polylysine  (Roche)


Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Roche polylysine
    Polylysine, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 508 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polylysine/product/Roche
    Average 92 stars, based on 508 article reviews
    Price from $9.99 to $1999.99
    polylysine - by Bioz Stars, 2020-09
    92/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: A Region of the Nucleosome Required for Multiple Types of Transcriptional Silencing in Saccharomyces cerevisiae
    Article Snippet: .. To generate mutations in histones H3 and H4, the gene of interest was amplified using error-prone PCR [0.2 mM dNTPs, 0.5 μM primers, 1.2 mM MnCl2 , 5 ng plasmid pDM18, and 0.75 unit Taq (Roche) (5 units/μl) in 50 μl denatured for 3 min at 94°, followed by 32 cycles of 15 sec at 94°, 15 sec of 55°, and 2 min at 68°]. .. The gene (H3) was amplified from pDM18 using primers (GGCTATGGCTCGGTGTCAAA) and (GCCCCGCAATTATGTCTGTAAA), and the gene (H4) was amplified using primers (TACATACGTGTTTGTGCGTAT) and (CCAGGGTTTTCCCAGTCAC).

    Mutagenesis:

    Article Title: Dissecting RNA folding by nucleotide analog interference mapping (NAIM)
    Article Snippet: .. It is supplied with a 5× transcription buffer and 0.1 M DTT stock solution 5× Mutant (Y639F) T7 RNA polymerase transcription buffer (EpiCentre) RNase inhibitor (40 U μl−1 ; Roche) Alkaline phosphatase (20 U μl−1 ; Roche) 10× Dephosphorylation buffer (Roche) T4-polynucleotide kinase (PNK, 10 U μl−1 ; NEB) 10× T4-PNK buffer (NEB) DNA polymerase I Klenow fragment exo− (2 U μl−1 ; Roche) 10× Nucleotide analog solution (Glen Research) NTPs (100 mM stock; Roche) γ-P32 -ATP (6,000 Ci mmol−1 ; Perkin Elmer) ! .. CAUTION Radiation can cause cell damage; wear protective gloves, goggles and lab coat and use a protective shield. α-P32 -dCTP (6,000 Ci mmol−1 ; Perkin Elmer) !

    Size-exclusion Chromatography:

    Article Title: A Region of the Nucleosome Required for Multiple Types of Transcriptional Silencing in Saccharomyces cerevisiae
    Article Snippet: .. To generate mutations in histones H3 and H4, the gene of interest was amplified using error-prone PCR [0.2 mM dNTPs, 0.5 μM primers, 1.2 mM MnCl2 , 5 ng plasmid pDM18, and 0.75 unit Taq (Roche) (5 units/μl) in 50 μl denatured for 3 min at 94°, followed by 32 cycles of 15 sec at 94°, 15 sec of 55°, and 2 min at 68°]. .. The gene (H3) was amplified from pDM18 using primers (GGCTATGGCTCGGTGTCAAA) and (GCCCCGCAATTATGTCTGTAAA), and the gene (H4) was amplified using primers (TACATACGTGTTTGTGCGTAT) and (CCAGGGTTTTCCCAGTCAC).

    Purification:

    Article Title: Functional Demarcation of Active and Silent Chromatin Domains in Human HOX Loci by Non-Coding RNAs
    Article Snippet: .. Biotinylated RNAs were treated with RNase-free DNase I and purified on G-50 Sephadex Quick Spin columns (Roche). .. 10 pmol biotinylated RNA was heated to 60 C for 10 min and slow cooled to 4 C. RNA was mixed with 100 μg of pre-cleared transcription and splicing-competent HeLa nuclear extract (Gozani et al., 1994) in RIP buffer supplemented with tRNA (0.1 μg/ul) and incubated at 4 C for 1 hour.

    Incubation:

    Article Title: Regulation of ppk Expression and In Vivo Function of Ppk in Streptomyces lividans TK24
    Article Snippet: .. A sample of the extracted products, corresponding to 20 μg of protein, was incubated for 4 h at 37°C in the presence of 3 U/μl RNase-free DNase I from Boehringer, 1.25 μg/μl RNase A from Roche, 0.25 μg/μl pronase from Sigma, and 2.5 U/μl CIPA from Roche. ..

