antisense primers  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Oligo dT 12 18 Primer
    Description:
    Oligo dT 12 18 Primer is suitable for use in first strand cDNA synthesis with reverse transcriptase The primer hybridizes to the poly A tail of mRNA It is phosphorylated on the 5 end to facilitate cloning of cDNA Performance and Quality Testing Performance is evaluated in a first strand cDNA synthesis reaction
    Catalog Number:
    18418012
    Price:
    None
    Category:
    Oligos Primers Probes Nucleotides
    Applications:
    PCR & Real-Time PCR|RT-PCR|Reverse Transcription|Two-Step RT-PCR
    Buy from Supplier


    Structured Review

    Thermo Fisher antisense primers
    MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific <t>antisense</t> primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.
    Oligo dT 12 18 Primer is suitable for use in first strand cDNA synthesis with reverse transcriptase The primer hybridizes to the poly A tail of mRNA It is phosphorylated on the 5 end to facilitate cloning of cDNA Performance and Quality Testing Performance is evaluated in a first strand cDNA synthesis reaction
    https://www.bioz.com/result/antisense primers/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    antisense primers - by Bioz Stars, 2021-06
    99/100 stars

    Images

    1) Product Images from "Defective Infiltration of Natural Killer Cells in MICA/B-Positive Renal Cell Carcinoma Involves ?2-Integrin-Mediated Interaction 1"

    Article Title: Defective Infiltration of Natural Killer Cells in MICA/B-Positive Renal Cell Carcinoma Involves ?2-Integrin-Mediated Interaction 1

    Journal: Neoplasia (New York, N.Y.)

    doi:

    MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific antisense primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.
    Figure Legend Snippet: MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific antisense primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.

    Techniques Used: Amplification, Polymerase Chain Reaction, Staining, Fluorescence, Incubation, Flow Cytometry, Cytometry

    2) Product Images from "Expression patterns of the aquaporin gene family during renal development: influence of genetic variability"

    Article Title: Expression patterns of the aquaporin gene family during renal development: influence of genetic variability

    Journal: Pflugers Archiv

    doi: 10.1007/s00424-009-0667-x

    In situ hybridization for AQP isoforms in developing mouse kidneys. a Digoxigenin-labeled antisense probes detected AQP1, AQP7, and AQP11 mRNAs essentially in the cortex (proximal tubules) and faintly in the medulla, whereas AQP2, AQP3, and AQP4 mRNAs are detected in collecting ducts in developing (E17.5) and mature (AD) C57 mouse kidneys. b No signal was obtained with the antisense probes for AQP5, AQP9, AQP10, and AQP12
    Figure Legend Snippet: In situ hybridization for AQP isoforms in developing mouse kidneys. a Digoxigenin-labeled antisense probes detected AQP1, AQP7, and AQP11 mRNAs essentially in the cortex (proximal tubules) and faintly in the medulla, whereas AQP2, AQP3, and AQP4 mRNAs are detected in collecting ducts in developing (E17.5) and mature (AD) C57 mouse kidneys. b No signal was obtained with the antisense probes for AQP5, AQP9, AQP10, and AQP12

    Techniques Used: In Situ Hybridization, Labeling

    3) Product Images from "An imprinted transcript, antisense to Nesp, adds complexity to the cluster of imprinted genes at the mouse Gnas locus"

    Article Title: An imprinted transcript, antisense to Nesp, adds complexity to the cluster of imprinted genes at the mouse Gnas locus

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi:

    Summary of oppositely imprinted transcripts at the Gnas ); the orientation with respect to centromere and telomere is not known. Shaded blocks show exons exclusive to Nesp , the hatched block represents the exon specific for Gnasxl , and the solid block represents Gnas exon 2. Mat and Pat refer to maternally and paternally derived alleles, respectively. The maternally and paternally methylated regions represent the approximate positions of differentially methylated Hpa ). The maternally expressed Nesp transcript that extends into Gnas exon 2, the paternally expressed Gnasxl transcript that also extends into exon 2, and the paternally expressed transcript that lies antisense to Nesp are represented by arrows showing the direction of transcription; the Gnas transcripts are not shown. The figure is not to scale.
    Figure Legend Snippet: Summary of oppositely imprinted transcripts at the Gnas ); the orientation with respect to centromere and telomere is not known. Shaded blocks show exons exclusive to Nesp , the hatched block represents the exon specific for Gnasxl , and the solid block represents Gnas exon 2. Mat and Pat refer to maternally and paternally derived alleles, respectively. The maternally and paternally methylated regions represent the approximate positions of differentially methylated Hpa ). The maternally expressed Nesp transcript that extends into Gnas exon 2, the paternally expressed Gnasxl transcript that also extends into exon 2, and the paternally expressed transcript that lies antisense to Nesp are represented by arrows showing the direction of transcription; the Gnas transcripts are not shown. The figure is not to scale.

    Techniques Used: Blocking Assay, Derivative Assay, Methylation

    4) Product Images from "Epidermal Growth Factor Activates m-Calpain (Calpain II), at Least in Part, by Extracellular Signal-Regulated Kinase-Mediated Phosphorylation"

    Article Title: Epidermal Growth Factor Activates m-Calpain (Calpain II), at Least in Part, by Extracellular Signal-Regulated Kinase-Mediated Phosphorylation

