CTG TGC TGC TGC GAC TGA AAT TGC TGC TGC TGC CGC TGC CAG CAT CTC ATA 3′). .. For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI).

    SDS Page:

    Article Title: Akt Plays a Critical Role in Replication of Nonsegmented Negative-Stranded RNA Viruses
    Article Snippet: Recombinant PIV5 P protein with a hexahistidine tag at the N terminus was generated by subcloning the P gene into the bacterial expression vector pET15b (Novagen) and transforming this plasmid into BL21(DE3)/pLysS cells. .. Recombinant Akt1 (400 ng) (Upstate Biotechnology), which is constitutively active, was incubated with 10 μCi [γ-32 P]ATP (Amersham Biosciences) and purified His-P protein in a volume of 30 μl with kinase buffer (25 mM HEPES, 25 mM β-glycerophosphate, 25 mM MgCl2 , 2 mM dithiothreitol, and 0.1 mM NaVO3 ) following a protocol by Powell et al. ( ).

    Plasmid Preparation:

    Article Title: Sublingual Immunization with M2-Based Vaccine Induces Broad Protective Immunity against Influenza
    Article Snippet: The gene has an Nde I site between 2nd and 3rd M2e region. .. For the plasmid expressing 3M2eC, the gene was digested with Xho I and BamH I and inserted into the bacterial expression vector pET15b (Novagen, Madison, WI) to express as a fusion of his-tag at the N terminus, resulting in the plasmid pET15b-3M2eC. .. For the construct expressing M2eC protein, which has one M2e domain, the synthesized gene was digested with Nde I and BamH I, and then inserted into pET15b vector.

    Article Title: Structure of acid deoxyribonuclease
    Article Snippet: One clone with the expected B. thailandensis DNase II sequence was selected for sub-cloning purposes. .. After digestion of pGEM-T Easy plasmid with Nco I and Xho I, the excised fragments were separated and purified as above and sub-cloned into the bacterial expression vector pET15b (Novagen, San Diego, CA, USA) using the vector's Nco I and Xho I cloning sites. .. The recombinant plasmid was transformed into BL21 (DE3) pLysS Escherichia coli competent cells (Novagen, San Diego, CA, USA).

    Article Title: Toxoplasma DJ-1 Regulates Organelle Secretion by a Direct Interaction with Calcium-Dependent Protein Kinase 1
    Article Snippet: The Toxoplasma gondii DJ-1 gene (TgDJ-1) ( ) was PCR amplified using primers that introduced a 5′ NdeI restriction site and a 3′ BamHI site. .. The amplified insertion was digested with NdeI and BamHI and cloned between these restriction sites in the bacterial expression vector pET15b (Novagen). .. The C104S and C127S point mutations were made using standard site-directed mutagenesis with mutagenic primers.

    Article Title: Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters
    Article Snippet: All constructs were prepared using an HSET cDNA corresponding to Gen Bank Accession Number BC121041. .. For motor domain (amino acids 305–673)-containing constructs, plasmids were prepared in the baculovirus vector pFASTBAC-HTa (Life Technologies) for use with the insect cell expression system, whereas all noncatalytic constructs (i.e., containing only the tail and stalk) were cloned into the bacterial expression vector pET15b (Novagen). .. Amino acid sequences of the tail, stalk, and motor domains of HSET/KIFC1 (Homo sapiens kinesin-14) were determined by sequence alignment to Ncd (Drosophila melanogaster kinesin-14) using as a guide, and used to design pET15b-HTa-EGFP-HSETΔMotor and pFASTBAC-HTa-EGFP-HSETΔTail.

    Article Title: ADP-ribosylation factor–like 4C binding to filamin-A modulates filopodium formation and cell migration
    Article Snippet: cDNAs corresponding to Arl4A/C/D and their various mutants were cloned into the mammalian expression vector pSG5 (Stratagene, La Jolla, CA), which was also used for expressing untagged Arl4C. .. The cDNAs were also subcloned into the mammalian expression vector pcDNA 3.1 (Invitrogen) or the bacterial expression vector pET15b (Novagen, Madison, WI) and pBTM116 to obtain myc-tagged, His-tagged, or LexA-tagged Arl4 A/C/D and their various mutants. pcDNA 3.1 harboring FLNa-myc was provided by Jeffrey J.Y. .. Yen (Academia Sinica, Taipei, Taiwan).

