Structured Review

Roche amplicons
Human defensin gene clusters at 8p23.1 (NCBI build 36, hg18) and location of the <t>amplicons</t> analyzed by 454 (F1-8) and cloning/Sanger (S1-2) sequencing within the proximal DEFB (DEF cluster b2) .
Amplicons, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 895 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/amplicons/product/Roche
Average 94 stars, based on 895 article reviews
Price from $9.99 to $1999.99
amplicons - by Bioz Stars, 2020-07
94/100 stars

Images

1) Product Images from "Haplotyping and copy number estimation of the highly polymorphic human beta-defensin locus on 8p23 by 454 amplicon sequencing"

Article Title: Haplotyping and copy number estimation of the highly polymorphic human beta-defensin locus on 8p23 by 454 amplicon sequencing

Journal: BMC Genomics

doi: 10.1186/1471-2164-11-252

Human defensin gene clusters at 8p23.1 (NCBI build 36, hg18) and location of the amplicons analyzed by 454 (F1-8) and cloning/Sanger (S1-2) sequencing within the proximal DEFB (DEF cluster b2) .
Figure Legend Snippet: Human defensin gene clusters at 8p23.1 (NCBI build 36, hg18) and location of the amplicons analyzed by 454 (F1-8) and cloning/Sanger (S1-2) sequencing within the proximal DEFB (DEF cluster b2) .

Techniques Used: Clone Assay, Sequencing

2) Product Images from "Host Alternation of Chikungunya Virus Increases Fitness while Restricting Population Diversity and Adaptability to Novel Selective Pressures ▿Host Alternation of Chikungunya Virus Increases Fitness while Restricting Population Diversity and Adaptability to Novel Selective Pressures ▿ †Host Alternation of Chikungunya Virus Increases Fitness while Restricting Population Diversity and Adaptability to Novel Selective Pressures ▿ † ‡"

Article Title: Host Alternation of Chikungunya Virus Increases Fitness while Restricting Population Diversity and Adaptability to Novel Selective Pressures ▿Host Alternation of Chikungunya Virus Increases Fitness while Restricting Population Diversity and Adaptability to Novel Selective Pressures ▿ †Host Alternation of Chikungunya Virus Increases Fitness while Restricting Population Diversity and Adaptability to Novel Selective Pressures ▿ † ‡

Journal: Journal of Virology

doi: 10.1128/JVI.01918-10

Increases in genetic diversity are greatest when no alternating passages are imposed. CHIKV RNAs from supernatants of passages were reverse transcribed, and amplicons flanking the E1 gene were cloned into TOPO vectors and sequenced. The mutation frequency (average number of mutations per E1 gene) was calculated by dividing the number of nucleotide polymorphisms in all clones by the number of nucleotides sequenced and then multiplying by the CHIKV E1 length (1,317 nt). When the same polymorphism was present in multiple RNAs in the population, it was counted each time that it occurred. The E1 gene was sequenced a mean of 71 times (∼90,000 nucleotides/population). Each frequency was adjusted by subtracting the background error rate, estimated from mutations in TOPO-cloned CHIKV plasmid DNA. Numbers above the lines denote P values (χ 2 test with Yates' correction) comparing frequencies.
Figure Legend Snippet: Increases in genetic diversity are greatest when no alternating passages are imposed. CHIKV RNAs from supernatants of passages were reverse transcribed, and amplicons flanking the E1 gene were cloned into TOPO vectors and sequenced. The mutation frequency (average number of mutations per E1 gene) was calculated by dividing the number of nucleotide polymorphisms in all clones by the number of nucleotides sequenced and then multiplying by the CHIKV E1 length (1,317 nt). When the same polymorphism was present in multiple RNAs in the population, it was counted each time that it occurred. The E1 gene was sequenced a mean of 71 times (∼90,000 nucleotides/population). Each frequency was adjusted by subtracting the background error rate, estimated from mutations in TOPO-cloned CHIKV plasmid DNA. Numbers above the lines denote P values (χ 2 test with Yates' correction) comparing frequencies.