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.24.6.2499-2512.2004

    EGF-induced calpain activity in S50A m-calpain-expressing cells. (A) Activity of S50A m-calpain was measured in the face of down-regulation of endogenous murine m-calpain. Antisense oligonucleotides were designed to be specific for murine m-calpain. These did not block the expression of S50A m-calpain, which is human in origin. Antisense treatment in the presence of EGF for 12 h was adequate to down-regulate endogenous m-calpain (lanes 3 and 4 [from the left]), and exogenous expression of S50A was not blocked (lanes 5 to 7; n = 3). (B) Calpain activity was measured in cells expressing S50A m-calpain with the substrate Boc-LM-CMAC (5 μM). Cells that possessed the S50A plasmid but that were not induced to express it were used as a control (no dexamethasone). Control cells were not treated with murine m-calpain antisense oligonucleotides. All other cells were induced with dexamethasone (2 μM) for 18 to 24 h and treated with murine m-calpain antisense oligonucleotides for the same time period. This produced conditions under which the activity of the S50A m-calpain construct could be measured. Control cells show normal EGF-induced calpain activity (indicated by increased fluorescence, equivalent to lightness of tone in micrographs). S50A-expressing cells do not exhibit EGF-induced calpain activity, and CI-1 and the MEK inhibitor PD98059 have no additional effects (images are representative; n = 3). (C) Calpain activity was determined by a calpain activity assay kit (BioVision). WT NR6 cells expressing wild-type (WT) or S50A human m-calpain-His were pretreated for 24 h with either antisense oligonucleotides against murine (mouse AS) or human (human AS) m-calpain to down-regulate either the endogenous murine or the exogenous human m-calpain and then treated with or without CI-1 and/or EGF. The cells were lysed, and the lysates were analyzed for calpain activity. The results from this assay correlate with those from the Boc assay showing that the mutation of serine 50 to alanine significantly reduces EGF-induced m-calpain activity ( P
    Figure Legend Snippet: EGF-induced calpain activity in S50A m-calpain-expressing cells. (A) Activity of S50A m-calpain was measured in the face of down-regulation of endogenous murine m-calpain. Antisense oligonucleotides were designed to be specific for murine m-calpain. These did not block the expression of S50A m-calpain, which is human in origin. Antisense treatment in the presence of EGF for 12 h was adequate to down-regulate endogenous m-calpain (lanes 3 and 4 [from the left]), and exogenous expression of S50A was not blocked (lanes 5 to 7; n = 3). (B) Calpain activity was measured in cells expressing S50A m-calpain with the substrate Boc-LM-CMAC (5 μM). Cells that possessed the S50A plasmid but that were not induced to express it were used as a control (no dexamethasone). Control cells were not treated with murine m-calpain antisense oligonucleotides. All other cells were induced with dexamethasone (2 μM) for 18 to 24 h and treated with murine m-calpain antisense oligonucleotides for the same time period. This produced conditions under which the activity of the S50A m-calpain construct could be measured. Control cells show normal EGF-induced calpain activity (indicated by increased fluorescence, equivalent to lightness of tone in micrographs). S50A-expressing cells do not exhibit EGF-induced calpain activity, and CI-1 and the MEK inhibitor PD98059 have no additional effects (images are representative; n = 3). (C) Calpain activity was determined by a calpain activity assay kit (BioVision). WT NR6 cells expressing wild-type (WT) or S50A human m-calpain-His were pretreated for 24 h with either antisense oligonucleotides against murine (mouse AS) or human (human AS) m-calpain to down-regulate either the endogenous murine or the exogenous human m-calpain and then treated with or without CI-1 and/or EGF. The cells were lysed, and the lysates were analyzed for calpain activity. The results from this assay correlate with those from the Boc assay showing that the mutation of serine 50 to alanine significantly reduces EGF-induced m-calpain activity ( P

    Techniques Used: Activity Assay, Expressing, Blocking Assay, Plasmid Preparation, Produced, Construct, Fluorescence, Mutagenesis

    Expression of the S50A m-calpain mutant inhibits EGF-induced motility and deadhesion in fibroblasts. (A) WT NR6 cells expressing the S50A mutant m-calpain were analyzed for their ability to migrate into a denuded space. The cells were pretreated for 24 h with either antisense oligonucleotides against murine (mouse AS) or human (human AS) m-calpain to down-regulate either the endogenous murine or the exogenous human m-calpain. A central swath was denuded in the confluent layer of cells, which were then treated with or without EGF (10 nM) in the presence of antisense oligonucleotides (20 μM) and incubated for 24 h. The area of the wound was measured, and the decreased area from the control (mouse antisense treatment only) was subtracted as background. The decreased area from the cells treated with human antisense oligonucleotides and EGF was set to 100%, and results for the other treatments are percentages of this value. The exogenous wild-type (WT) human m-calpain demonstrated the same EGF-induced motility as the endogenous murine m-calpain ( P was not significant). However, the S50A mutant m-calpain showed a significant decrease in motility compared to the endogenous murine m-calpain ( P
    Figure Legend Snippet: Expression of the S50A m-calpain mutant inhibits EGF-induced motility and deadhesion in fibroblasts. (A) WT NR6 cells expressing the S50A mutant m-calpain were analyzed for their ability to migrate into a denuded space. The cells were pretreated for 24 h with either antisense oligonucleotides against murine (mouse AS) or human (human AS) m-calpain to down-regulate either the endogenous murine or the exogenous human m-calpain. A central swath was denuded in the confluent layer of cells, which were then treated with or without EGF (10 nM) in the presence of antisense oligonucleotides (20 μM) and incubated for 24 h. The area of the wound was measured, and the decreased area from the control (mouse antisense treatment only) was subtracted as background. The decreased area from the cells treated with human antisense oligonucleotides and EGF was set to 100%, and results for the other treatments are percentages of this value. The exogenous wild-type (WT) human m-calpain demonstrated the same EGF-induced motility as the endogenous murine m-calpain ( P was not significant). However, the S50A mutant m-calpain showed a significant decrease in motility compared to the endogenous murine m-calpain ( P

    Techniques Used: Expressing, Mutagenesis, Incubation

    5) Product Images from "Differential Activation of Human Gingival Epithelial Cells and Monocytes by Porphyromonas gingivalis Fimbriae ▿"

    Article Title: Differential Activation of Human Gingival Epithelial Cells and Monocytes by Porphyromonas gingivalis Fimbriae ▿