    De-Phosphorylation Assay:

    Article Title: Dissecting RNA folding by nucleotide analog interference mapping (NAIM)
    Article Snippet: .. It is supplied with a 5× transcription buffer and 0.1 M DTT stock solution 5× Mutant (Y639F) T7 RNA polymerase transcription buffer (EpiCentre) RNase inhibitor (40 U μl−1 ; Roche) Alkaline phosphatase (20 U μl−1 ; Roche) 10× Dephosphorylation buffer (Roche) T4-polynucleotide kinase (PNK, 10 U μl−1 ; NEB) 10× T4-PNK buffer (NEB) DNA polymerase I Klenow fragment exo− (2 U μl−1 ; Roche) 10× Nucleotide analog solution (Glen Research) NTPs (100 mM stock; Roche) γ-P32 -ATP (6,000 Ci mmol−1 ; Perkin Elmer) ! .. CAUTION Radiation can cause cell damage; wear protective gloves, goggles and lab coat and use a protective shield. α-P32 -dCTP (6,000 Ci mmol−1 ; Perkin Elmer) !

    Polymerase Chain Reaction:

    Article Title: A Region of the Nucleosome Required for Multiple Types of Transcriptional Silencing in Saccharomyces cerevisiae
    Article Snippet: .. To generate mutations in histones H3 and H4, the gene of interest was amplified using error-prone PCR [0.2 mM dNTPs, 0.5 μM primers, 1.2 mM MnCl2 , 5 ng plasmid pDM18, and 0.75 unit Taq (Roche) (5 units/μl) in 50 μl denatured for 3 min at 94°, followed by 32 cycles of 15 sec at 94°, 15 sec of 55°, and 2 min at 68°]. .. The gene (H3) was amplified from pDM18 using primers (GGCTATGGCTCGGTGTCAAA) and (GCCCCGCAATTATGTCTGTAAA), and the gene (H4) was amplified using primers (TACATACGTGTTTGTGCGTAT) and (CCAGGGTTTTCCCAGTCAC).

    Staining:

    Article Title: The EGF repeat and discoidin domain protein, SED1/MFG-E8, is required for mammary gland branching morphogenesis
    Article Snippet: .. DIG-labeled RNA was detected with anti-DIG alkaline phosphatase conjugate (1:200; Roche) and developed by using the BCIP/NBT staining kit (Vector Laboratories, Burlingame, CA). .. Organoids were treated with 0.2% collagenase/2.5 units/ml dispase (Invitrogen, Carlsbad, CA).

    In Situ Hybridization:

    Article Title: Myelin Transcription Factor 1 (Myt1) Expression in Demyelinated Lesions of Rodent and Human CNS
    Article Snippet: .. Following in situ hybridization detection of Myt1 transcripts, sections were immunostained with anti-BrdU antibody directly conjugated with horseradish peroxidase (Roche, Indianapolis, IN) and detected with DAB (Vector Labs, Burlingame, CA). ..

    Plasmid Preparation:

    Article Title: A Region of the Nucleosome Required for Multiple Types of Transcriptional Silencing in Saccharomyces cerevisiae
    Article Snippet: .. To generate mutations in histones H3 and H4, the gene of interest was amplified using error-prone PCR [0.2 mM dNTPs, 0.5 μM primers, 1.2 mM MnCl2 , 5 ng plasmid pDM18, and 0.75 unit Taq (Roche) (5 units/μl) in 50 μl denatured for 3 min at 94°, followed by 32 cycles of 15 sec at 94°, 15 sec of 55°, and 2 min at 68°]. .. The gene (H3) was amplified from pDM18 using primers (GGCTATGGCTCGGTGTCAAA) and (GCCCCGCAATTATGTCTGTAAA), and the gene (H4) was amplified using primers (TACATACGTGTTTGTGCGTAT) and (CCAGGGTTTTCCCAGTCAC).

    Hybridization:

    Article Title: Detection of a novel sense-antisense RNA-hybrid structure by RACE experiments on endogenous troponin I antisense RNA
    Article Snippet: .. Hybridization was carried out overnight with 100 ng/mL of DIG-labeled RNA at 65°C in DIG-EasyHyb (Roche). .. After several washing steps including a stringent washing with 0.1× SSC, 0.1% SDS at 60°C, the hybrid RNA were detected by incubation with an anti-DIG/alkaline phosphatase conjugate and a subsequent chemiluminescence reaction with CSPD or CPDstar.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Roche anti br utp antibody
    Anti Br Utp Antibody, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti br utp antibody/product/Roche
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti br utp antibody - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    Image Search Results