Techniques Used: Clone Assay, Mutagenesis, Plasmid Preparation

3) Product Images from "HiDRA-seq: High-Throughput SARS-CoV-2 Detection by RNA Barcoding and Amplicon Sequencing"

Article Title: HiDRA-seq: High-Throughput SARS-CoV-2 Detection by RNA Barcoding and Amplicon Sequencing

Journal: bioRxiv

doi: 10.1101/2020.06.02.130484

(A) Matched pairs of normalized Ct values and alignment rate. Ct values (y-axis-left) for sets of RT-qPCR technical replicates were normalized and correlated to the alignment rate (y-axis-right) for the different amplicons using the Wilcoxon-Signed-Rank test for matched pairs (p
Figure Legend Snippet: (A) Matched pairs of normalized Ct values and alignment rate. Ct values (y-axis-left) for sets of RT-qPCR technical replicates were normalized and correlated to the alignment rate (y-axis-right) for the different amplicons using the Wilcoxon-Signed-Rank test for matched pairs (p

Techniques Used: Quantitative RT-PCR

(A) Schematic representation of the protocol. Using a low volume liquid handling robot, the patients’ RNA is distributed in 384-well plates containing indexed oligo-dT primers. Barcoded cDNA is generated by reverse transcription and pooled into a single tube. Libraries are produced from SARS-CoV-2-specific amplicons and sequenced. Reads are de-multiplexed based on both a plate and a sample barcode and used for downstream diagnostic analysis. (B) Amplicon primer design. The table contains the sequences of the forward primers used to generate the different amplicons. The reverse primer is common to all amplicons and it anneals to the 3’-end of the barcoded oligo-dT primers used to generate cDNA in the reverse transcription. The primer labels contain the position of the first sequenced base. Insert length was calculated using the start of the poly-A sequence. SARS-CoV-2 NC_045512_2 sequence and GAPDH NM_002046.4 sequence were used as reference. For the theoretical size of the amplicon after PCR 1 the Nextera Tag (34bp), the length of the barcoded Oligo-dT-primer (80bp) and the primer sequence was added.
Figure Legend Snippet: (A) Schematic representation of the protocol. Using a low volume liquid handling robot, the patients’ RNA is distributed in 384-well plates containing indexed oligo-dT primers. Barcoded cDNA is generated by reverse transcription and pooled into a single tube. Libraries are produced from SARS-CoV-2-specific amplicons and sequenced. Reads are de-multiplexed based on both a plate and a sample barcode and used for downstream diagnostic analysis. (B) Amplicon primer design. The table contains the sequences of the forward primers used to generate the different amplicons. The reverse primer is common to all amplicons and it anneals to the 3’-end of the barcoded oligo-dT primers used to generate cDNA in the reverse transcription. The primer labels contain the position of the first sequenced base. Insert length was calculated using the start of the poly-A sequence. SARS-CoV-2 NC_045512_2 sequence and GAPDH NM_002046.4 sequence were used as reference. For the theoretical size of the amplicon after PCR 1 the Nextera Tag (34bp), the length of the barcoded Oligo-dT-primer (80bp) and the primer sequence was added.

Techniques Used: Generated, Produced, Diagnostic Assay, Amplification, Sequencing, Polymerase Chain Reaction

(A) Read distribution in the different wells of the plate. The histogram shows the read numbers obtained in the different wells of the plate for the different amplicons. As the input for the protocols was not normalized, a wide distribution in the number of reads is observed. Wells with
Figure Legend Snippet: (A) Read distribution in the different wells of the plate. The histogram shows the read numbers obtained in the different wells of the plate for the different amplicons. As the input for the protocols was not normalized, a wide distribution in the number of reads is observed. Wells with

Techniques Used:

4) Product Images from "Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance"

Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance

Journal: Molecular Neurodegeneration

doi: 10.1186/1750-1326-4-37

Distributions of heteroplasmic mutations in sPD and CTL brain mtDNA . mtDNA's from six sPD and six CTL brains were amplified using primer pairs A-H. The amplicons were subject to Surveyor Nuclease treatment and separation/analysis of products using Experion 12K DNA chips. Bands from 1000-1900 bp size are included in the Figure. The Y-axes are DNA levels and X-axes are product sizes in bp.
Figure Legend Snippet: Distributions of heteroplasmic mutations in sPD and CTL brain mtDNA . mtDNA's from six sPD and six CTL brains were amplified using primer pairs A-H. The amplicons were subject to Surveyor Nuclease treatment and separation/analysis of products using Experion 12K DNA chips. Bands from 1000-1900 bp size are included in the Figure. The Y-axes are DNA levels and X-axes are product sizes in bp.