    Journal: Infection and Immunity

    doi: 10.1128/IAI.01604-06

    P. gingivalis FimA does not influence TLR1, -2, and -6 expression in human gingival epithelial cells. HGECs were challenged with either P. gingivalis (P.g; MOI, 100:1) or FimA (10 μg/ml) for 4 h at 37°C. Real-time PCR was performed with an ABI 7500 system (Applied Biosystems). TaqMan probes and sense and antisense primers for gene expression of human TLR1, -2, and -6 were purchased from Applied Biosystems along with probes and primers for the human endogenous control, GAPDH. Using a Universal PCR Master Mix (Applied Biosystems), the reactions were carried out according to the manufacturer's protocol. The ratio of TLR2 (A), TLR1 (B), and TLR6 (C) mRNAs was normalized to GAPDH mRNA. Data are presented as the means ± standard deviations of triplicate determinations. NS, not statistically significant.
    Figure Legend Snippet: P. gingivalis FimA does not influence TLR1, -2, and -6 expression in human gingival epithelial cells. HGECs were challenged with either P. gingivalis (P.g; MOI, 100:1) or FimA (10 μg/ml) for 4 h at 37°C. Real-time PCR was performed with an ABI 7500 system (Applied Biosystems). TaqMan probes and sense and antisense primers for gene expression of human TLR1, -2, and -6 were purchased from Applied Biosystems along with probes and primers for the human endogenous control, GAPDH. Using a Universal PCR Master Mix (Applied Biosystems), the reactions were carried out according to the manufacturer's protocol. The ratio of TLR2 (A), TLR1 (B), and TLR6 (C) mRNAs was normalized to GAPDH mRNA. Data are presented as the means ± standard deviations of triplicate determinations. NS, not statistically significant.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    6) Product Images from "Effect of Herbal Formulation on Immune Response Enhancement in RAW 264.7 Macrophages"

    Article Title: Effect of Herbal Formulation on Immune Response Enhancement in RAW 264.7 Macrophages

    Journal: Biomolecules

    doi: 10.3390/biom10030424

    Effect of KM1608 on the expression of cytokines. RAW 264.7 cells were harvested 12 h post treatment with 0.5% DMSO (control) or KM1608 at the indicated concentrations. Total cellular RNA was isolated with TRIzol reagent and then reverse transcribed to cDNA. The reaction mixture was prepared by mixing cDNA with sense and antisense primers. PCR was performed using 45 amplification cycles. The relative gene expression levels were calculated by the ΔΔCq method. ∗ p
    Figure Legend Snippet: Effect of KM1608 on the expression of cytokines. RAW 264.7 cells were harvested 12 h post treatment with 0.5% DMSO (control) or KM1608 at the indicated concentrations. Total cellular RNA was isolated with TRIzol reagent and then reverse transcribed to cDNA. The reaction mixture was prepared by mixing cDNA with sense and antisense primers. PCR was performed using 45 amplification cycles. The relative gene expression levels were calculated by the ΔΔCq method. ∗ p

    Techniques Used: Expressing, Isolation, Polymerase Chain Reaction, Amplification

    Related Articles

    Synthesized:

    Article Title: Expression of Lewis-a glycans on polymorphonuclear leukocytes augments function by increasing transmigration
    Article Snippet: HL60 cells or human PMNs were lysed in TRIzol (Thermo Fisher Scientific) then subjected to phenol-chloroform extraction, according to the manufacturer’s protocol [ ]. .. RNA was digested with DNaseI (Ambion, Austin, TX, USA) to remove contamination with genomic DNA; then, DNA was synthesized by reverse transcription using oligo(dt12–18) primers and Superscript II reverse transcriptase (Thermo Fisher Scientific). .. Real-time PCR was performed with a MyIQ real-time PCR machine and SYBR Green supermix (Bio-Rad Laboratories, Hercules, CA, USA).

    Isolation:

    Article Title: Developmental and Immune Role of a Novel Multiple Cysteine Cluster TLR From Eisenia andrei Earthworms
    Article Snippet: RNA Isolation, cDNA Synthesis, qPCR, Preparation of Plasmids Total RNA was isolated from coelomocytes, from various tissues or from whole body tissues of the individual earthworms, using TRIZOL reagent (Life Technologies) according to the manufacturer's protocol. .. RNA Isolation, cDNA Synthesis, qPCR, Preparation of PlasmidsTotal RNA was isolated from coelomocytes, from various tissues or from whole body tissues of the individual earthworms, using TRIZOL reagent (Life Technologies) according to the manufacturer's protocol. .. One microgram of DNAse I treated total RNA was reverse-transcribed using the Oligo(dT)12–18 primer and Superscript IV Reverse Transcriptase (Life Technologies) and subsequently used in a PCR reaction.

    Real-time Polymerase Chain Reaction:

    Article Title: Developmental and Immune Role of a Novel Multiple Cysteine Cluster TLR From Eisenia andrei Earthworms
    Article Snippet: RNA Isolation, cDNA Synthesis, qPCR, Preparation of Plasmids Total RNA was isolated from coelomocytes, from various tissues or from whole body tissues of the individual earthworms, using TRIZOL reagent (Life Technologies) according to the manufacturer's protocol. .. RNA Isolation, cDNA Synthesis, qPCR, Preparation of PlasmidsTotal RNA was isolated from coelomocytes, from various tissues or from whole body tissues of the individual earthworms, using TRIZOL reagent (Life Technologies) according to the manufacturer's protocol. .. One microgram of DNAse I treated total RNA was reverse-transcribed using the Oligo(dT)12–18 primer and Superscript IV Reverse Transcriptase (Life Technologies) and subsequently used in a PCR reaction.

    Produced:

    Article Title: Defective Infiltration of Natural Killer Cells in MICA/B-Positive Renal Cell Carcinoma Involves ?2-Integrin-Mediated Interaction 1
    Article Snippet: Total RNA was extracted from 3 x 106 cultured cells using a Qiagen (Basel, Switzerland) RNeasy kit. .. Complementary DNA (cDNA) first strand was produced using a SuperScript First-Strand Synthesis System using oligo(dt)12–18 antisense primers (Invitrogen, Lucerne, Switzerland). .. MICA and MICB transcripts were amplified from cDNA by 30 cycles of polymerase chain reaction in the presence of the following primers: MICA/MICB sense primer (5′ACACCCAGCAGTGGGGGGAT3′); MICA antisense primer (5′GCAGGGAATTGAATCCCAGCT3′); and MICB antisense primer (5′AGCAGTCGTGAGTTTGCCCAC-3′) [ ].