    Article Title: Equine Arteritis Virus Uses Equine CXCL16 as an Entry Receptor
    Article Snippet: The amplified EqCXCL16 fragment (amino acids [aa] 17 to 247) was run on a 1% agarose gel (E-Gel EX; Life Technologies, Grand Island, NY) and purified with a commercial kit (Zymoclean gel recovery kit; Zymo Research, Irvine, CA). .. The purified EqCXCL16 fragment was digested with the XhoI and BamHI restriction enzymes and ligated (Rapid DNA ligation kit; Thermo Scientific, Rockford, IL) into the bacterial expression vector pET15b (EMD Millipore Novagen, Temecula, CA) following digestion with the same restriction enzymes. .. The resultant plasmid construct (p15-16A) was used to transform E. coli NovaBlue (EMD Millipore Novagen, Temecula, CA) using a TransformAid kit (Thermo Scientific, Rockford, IL).

    Article Title: Expression characteristics of PDEF support a role in breast and prostate cancer progression
    Article Snippet: The actin monoclonal antibody and HRP- conjugated goat anti-rabbit antibody were purchased from Sigma (St. Louis, MO). .. The full-length open reading frame of PDEF cDNA (PDEF-full-length) and the cDNA encoding N-terminal 1 to 104 amino acids (PDEF-1-104) were PCR-amplified and subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) at the Nde I site. .. After confirmation of the orientation and sequence, E. coli BL21(DE3) cells were transformed by the resultant pET15b-PDEF-full-length or pET15b-PDEF-1-104 plasmids.

    Article Title:
    Article Snippet: However, the effect of such dimerization-disrupting mutations on the biological activity of S100A4 is presently unknown. .. Wild type S100A4 cDNA was cloned into the NdeI/BamHI sites of bacterial expression vector pET15b (Novagen) and recombinant protein produced in Escherichia coli C41 ( ). .. The fraction containing the S100A4 recombinant protein was dialyzed against phosphate-buffered saline (PBS), and the purity of the S100A4 was checked by SDS-15% (w/v) polyacrylamide gel electrophoresis.

    Article Title: Functional convergence of structurally distinct thioesterases from cyanobacteria and plants involved in phylloquinone biosynthesis
    Article Snippet: The structural relationship between the 4-HBTs and DHNATs confirms a previous phylogenetic analysis (Widhalm et al. , 2012 ) suggesting that the division between these two clades of hotdog-fold thioesterases preceded the evolution of the stringent substrate specificity of these enzymes. .. The genes for Slr0204 and AtDHNAT1 were cloned from their respective organisms into the bacterial expression vector pET15b (Novagen) between the Nde I and Xho I restriction sites. .. These constructs produce recombinant proteins bearing an N-terminal hexahistidine tag that can be removed by cleavage with thrombin, leaving the residual sequence GSH– at the N-termini of the mature proteins.

    Article Title: Programmed Cell Death Protein 5 Interacts with the Cytosolic Chaperonin Containing Tailless Complex Polypeptide 1 (CCT) to Regulate β-Tubulin Folding
    Article Snippet: C-terminally c-Myc-tagged human PhLP1 in pcDNA3.1/Myc-His B vector was described previously ( ). .. For recombinant protein purification, His6 -PDCD5-FLAG was cloned into the first multiple cloning site of the bacterial expression vector pETDuet, and PhLP1-Myc-His was cloned into the bacterial expression vector pET15b (Novagen) using PCR. .. The integrity of all constructs was confirmed by sequence analysis.

    Article Title: Evolution of New Enzymatic Function by Structural Modulation of Cysteine Reactivity in Pseudomonas fluorescen
    Article Snippet: The coding sequence for ICH was PCR-amplified from the genomic DNA of P. fluorescens Migula strain Pf-5 (American Type Culture Collection number BAA-477D) using primers that incorporated a 5′ NdeI restriction site and a 3′ XhoI restriction site. .. The ICH gene was cloned between the NdeI and XhoI restriction sites of the bacterial expression vector pET15b (Novagen, Darmstadt, Germany) such that the expressed protein carries an N-terminal, thrombin-cleavable hexahistidine tag. .. After thrombin cleavage, the final recombinant ICH protein has three vector-derived amino acids at the N terminus (GSH), resulting in a 231-amino acid protein with a calculated molecular mass of 24,158 Da.