Techniques Used: CTL Assay, Amplification

5) Product Images from "The endothelial-specific regulatory mutation, Mvwf1, is a common mouse founder allele"

Article Title: The endothelial-specific regulatory mutation, Mvwf1, is a common mouse founder allele

Journal: Mammalian Genome

doi: 10.1007/s00335-007-9079-4

Mvwf1 haplotype block. A highly conserved Mvwf1 haplotype block (yellow) is shared by the Mvwf1 inbred strains and distinct from other wild-derived inbred strains representative of the M. m. musculus clade, M. spretus , and M. spicilegus . Strain ID numbers are indicated on the left (see Supplementary Table 1 ). Colors were assigned to similar sequences based upon PAUP phylogeny trees; missing data are white. The B4galnt2 exon 1 boundary is highlighted by the thick white vertical line. The Mvwf1 haplotype block is outlined in black. Shorter segments in seven additional strains (28, 64, 37, 38, 40, 31, 20) have two or more contiguous amplicons with sequence identity to the Mvwf1 strains (outlined in the red boxes)
Figure Legend Snippet: Mvwf1 haplotype block. A highly conserved Mvwf1 haplotype block (yellow) is shared by the Mvwf1 inbred strains and distinct from other wild-derived inbred strains representative of the M. m. musculus clade, M. spretus , and M. spicilegus . Strain ID numbers are indicated on the left (see Supplementary Table 1 ). Colors were assigned to similar sequences based upon PAUP phylogeny trees; missing data are white. The B4galnt2 exon 1 boundary is highlighted by the thick white vertical line. The Mvwf1 haplotype block is outlined in black. Shorter segments in seven additional strains (28, 64, 37, 38, 40, 31, 20) have two or more contiguous amplicons with sequence identity to the Mvwf1 strains (outlined in the red boxes)

Techniques Used: Blocking Assay, Derivative Assay, Sequencing

6) Product Images from "A Modified RNA-Seq Approach for Whole Genome Sequencing of RNA Viruses from Faecal and Blood Samples"

Article Title: A Modified RNA-Seq Approach for Whole Genome Sequencing of RNA Viruses from Faecal and Blood Samples

Journal: PLoS ONE

doi: 10.1371/journal.pone.0066129

Coverage profiles of one Norovirus sample from amplicon and direct RNA sequencing. A – Coverage across the genome for one Norovirus sample sequenced from PCR amplicons (others similar). Green and orange dotted lined mark the locations of the PCR primers used to generate the amplicons. B – coverage across the genome for the same Norovirus sample sequenced directly from RNA.
Figure Legend Snippet: Coverage profiles of one Norovirus sample from amplicon and direct RNA sequencing. A – Coverage across the genome for one Norovirus sample sequenced from PCR amplicons (others similar). Green and orange dotted lined mark the locations of the PCR primers used to generate the amplicons. B – coverage across the genome for the same Norovirus sample sequenced directly from RNA.

Techniques Used: Amplification, RNA Sequencing Assay, Polymerase Chain Reaction

7) Product Images from "Molecular diagnostics for congenital hearing loss including 15 deafness genes using a next generation sequencing platform"

Article Title: Molecular diagnostics for congenital hearing loss including 15 deafness genes using a next generation sequencing platform

Journal: BMC Medical Genomics

doi: 10.1186/1755-8794-5-17

Cq values for the 15 genes. The Cq values for the amplicons covering all of the 15 genes are displayed. One amplicon of the TRIOBP gene failed during this PCR (red).
Figure Legend Snippet: Cq values for the 15 genes. The Cq values for the amplicons covering all of the 15 genes are displayed. One amplicon of the TRIOBP gene failed during this PCR (red).