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Thermo Fisher gli1
    Conditional KO of Gli2 or overexpression of the GLI3 repressor in <t>GLI1</t> + cells ameliorates kidney fibrosis following UUO.
    Gli1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gli1/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gli1 - by Bioz Stars, 2021-06
    97/100 stars
      Buy from Supplier

    99
    Thermo Fisher antisense primers
    MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific <t>antisense</t> primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.
    Antisense Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense primers/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    antisense primers - by Bioz Stars, 2021-06
    99/100 stars
      Buy from Supplier

    97
    Thermo Fisher mcp 1
    Effect of ezetimibe on monocyte migration. Cells were pre-treated with serial concentrations of ezetimibe (Eze), simvastatin (Simva) or the combination (Eze + Simva) for 2 h and then chemotaxis was induced by monocyte chemoattractant protein-1 <t>(MCP-1)</t>
    Mcp 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mcp 1/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mcp 1 - by Bioz Stars, 2021-06
    97/100 stars
      Buy from Supplier

    86
    Thermo Fisher antisense mir 147a
    CAPN2 is responsible for the oncogenic function of hnRNPK/ LINC00263 <t>/miR-147a.</t> a By comparing RNA sequencing data and miR-147a predicted target genes (TargetScan v7), eight genes were selected as putative targets of hnRNPK/ LINC00263 /miR-147a. b To check whether the interaction of hnRNPK with CAPN2 mRNA is required for the regulation of its expression, an RNP-IP experiment was performed. The levels of CAPN2 mRNA and LINC00263 in each IP material were determined by RT-qPCR analysis. c – g Following transfection of HeLa cells with pre-miR-147a (for overexpression, c , e , and g ) or anti-miR-147a (for inhibition, d and f ), the levels of CAPN2 protein and mRNA were determined by Western blot and RT-qPCR analyses, respectively. To examine whether miR-147a directly binds to the 3′UTR of CAPN2 mRNA, Ago2 RNP-IP ( e , f ) and luciferase reporter assay ( g ) were performed. Detailed information of luciferase reporter vector is presented in Supplementary Fig. 7c . h Protein and mRNA expression of CAPN2 in hnRNPK- and LINC00263 -silenced cells were determined by Western blot and RT-qPCR analyses, respectively. i To examine whether knockdown of hnRNPK or LINC00263 influences the interaction between miR-147a and CAPN2 mRNA, Ago2 RNP-IP assay was performed as described in “Materials and methods”. j – m The effect of CAPN2 silencing on malignant phenotypes including invasiveness ( k ), proliferation ( l ), and clonogenicity ( m ) were investigated. The efficiency of CAPN2 silencing was determined by Western blot analysis ( j ). Bars on microscopic images represent 100 μm. Statistical analyses were performed using the Student’s t test using three independent experiments (* p
    Antisense Mir 147a, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense mir 147a/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    antisense mir 147a - by Bioz Stars, 2021-06
    86/100 stars
      Buy from Supplier

    Image Search Results


    Conditional KO of Gli2 or overexpression of the GLI3 repressor in GLI1 + cells ameliorates kidney fibrosis following UUO.

    Journal: The Journal of Clinical Investigation

    Article Title: Pharmacological GLI2 inhibition prevents myofibroblast cell-cycle progression and reduces kidney fibrosis

    doi: 10.1172/JCI74929

    Figure Lengend Snippet: Conditional KO of Gli2 or overexpression of the GLI3 repressor in GLI1 + cells ameliorates kidney fibrosis following UUO.

    Article Snippet: For siRNA experiments, cells were transfected with either siRNA directed against Gli1 (Life Technologies, siRNA ID s66723; primer sequences: sense: 5′-GCAGGUCUCCUAUCCUGAUTT-3′, antisense: 5′-AUCAGGAUAGGAGACCUGCTG-3′); Gli2 (Life Technologies, siRNA ID s66726; primer sequences: sense: 5′-GGAAAACUUCAACAAUACATT-3′, antisense: 5′-UGUAUUGUUGAAGUUUUCCAG-3′), or siRNA against both Gli1 and Gli2 .

    Techniques: Over Expression

    Conditional KO of Gli2 or overexpression of the GLI3 repressor in GLI1 + cells induces myofibroblast-specific cell-cycle arrest.

    Journal: The Journal of Clinical Investigation

    Article Title: Pharmacological GLI2 inhibition prevents myofibroblast cell-cycle progression and reduces kidney fibrosis

    doi: 10.1172/JCI74929

    Figure Lengend Snippet: Conditional KO of Gli2 or overexpression of the GLI3 repressor in GLI1 + cells induces myofibroblast-specific cell-cycle arrest.

    Article Snippet: For siRNA experiments, cells were transfected with either siRNA directed against Gli1 (Life Technologies, siRNA ID s66723; primer sequences: sense: 5′-GCAGGUCUCCUAUCCUGAUTT-3′, antisense: 5′-AUCAGGAUAGGAGACCUGCTG-3′); Gli2 (Life Technologies, siRNA ID s66726; primer sequences: sense: 5′-GGAAAACUUCAACAAUACATT-3′, antisense: 5′-UGUAUUGUUGAAGUUUUCCAG-3′), or siRNA against both Gli1 and Gli2 .

    Techniques: Over Expression

    Lowering GLI2, but not GLI1, levels by RNAi induces cell-cycle arrest of MSC-like cells in vitro.

    Journal: The Journal of Clinical Investigation

    Article Title: Pharmacological GLI2 inhibition prevents myofibroblast cell-cycle progression and reduces kidney fibrosis

    doi: 10.1172/JCI74929

    Figure Lengend Snippet: Lowering GLI2, but not GLI1, levels by RNAi induces cell-cycle arrest of MSC-like cells in vitro.