    Article Title: Identification of Novel Small Molecule Inhibitors of 4-diphosphocytidyl-2-C-methyl-D-erythritol (CDP-ME) kinase of Gram-negative bacteria
    Article Snippet: The genes encoding the bacterial CDP-ME kinases were PCR-amplified from the genomic DNA harvested from E. coli strain DH5α and Y. pestis strain KIM6 using oligonucleotide primers containing the histidine hexamer (His6) sequence at the 5′ end. .. The PCR products were sub-cloned into the bacterial expression vector pET15b ( Novagen ). .. Sequences of the PCR inserts were confirmed by DNA sequencing.

    Article Title: Dynamin GTPase regulation is altered by PH domain mutations found in centronuclear myopathy patients
    Article Snippet: In this context, inappropriate regulation of dynamin's GTPase activity could lead to aberrant nuclear positioning. .. Full-length dynamin constructs were amplified from either pUHD10-3 Dyn1 (human dynamin-1 ba; ) or pCR3.1 (rat dynamin-2 isoforms aa, ab, ba, and bb—gift of M McNiven; ) with 5′ Nde I and 3′ Bam HI restriction sites and subcloned into the bacterial expression vector pET15b (Novagen). .. Resulting dynamin constructs have the N-terminal sequence NH3 + -MGSS(H)6 SSGLVPRGSH preceding the dynamin start methionine.

    Article Title: Folded or Not? Tracking Bet v 1 Conformation in Recombinant Allergen Preparations
    Article Snippet: Serum from a non-allergic subject was used as negative control for the specific IgE measurements. .. The open reading frame of Bet v 1a optimized for codon usage of Escherichia coli was purchased from Geneart (Life Technologies, Thermo Fisher Scientific, Waltham, MA, U.S.A.) and cloned into bacterial expression vector pET15b (Novagen, Merck, Darmstadt, Germany) using the Clontech InFusion Kit (Mountain View, CA, U.S.A.). .. Bet v 1a variant rBet v 1aS112P/R145P was generated with the QuickChange Multi Lighting mutagenesis kit (Agilent Technologies, Inc., Santa Clara, CA, U.S.A.) using the Bet v 1a ORF in pET15b_Bet v 1a as DNA template and two mutagenic primers Bet v 1S112P (acaccggatggtggtcccattctgaaaattagc) and Bet v 1R145P (ggtgaaaccctgctgcctgcagttgaaagctat) according to manufacturer’s instructions.

    Article Title:
    Article Snippet: For expression as GST-fusion protein in Escherichia coli and N-terminal FLAG-fusion protein in mammalian cells, ARNO was cloned into pGEX-4T (GE Healthcare) and pCMV-Tag2 (Stratagene) vectors, respectively. .. For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI). .. ARF6 and ARL4D were cloned into the expression vector pET43a (Novagen). pACYC177/ET3d/yNMT, which encodes yeast ( Saccharomyces cerevisiae ) N -myristoyltransferase ( ) was used to myristoylate ARF6 and ARL4D in Escherichia coli .

    Article Title: INVOLVEMENT OF ENDOPLASMIC RETICULUM STRESS IN A NOVEL CLASSIC GALACTOSEMIA MODEL
    Article Snippet: Each sample was repeated three times and the mean value and standard deviation were calculated. .. Human inositol monophosphatase I (hIMPaseI) cDNA clone was purchased from Open Biosystems. cDNA was amplified by PCR and subcloned into the bacterial expression vector pET15b (Novagen). .. The hIMPase was over-expressed in Escherichia coli strain BL21(DE3) (Novagen) and purified using nickel-affinity chromatography (Ni-NTA, Qiagen, #1004493).