Techniques Used: Amplification, Polymerase Chain Reaction

Cq values for OTOF and CDH23 . The Cq value is displayed in function of the corresponding amplicon for the OTOF and CDH23 gene. The plot shows a drop-out of two amplicons (red).
Figure Legend Snippet: Cq values for OTOF and CDH23 . The Cq value is displayed in function of the corresponding amplicon for the OTOF and CDH23 gene. The plot shows a drop-out of two amplicons (red).

Techniques Used: Amplification

Workflow for the PCR enrichment approach. Amplicons are equimolar pooled per patient, continuously the A and B (454) adapters with MID are ligated to each pool of amplicons. All the patients, each tagged with a unique MID, can be pooled before proceeding to emulsion PCR.
Figure Legend Snippet: Workflow for the PCR enrichment approach. Amplicons are equimolar pooled per patient, continuously the A and B (454) adapters with MID are ligated to each pool of amplicons. All the patients, each tagged with a unique MID, can be pooled before proceeding to emulsion PCR.

Techniques Used: Polymerase Chain Reaction

8) Product Images from "Sequence Polymorphism and Expression Variability of Crassostrea gigas Immune Related Genes Discriminate Two Oyster Lines Contrasted in Term of Resistance to Summer Mortalities"

Article Title: Sequence Polymorphism and Expression Variability of Crassostrea gigas Immune Related Genes Discriminate Two Oyster Lines Contrasted in Term of Resistance to Summer Mortalities

Journal: PLoS ONE

doi: 10.1371/journal.pone.0075900

Melting temperature from transcript amplicons of four antimicrobial peptides and protein and three reference genes in individual oysters from H and L lines. Graphs represent melting curves of qPCR amplicons of three antimicrobial peptides ( Cg-Defs , Cg-Defh , and Cg-Prp ), one antimicrobial protein ( Cg-BPI ), and three constitutively expressed genes ( Cg-EF1 , Cg-RPL40 and Cg-RPS6 ) from two selected oyster lines (ten oysters per line). H oyster line is represented in grey and L oyster line in black. The three antimicrobial peptides ( Cg-Defs , Cg-Defh , and Cg-Prp ) display a high variation on their melting temperatures is significantly associated with the L line (Fisher test, p
Figure Legend Snippet: Melting temperature from transcript amplicons of four antimicrobial peptides and protein and three reference genes in individual oysters from H and L lines. Graphs represent melting curves of qPCR amplicons of three antimicrobial peptides ( Cg-Defs , Cg-Defh , and Cg-Prp ), one antimicrobial protein ( Cg-BPI ), and three constitutively expressed genes ( Cg-EF1 , Cg-RPL40 and Cg-RPS6 ) from two selected oyster lines (ten oysters per line). H oyster line is represented in grey and L oyster line in black. The three antimicrobial peptides ( Cg-Defs , Cg-Defh , and Cg-Prp ) display a high variation on their melting temperatures is significantly associated with the L line (Fisher test, p

Techniques Used: Real-time Polymerase Chain Reaction

9) Product Images from "A panel of genes methylated with high frequency in colorectal cancer"

Article Title: A panel of genes methylated with high frequency in colorectal cancer

Journal: BMC Cancer

doi: 10.1186/1471-2407-14-54

Profiles of gene methylation for six amplicons. Individual panels show plots of CpG site methylation across the indicated amplicons. Data is presented for 10 individual cancer tissues (red), 10 matched non-neoplastic colon tissues (blue), a 50:50 mix of wbc DNA and fully methylated DNA (green) and wbc blood DNA (ochre). CpG sites are equispaced along the x-axis with labels showing the relative position of each CpG site within the amplicon, relative to the start of the forward primer. Chromosomal locations of amplicons are provided in Additional file 2 : Table S3. The y-axis shows the proportion of methylated cytosines at a CpG site. Sudden coordinated changes in measured methylation rate, such as that at coordinate 134 of the GRASP Region 3 amplicon, is due to a DNA alignment technical artefact caused by long thymine homopolymer repeats creating errors within the pyrosequencing reads.
Figure Legend Snippet: Profiles of gene methylation for six amplicons. Individual panels show plots of CpG site methylation across the indicated amplicons. Data is presented for 10 individual cancer tissues (red), 10 matched non-neoplastic colon tissues (blue), a 50:50 mix of wbc DNA and fully methylated DNA (green) and wbc blood DNA (ochre). CpG sites are equispaced along the x-axis with labels showing the relative position of each CpG site within the amplicon, relative to the start of the forward primer. Chromosomal locations of amplicons are provided in Additional file 2 : Table S3. The y-axis shows the proportion of methylated cytosines at a CpG site. Sudden coordinated changes in measured methylation rate, such as that at coordinate 134 of the GRASP Region 3 amplicon, is due to a DNA alignment technical artefact caused by long thymine homopolymer repeats creating errors within the pyrosequencing reads.