    Article Snippet: For siRNA experiments, cells were transfected with either siRNA directed against Gli1 (Life Technologies, siRNA ID s66723; primer sequences: sense: 5′-GCAGGUCUCCUAUCCUGAUTT-3′, antisense: 5′-AUCAGGAUAGGAGACCUGCTG-3′); Gli2 (Life Technologies, siRNA ID s66726; primer sequences: sense: 5′-GGAAAACUUCAACAAUACATT-3′, antisense: 5′-UGUAUUGUUGAAGUUUUCCAG-3′), or siRNA against both Gli1 and Gli2 .

    Techniques: In Vitro

    MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific antisense primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.

    Journal: Neoplasia (New York, N.Y.)

    Article Title: Defective Infiltration of Natural Killer Cells in MICA/B-Positive Renal Cell Carcinoma Involves ?2-Integrin-Mediated Interaction 1

    doi:

    Figure Lengend Snippet: MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific antisense primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.

    Article Snippet: Complementary DNA (cDNA) first strand was produced using a SuperScript First-Strand Synthesis System using oligo(dt)12–18 antisense primers (Invitrogen, Lucerne, Switzerland).

    Techniques: Amplification, Polymerase Chain Reaction, Staining, Fluorescence, Incubation, Flow Cytometry, Cytometry

    Effect of ezetimibe on monocyte migration. Cells were pre-treated with serial concentrations of ezetimibe (Eze), simvastatin (Simva) or the combination (Eze + Simva) for 2 h and then chemotaxis was induced by monocyte chemoattractant protein-1 (MCP-1)

    Journal: British Journal of Pharmacology

    Article Title: Ezetimibe reduces plaque inflammation in a rabbit model of atherosclerosis and inhibits monocyte migration in addition to its lipid-lowering effect

    doi: 10.1111/j.1476-5381.2008.00091.x

    Figure Lengend Snippet: Effect of ezetimibe on monocyte migration. Cells were pre-treated with serial concentrations of ezetimibe (Eze), simvastatin (Simva) or the combination (Eze + Simva) for 2 h and then chemotaxis was induced by monocyte chemoattractant protein-1 (MCP-1)

    Article Snippet: The PCR primers and TaqMan probe for MCP-1 (sense primer: 5′-GCTCATAGCAGTCGCCTTCAG-3′; antisense primer: 5′-GTGAATGTATAGCAGCAGGTGACT-3′; sense probe: 5′-TCCCATGTGCTTGCCC-3′) were designed using PrimerExpress software (Applied Biosystems) according to the rabbit MCP-1 sequence (GenBank accession number ).

    Techniques: Migration, Chemotaxis Assay

    Immunolocalization of monocyte chemoattractant protein-1 (MCP-1) on femoral arteries from normolipidemic diet (ND, A), untreated (B), ezetimibe-treated (Eze, C), simvastatin-treated (Simva, D) and ezetimibe + simvastatin-treated (Eze + Simva, E) rabbits.

    Journal: British Journal of Pharmacology

    Article Title: Ezetimibe reduces plaque inflammation in a rabbit model of atherosclerosis and inhibits monocyte migration in addition to its lipid-lowering effect

    doi: 10.1111/j.1476-5381.2008.00091.x

    Figure Lengend Snippet: Immunolocalization of monocyte chemoattractant protein-1 (MCP-1) on femoral arteries from normolipidemic diet (ND, A), untreated (B), ezetimibe-treated (Eze, C), simvastatin-treated (Simva, D) and ezetimibe + simvastatin-treated (Eze + Simva, E) rabbits.

    Article Snippet: The PCR primers and TaqMan probe for MCP-1 (sense primer: 5′-GCTCATAGCAGTCGCCTTCAG-3′; antisense primer: 5′-GTGAATGTATAGCAGCAGGTGACT-3′; sense probe: 5′-TCCCATGTGCTTGCCC-3′) were designed using PrimerExpress software (Applied Biosystems) according to the rabbit MCP-1 sequence (GenBank accession number ).

    Techniques:

    CAPN2 is responsible for the oncogenic function of hnRNPK/ LINC00263 /miR-147a. a By comparing RNA sequencing data and miR-147a predicted target genes (TargetScan v7), eight genes were selected as putative targets of hnRNPK/ LINC00263 /miR-147a. b To check whether the interaction of hnRNPK with CAPN2 mRNA is required for the regulation of its expression, an RNP-IP experiment was performed. The levels of CAPN2 mRNA and LINC00263 in each IP material were determined by RT-qPCR analysis. c – g Following transfection of HeLa cells with pre-miR-147a (for overexpression, c , e , and g ) or anti-miR-147a (for inhibition, d and f ), the levels of CAPN2 protein and mRNA were determined by Western blot and RT-qPCR analyses, respectively. To examine whether miR-147a directly binds to the 3′UTR of CAPN2 mRNA, Ago2 RNP-IP ( e , f ) and luciferase reporter assay ( g ) were performed. Detailed information of luciferase reporter vector is presented in Supplementary Fig. 7c . h Protein and mRNA expression of CAPN2 in hnRNPK- and LINC00263 -silenced cells were determined by Western blot and RT-qPCR analyses, respectively. i To examine whether knockdown of hnRNPK or LINC00263 influences the interaction between miR-147a and CAPN2 mRNA, Ago2 RNP-IP assay was performed as described in “Materials and methods”. j – m The effect of CAPN2 silencing on malignant phenotypes including invasiveness ( k ), proliferation ( l ), and clonogenicity ( m ) were investigated. The efficiency of CAPN2 silencing was determined by Western blot analysis ( j ). Bars on microscopic images represent 100 μm. Statistical analyses were performed using the Student’s t test using three independent experiments (* p