    Article Title: Identification of Phosphorylation Sites on Phosducin-like Protein by QTOF Mass Spectrometry
    Article Snippet: The product was cut with EcoRI and XbaI restriction endonucleases and was inserted into the pcDNA3.1/myc-HisB vector at the EcoRI and XbaI sites, generating an hPhLP construct with a c-myc epitope tag and a hexahistidine purification tag. .. The hPhLP-myc-His construct was then subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) by polymerase chain reaction amplification with the forward primer 5′–AA CCA ATC ATG ACC ACC CTT GAT GAT AAG TTG C and the reverse primer 5′- A CCA GGA TCC TCA ATG GTG ATG GTG ATG ATG ACC. .. The product was cut with PagI and BamHI restriction endonucleases and inserted into the pET15b vector at the NcoI and BamHI restriction sites.

    Article Title: Identification of functionally relevant histidine residues in the apoptotic nuclease CAD
    Article Snippet: To isolate the cDNA for human ICAD-L/DFF45 (hICAD-L), total RNA was extracted from HeLa cells with a RNeasy Mini Kit (Qiagen) and used for first-strand cDNA synthesis and subsequent amplification of the hICAD-L gene with the Access RT–PCR system (Promega). .. The coding region for hICAD-L (DFF45) was inserted in-frame as an Nco I– Sal I fragment into the Nco I and Xho I sites of the bacterial expression vector pET15b (Novagen). .. Hamster caspase 3 cDNA was a kind gift of Dr X. Wang (University of Texas Southwestern Medical Center at Dallas, Dallas, TX).

    Article Title: Defining the Interactions Between Intermediate Filaments and Desmosomes
    Article Snippet: To engineer recombinant desmoglein-tail, we used clone pDGK3C (generous gift of Dr. W.W. Franke) containing bovine Dsg1 cDNA. .. The Sca1–BsaA1 fragment, containing nucleotide residues 1592–3326, were subcloned into the NcoI–BamHI sites of bacterial expression vector Pet15b (Novagen, Inc., Madison, WI). .. This construct encoded 50 amino acids of extracellular and the entire transmembrane and cytoplasmic domains of Dsg1.

    Affinity Chromatography:

    Article Title: Toxoplasma DJ-1 Regulates Organelle Secretion by a Direct Interaction with Calcium-Dependent Protein Kinase 1
    Article Snippet: The amplified insertion was digested with NdeI and BamHI and cloned between these restriction sites in the bacterial expression vector pET15b (Novagen). .. The constructs were transformed into chemically competent E. coli strain BL21(DE3) (Novagen Merck, Darmstadt, Germany,) for protein expression.

    Article Title: Expression characteristics of PDEF support a role in breast and prostate cancer progression
    Article Snippet: The full-length open reading frame of PDEF cDNA (PDEF-full-length) and the cDNA encoding N-terminal 1 to 104 amino acids (PDEF-1-104) were PCR-amplified and subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) at the Nde I site. .. After confirmation of the orientation and sequence, E. coli BL21(DE3) cells were transformed by the resultant pET15b-PDEF-full-length or pET15b-PDEF-1-104 plasmids.

    Two Hybrid Screening:

    Article Title:
    Article Snippet: ARNO and its deletion mutant cDNA sequences were amplified by polymerase chain reaction (PCR) by using ARNO/pACT2 plasmid as a template (obtained from yeast two-hybrid screen) and oligonucleotide primers incorporating restriction sites. .. For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI).

    Produced:

    Article Title:
    Article Snippet: However, the effect of such dimerization-disrupting mutations on the biological activity of S100A4 is presently unknown. .. Wild type S100A4 cDNA was cloned into the NdeI/BamHI sites of bacterial expression vector pET15b (Novagen) and recombinant protein produced in Escherichia coli C41 ( ). .. The fraction containing the S100A4 recombinant protein was dialyzed against phosphate-buffered saline (PBS), and the purity of the S100A4 was checked by SDS-15% (w/v) polyacrylamide gel electrophoresis.

    Article Title: INVOLVEMENT OF ENDOPLASMIC RETICULUM STRESS IN A NOVEL CLASSIC GALACTOSEMIA MODEL
    Article Snippet: Human inositol monophosphatase I (hIMPaseI) cDNA clone was purchased from Open Biosystems. cDNA was amplified by PCR and subcloned into the bacterial expression vector pET15b (Novagen). .. The hIMPase was over-expressed in Escherichia coli strain BL21(DE3) (Novagen) and purified using nickel-affinity chromatography (Ni-NTA, Qiagen, #1004493).