    Journal: Cell Death & Disease

    Article Title: hnRNPK-regulated LINC00263 promotes malignant phenotypes through miR-147a/CAPN2

    doi: 10.1038/s41419-021-03575-1

    Figure Lengend Snippet: CAPN2 is responsible for the oncogenic function of hnRNPK/ LINC00263 /miR-147a. a By comparing RNA sequencing data and miR-147a predicted target genes (TargetScan v7), eight genes were selected as putative targets of hnRNPK/ LINC00263 /miR-147a. b To check whether the interaction of hnRNPK with CAPN2 mRNA is required for the regulation of its expression, an RNP-IP experiment was performed. The levels of CAPN2 mRNA and LINC00263 in each IP material were determined by RT-qPCR analysis. c – g Following transfection of HeLa cells with pre-miR-147a (for overexpression, c , e , and g ) or anti-miR-147a (for inhibition, d and f ), the levels of CAPN2 protein and mRNA were determined by Western blot and RT-qPCR analyses, respectively. To examine whether miR-147a directly binds to the 3′UTR of CAPN2 mRNA, Ago2 RNP-IP ( e , f ) and luciferase reporter assay ( g ) were performed. Detailed information of luciferase reporter vector is presented in Supplementary Fig. 7c . h Protein and mRNA expression of CAPN2 in hnRNPK- and LINC00263 -silenced cells were determined by Western blot and RT-qPCR analyses, respectively. i To examine whether knockdown of hnRNPK or LINC00263 influences the interaction between miR-147a and CAPN2 mRNA, Ago2 RNP-IP assay was performed as described in “Materials and methods”. j – m The effect of CAPN2 silencing on malignant phenotypes including invasiveness ( k ), proliferation ( l ), and clonogenicity ( m ) were investigated. The efficiency of CAPN2 silencing was determined by Western blot analysis ( j ). Bars on microscopic images represent 100 μm. Statistical analyses were performed using the Student’s t test using three independent experiments (* p

    Article Snippet: Precursor miR-147a (pre-miR-147a: PM10020) and antisense miR-147a (anti-miR-147a: AM10020) were purchased from Ambion (Ambion, Thermo Fisher Scientific, Waltham, MA) and used for overexpression or inhibition of miR-147a, respectively, using Lipofectamine2000 (Invitrogen).

    Techniques: RNA Sequencing Assay, Expressing, Quantitative RT-PCR, Transfection, Over Expression, Inhibition, Western Blot, Luciferase, Reporter Assay, Plasmid Preparation

    hnRNPK/ LINC00263 /miR-147a/CAPN2 is a promising target for the development of cancer therapeutics. To expand our findings to various types of cancer, we checked whether the regulatory mechanism of hnRNPK/ LINC00263 /miR-147a/CAPN2 is applicable to various types of cancers. a The relationship between the expression of HNRNPK mRNA and LINC00263 was examined in lung cancer cells by comparing them to the levels in WI-38 cells. The levels of HNRNPK mRNA and LINC00263 in WI-38, H460, and H1299 were determined by RT-qPCR analysis. b To determine whether hnRNPK regulates LINC00263 , the level of LINC00263 was analyzed by RT-qPCR analysis in hnRNPK-silenced lung cancer cells. c Regulation of CAPN2 by hnRNPK and LINC00263 was verified by assessing the level of CAPN2 mRNA in hnRNPK- or LINC00263 -silenced lung cancer cells. d – h To examine whether hnRNPK/ LINC00263 /miR-147a/CAPN2 axis regulates the invasive and clonogenic abilities, H460 and H1299 cells were transfected with siRNA targeting HNRNPK mRNA or LINC00263 , or pre-miR-147a. The level of CAPN2 protein was determined by We stern blot analysis ( d ). Invasiveness ( e , g ) and colony-forming ability ( f , h ) were examined as described in “Materials and methods”. i The effect of hnRNPK/ LINC00263 /miR-147a on CAPN2 expression was evaluated in various cancer cells including DLD1, LoVo, A375P, T98G, and A172. The expression level of CAPN2 and hnRNPK were determined by Western blot analysis. Bars on microscopic images represent 100 μm. Statistical analyses were performed using the Student’s t test using three independent experiments (* p

    Journal: Cell Death & Disease

    Article Title: hnRNPK-regulated LINC00263 promotes malignant phenotypes through miR-147a/CAPN2

    doi: 10.1038/s41419-021-03575-1

    Figure Lengend Snippet: hnRNPK/ LINC00263 /miR-147a/CAPN2 is a promising target for the development of cancer therapeutics. To expand our findings to various types of cancer, we checked whether the regulatory mechanism of hnRNPK/ LINC00263 /miR-147a/CAPN2 is applicable to various types of cancers. a The relationship between the expression of HNRNPK mRNA and LINC00263 was examined in lung cancer cells by comparing them to the levels in WI-38 cells. The levels of HNRNPK mRNA and LINC00263 in WI-38, H460, and H1299 were determined by RT-qPCR analysis. b To determine whether hnRNPK regulates LINC00263 , the level of LINC00263 was analyzed by RT-qPCR analysis in hnRNPK-silenced lung cancer cells. c Regulation of CAPN2 by hnRNPK and LINC00263 was verified by assessing the level of CAPN2 mRNA in hnRNPK- or LINC00263 -silenced lung cancer cells. d – h To examine whether hnRNPK/ LINC00263 /miR-147a/CAPN2 axis regulates the invasive and clonogenic abilities, H460 and H1299 cells were transfected with siRNA targeting HNRNPK mRNA or LINC00263 , or pre-miR-147a. The level of CAPN2 protein was determined by We stern blot analysis ( d ). Invasiveness ( e , g ) and colony-forming ability ( f , h ) were examined as described in “Materials and methods”. i The effect of hnRNPK/ LINC00263 /miR-147a on CAPN2 expression was evaluated in various cancer cells including DLD1, LoVo, A375P, T98G, and A172. The expression level of CAPN2 and hnRNPK were determined by Western blot analysis. Bars on microscopic images represent 100 μm. Statistical analyses were performed using the Student’s t test using three independent experiments (* p

    Article Snippet: Precursor miR-147a (pre-miR-147a: PM10020) and antisense miR-147a (anti-miR-147a: AM10020) were purchased from Ambion (Ambion, Thermo Fisher Scientific, Waltham, MA) and used for overexpression or inhibition of miR-147a, respectively, using Lipofectamine2000 (Invitrogen).

    Techniques: Expressing, Quantitative RT-PCR, Transfection, Western Blot

    Repression of malignant phenotypes following knockdown of hnRNPK and LINC00263 is restored by inhibition of miR-147a or ectopic expression of CAPN2. a – e To examine whether inhibition of miR-147a restores the malignant capabilities, siRNAs for hnRNPK or LINC00263 were introduced into HeLa cells with control miRNA or anti-miR-147a. Following isolation of total RNA, the level of miR-147a was determined by RT-qPCR analysis ( a ). Ago2 RNP-IP experiment was performed using the cytoplasmic lysates. The level of CAPN2 mRNA in Ago2 IP material was determined by RT-qPCR analysis ( b ). The expression levels of CAPN2 protein and mRNA were determined by Western blot and RT-qPCR analyses, respectively ( c ). Invasiveness ( d ) and colony-forming ability ( e ) were examined as described in “Materials and methods”. f – h For the rescue experiments, CAPN2 was ectopically overexpressed in hnRNPK- or LINC00263 -silenced HeLa cells. The protein level of CAPN2 was determined by Western blot analysis ( f ). Invasiveness ( g ) and colony-forming ability ( h ) were examined as described in “Materials and methods”. Bars on microscopic images represent 100 μm. Statistical analyses were performed using the Student’s t test using three independent experiments (* p

    Journal: Cell Death & Disease

    Article Title: hnRNPK-regulated LINC00263 promotes malignant phenotypes through miR-147a/CAPN2

    doi: 10.1038/s41419-021-03575-1

    Figure Lengend Snippet: Repression of malignant phenotypes following knockdown of hnRNPK and LINC00263 is restored by inhibition of miR-147a or ectopic expression of CAPN2. a – e To examine whether inhibition of miR-147a restores the malignant capabilities, siRNAs for hnRNPK or LINC00263 were introduced into HeLa cells with control miRNA or anti-miR-147a. Following isolation of total RNA, the level of miR-147a was determined by RT-qPCR analysis ( a ). Ago2 RNP-IP experiment was performed using the cytoplasmic lysates. The level of CAPN2 mRNA in Ago2 IP material was determined by RT-qPCR analysis ( b ). The expression levels of CAPN2 protein and mRNA were determined by Western blot and RT-qPCR analyses, respectively ( c ). Invasiveness ( d ) and colony-forming ability ( e ) were examined as described in “Materials and methods”. f – h For the rescue experiments, CAPN2 was ectopically overexpressed in hnRNPK- or LINC00263 -silenced HeLa cells. The protein level of CAPN2 was determined by Western blot analysis ( f ). Invasiveness ( g ) and colony-forming ability ( h ) were examined as described in “Materials and methods”. Bars on microscopic images represent 100 μm. Statistical analyses were performed using the Student’s t test using three independent experiments (* p

    Article Snippet: Precursor miR-147a (pre-miR-147a: PM10020) and antisense miR-147a (anti-miR-147a: AM10020) were purchased from Ambion (Ambion, Thermo Fisher Scientific, Waltham, MA) and used for overexpression or inhibition of miR-147a, respectively, using Lipofectamine2000 (Invitrogen).

    Techniques: Inhibition, Expressing, Isolation, Quantitative RT-PCR, Western Blot

    The ability to sponge miR-147a is required for the oncogenic function of LINC00263 . a , b HeLa cells were transfected with HNRNPK siRNA and/or a LINC00263 expression vector. The expression levels of CAPN2 protein ( a ) and CAPN2 mRNA ( b ) were determined by Western blot and RT-qPCR analyses, respectively. c – e LINC00263 expression vectors harboring mutant sequences of both miR-147a MREs were constructed. As with constructing the luciferase reporter vectors, four nucleotides of each miR-147a MRE in LINC00263 were changed to block the binding of miR-147a. c The invasive and clonogenic effects of three mutated LINC00263 (miR-147a MRE mutant #1, #2, and #1/#2) were determined as described in “Material and methods”. d The expression levels of CAPN2 protein and CAPN2 mRNA were determined by Western blot and RT-qPCR analyses, respectively. e Effect of mutated LINC00263 on miR-147a expression was assessed by RT-qPCR. Statistical analyses were performed using the Student’s t test using three independent experiments (* p

    Journal: Cell Death & Disease

    Article Title: hnRNPK-regulated LINC00263 promotes malignant phenotypes through miR-147a/CAPN2

    doi: 10.1038/s41419-021-03575-1

    Figure Lengend Snippet: The ability to sponge miR-147a is required for the oncogenic function of LINC00263 . a , b HeLa cells were transfected with HNRNPK siRNA and/or a LINC00263 expression vector. The expression levels of CAPN2 protein ( a ) and CAPN2 mRNA ( b ) were determined by Western blot and RT-qPCR analyses, respectively. c – e LINC00263 expression vectors harboring mutant sequences of both miR-147a MREs were constructed. As with constructing the luciferase reporter vectors, four nucleotides of each miR-147a MRE in LINC00263 were changed to block the binding of miR-147a. c The invasive and clonogenic effects of three mutated LINC00263 (miR-147a MRE mutant #1, #2, and #1/#2) were determined as described in “Material and methods”. d The expression levels of CAPN2 protein and CAPN2 mRNA were determined by Western blot and RT-qPCR analyses, respectively. e Effect of mutated LINC00263 on miR-147a expression was assessed by RT-qPCR. Statistical analyses were performed using the Student’s t test using three independent experiments (* p

    Article Snippet: Precursor miR-147a (pre-miR-147a: PM10020) and antisense miR-147a (anti-miR-147a: AM10020) were purchased from Ambion (Ambion, Thermo Fisher Scientific, Waltham, MA) and used for overexpression or inhibition of miR-147a, respectively, using Lipofectamine2000 (Invitrogen).