    Article Title: Identification of functionally relevant histidine residues in the apoptotic nuclease CAD
    Article Snippet: The open reading frame for mCAD was inserted in-frame into the Nco I and Not I sites of pTriEx1 (Novagen) such that a coding region for an N-terminal His6 tag was produced at the 5′-end of the mCAD gene, resulting in plasmid pHis-mCAD. .. The coding region for hICAD-L (DFF45) was inserted in-frame as an Nco I– Sal I fragment into the Nco I and Xho I sites of the bacterial expression vector pET15b (Novagen).

    Concentration Assay:

    Article Title: Functional convergence of structurally distinct thioesterases from cyanobacteria and plants involved in phylloquinone biosynthesis
    Article Snippet: The genes for Slr0204 and AtDHNAT1 were cloned from their respective organisms into the bacterial expression vector pET15b (Novagen) between the Nde I and Xho I restriction sites. .. The genes for Slr0204 and AtDHNAT1 were cloned from their respective organisms into the bacterial expression vector pET15b (Novagen) between the Nde I and Xho I restriction sites.

    Article Title: Identification of Novel Small Molecule Inhibitors of 4-diphosphocytidyl-2-C-methyl-D-erythritol (CDP-ME) kinase of Gram-negative bacteria
    Article Snippet: The PCR products were sub-cloned into the bacterial expression vector pET15b ( Novagen ). .. Sequences of the PCR inserts were confirmed by DNA sequencing.

    Article Title: Folded or Not? Tracking Bet v 1 Conformation in Recombinant Allergen Preparations
    Article Snippet: The open reading frame of Bet v 1a optimized for codon usage of Escherichia coli was purchased from Geneart (Life Technologies, Thermo Fisher Scientific, Waltham, MA, U.S.A.) and cloned into bacterial expression vector pET15b (Novagen, Merck, Darmstadt, Germany) using the Clontech InFusion Kit (Mountain View, CA, U.S.A.). .. The open reading frame of Bet v 1a optimized for codon usage of Escherichia coli was purchased from Geneart (Life Technologies, Thermo Fisher Scientific, Waltham, MA, U.S.A.) and cloned into bacterial expression vector pET15b (Novagen, Merck, Darmstadt, Germany) using the Clontech InFusion Kit (Mountain View, CA, U.S.A.).

    CTG Assay:

    Article Title:
    Article Snippet: To generate ARNOC7A, seven basic charge amino acids in the polybasic c domain were replaced with alanine (386 RKKR ISV KKK QEQP399→386 AAAA ISV AAA QEQP399), by using a 3′ primer in which the basic residues were replaced by alanine codons (5′ CTC GAG TCA GGG CTG CTC CTG TGC TGC TGC GAC TGA AAT TGC TGC TGC TGC CGC TGC CAG CAT CTC ATA 3′). .. For production of recombinant His-tagged proteins, ARNO and ARNO(E156K) were subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI).

    Article Title: Identification of Phosphorylation Sites on Phosducin-like Protein by QTOF Mass Spectrometry
    Article Snippet: Human PhLP (hPhLP) cDNA was subcloned from a previous construct in the pCR3.1 vector (Invitrogen, Carlsbad, CA) by polymerase chain reaction into the pcDNA3.1/myc-His vector (Invitrogen) with the forward primer 5′–GGA AGA GAA TTC ATG ACC ACC CTT GAT GAT AAG TTG CTG and the reverse primer 5′–TTG TTC TAG AGC ATC TAT TTC CAG GTC GCT ATC CTC AC. .. The hPhLP-myc-His construct was then subcloned into the bacterial expression vector pET15b (Novagen, Madison, WI) by polymerase chain reaction amplification with the forward primer 5′–AA CCA ATC ATG ACC ACC CTT GAT GAT AAG TTG C and the reverse primer 5′- A CCA GGA TCC TCA ATG GTG ATG GTG ATG ATG ACC.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Millipore bacterial expression vector pet15b
    Bacterial Expression Vector Pet15b, supplied by Millipore, used in various techniques. Bioz Stars score: 97/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial expression vector pet15b/product/Millipore
    Average 97 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    bacterial expression vector pet15b - by Bioz Stars, 2020-01
    97/100 stars
      Buy from Supplier

    Image Search Results