    Techniques: Transfection, Expressing, Plasmid Preparation, Western Blot, Quantitative RT-PCR, Mutagenesis, Construct, Luciferase, Blocking Assay, Binding Assay

    LINC00263 functions as ceRNA for miR-147a. a , b Cellular fractionation assay was performed to check the localization of LINC00263 . To ensure the purity of the fractions, the levels of α-tubulin (cytosolic marker) and lamin B (nuclear marker) were analyzed by Western blot analysis ( a ). The levels of LINC00263 , 18S , GAPDH , and ACTB mRNA in each fraction were determined by RT-qPCR analysis ( b ). c To check whether LINC00263 is involved in miRISC, Ago2 RNP-IP was performed using a specific antibody. The level of LINC00263 in control IgG and Ago2 IP materials was determined by RT-qPCR analysis and normalized to the level of GAPDH mRNA. d – f To screen for LINC00263 -associated miRNAs, antisense oligonucleotide pull-down (ASO PD) was performed. A schematic of the experimental design is shown ( d ). Detailed information of the ASO sequences for LacZ (control) and LINC00263 was provided in Supplementary Fig. 4a . The efficiency of ASO PD was examined by comparing the level of LINC00263 in ASO PD materials ( e ). Small RNA sequencing was performed with RNAs isolated from ASO PD materials. miRNAs with higher expression in LINC00263 ASO PD are listed ( f and Supplementary fig. 4b ). g Quantification of copy numbers of LINC00263 and miR-147a (copy number per cell) was performed by RT-qPCR and ddPCR analyses. h – k HeLa cells were transfected with pre-miR-147a (for overexpression, h and j ) or anti-miR-147a (for inhibition, i and k ). Direct association of LINC00263 with miR-147a-involved miRISC was analyzed by Ago2 RNP-IP ( h , i ) and the level of LINC00263 was determined by RT-qPCR analysis ( j , k ). l Following the knockdown of hnRNPK and LINC00263 , the level of miR-147a was determined by RT-qPCR analysis. m Bioinformatic analyses revealed that two MREs of miR-147a exist in the LINC00263 sequence (Supplementary Fig. 7a, b ). To examine the sequence-specific interaction, luciferase reporter vectors containing wild-type or mutant sequences of miR-147a MREs were constructed. Following overexpression of miR-147a, the luciferase activity was assessed as described in “Materials and methods”. n – s To investigate the effect of miR-147a on malignant capabilities, pre-miR-147a ( n , p , and r ) or anti-miR-147a ( o , q , and s ) were introduced into HeLa cells. Malignant phenotypes including invasiveness ( n , o ), proliferation rate ( p , q ), and clonogenicity ( r , s ) were examined as described in “Materials and methods”. Bars on microscopic images represent 100 μm. Statistical analyses were performed using the Student’s t test using three independent experiments (* p

    Journal: Cell Death & Disease

    Article Title: hnRNPK-regulated LINC00263 promotes malignant phenotypes through miR-147a/CAPN2

    doi: 10.1038/s41419-021-03575-1

    Figure Lengend Snippet: LINC00263 functions as ceRNA for miR-147a. a , b Cellular fractionation assay was performed to check the localization of LINC00263 . To ensure the purity of the fractions, the levels of α-tubulin (cytosolic marker) and lamin B (nuclear marker) were analyzed by Western blot analysis ( a ). The levels of LINC00263 , 18S , GAPDH , and ACTB mRNA in each fraction were determined by RT-qPCR analysis ( b ). c To check whether LINC00263 is involved in miRISC, Ago2 RNP-IP was performed using a specific antibody. The level of LINC00263 in control IgG and Ago2 IP materials was determined by RT-qPCR analysis and normalized to the level of GAPDH mRNA. d – f To screen for LINC00263 -associated miRNAs, antisense oligonucleotide pull-down (ASO PD) was performed. A schematic of the experimental design is shown ( d ). Detailed information of the ASO sequences for LacZ (control) and LINC00263 was provided in Supplementary Fig. 4a . The efficiency of ASO PD was examined by comparing the level of LINC00263 in ASO PD materials ( e ). Small RNA sequencing was performed with RNAs isolated from ASO PD materials. miRNAs with higher expression in LINC00263 ASO PD are listed ( f and Supplementary fig. 4b ). g Quantification of copy numbers of LINC00263 and miR-147a (copy number per cell) was performed by RT-qPCR and ddPCR analyses. h – k HeLa cells were transfected with pre-miR-147a (for overexpression, h and j ) or anti-miR-147a (for inhibition, i and k ). Direct association of LINC00263 with miR-147a-involved miRISC was analyzed by Ago2 RNP-IP ( h , i ) and the level of LINC00263 was determined by RT-qPCR analysis ( j , k ). l Following the knockdown of hnRNPK and LINC00263 , the level of miR-147a was determined by RT-qPCR analysis. m Bioinformatic analyses revealed that two MREs of miR-147a exist in the LINC00263 sequence (Supplementary Fig. 7a, b ). To examine the sequence-specific interaction, luciferase reporter vectors containing wild-type or mutant sequences of miR-147a MREs were constructed. Following overexpression of miR-147a, the luciferase activity was assessed as described in “Materials and methods”. n – s To investigate the effect of miR-147a on malignant capabilities, pre-miR-147a ( n , p , and r ) or anti-miR-147a ( o , q , and s ) were introduced into HeLa cells. Malignant phenotypes including invasiveness ( n , o ), proliferation rate ( p , q ), and clonogenicity ( r , s ) were examined as described in “Materials and methods”. Bars on microscopic images represent 100 μm. Statistical analyses were performed using the Student’s t test using three independent experiments (* p

    Article Snippet: Precursor miR-147a (pre-miR-147a: PM10020) and antisense miR-147a (anti-miR-147a: AM10020) were purchased from Ambion (Ambion, Thermo Fisher Scientific, Waltham, MA) and used for overexpression or inhibition of miR-147a, respectively, using Lipofectamine2000 (Invitrogen).

    Techniques: Cell Fractionation, Marker, Western Blot, Quantitative RT-PCR, Allele-specific Oligonucleotide, RNA Sequencing Assay, Isolation, Expressing, Transfection, Over Expression, Inhibition, Sequencing, Luciferase, Mutagenesis, Construct, Activity Assay