Techniques Used: Methylation, Amplification

10) Product Images from "A panel of genes methylated with high frequency in colorectal cancer"

Article Title: A panel of genes methylated with high frequency in colorectal cancer

Journal: BMC Cancer

doi: 10.1186/1471-2407-14-54

Profiles of gene methylation for six amplicons. Individual panels show plots of CpG site methylation across the indicated amplicons. Data is presented for 10 individual cancer tissues (red), 10 matched non-neoplastic colon tissues (blue), a 50:50 mix of wbc DNA and fully methylated DNA (green) and wbc blood DNA (ochre). CpG sites are equispaced along the x-axis with labels showing the relative position of each CpG site within the amplicon, relative to the start of the forward primer. Chromosomal locations of amplicons are provided in Additional file 2 : Table S3. The y-axis shows the proportion of methylated cytosines at a CpG site. Sudden coordinated changes in measured methylation rate, such as that at coordinate 134 of the GRASP Region 3 amplicon, is due to a DNA alignment technical artefact caused by long thymine homopolymer repeats creating errors within the pyrosequencing reads.
Figure Legend Snippet: Profiles of gene methylation for six amplicons. Individual panels show plots of CpG site methylation across the indicated amplicons. Data is presented for 10 individual cancer tissues (red), 10 matched non-neoplastic colon tissues (blue), a 50:50 mix of wbc DNA and fully methylated DNA (green) and wbc blood DNA (ochre). CpG sites are equispaced along the x-axis with labels showing the relative position of each CpG site within the amplicon, relative to the start of the forward primer. Chromosomal locations of amplicons are provided in Additional file 2 : Table S3. The y-axis shows the proportion of methylated cytosines at a CpG site. Sudden coordinated changes in measured methylation rate, such as that at coordinate 134 of the GRASP Region 3 amplicon, is due to a DNA alignment technical artefact caused by long thymine homopolymer repeats creating errors within the pyrosequencing reads.

Techniques Used: Methylation, Amplification

11) Product Images from "Combinatorial analysis and algorithms for quasispecies reconstruction using next-generation sequencing"

Article Title: Combinatorial analysis and algorithms for quasispecies reconstruction using next-generation sequencing

Journal: BMC Bioinformatics

doi: 10.1186/1471-2105-12-5

Overlap graph . Example of amplicon sampling from a quasispecies constituted by two variants (binary alphabet), with different prevalence. The reads are aligned to a reference genome, cover entirely an amplicon and are trimmed to the amplicon start/end positions (otherwise a question mark is placed). With such a design of 4 amplicons and 3 overlaps, the last overlap allows for ambiguous consistency. The overlap graph analysis leads to the reconstruction of 4 candidate variants, where 2 of them are in-silico recombinants. Without additional analysis on read distributions over the amplicons, it is impossible to infer the correct quasispecies.
Figure Legend Snippet: Overlap graph . Example of amplicon sampling from a quasispecies constituted by two variants (binary alphabet), with different prevalence. The reads are aligned to a reference genome, cover entirely an amplicon and are trimmed to the amplicon start/end positions (otherwise a question mark is placed). With such a design of 4 amplicons and 3 overlaps, the last overlap allows for ambiguous consistency. The overlap graph analysis leads to the reconstruction of 4 candidate variants, where 2 of them are in-silico recombinants. Without additional analysis on read distributions over the amplicons, it is impossible to infer the correct quasispecies.

Techniques Used: Amplification, Sampling, In Silico

12) Product Images from "Clade-Specific Quantitative Analysis of Photosynthetic Gene Expression in Prochlorococcus"

Article Title: Clade-Specific Quantitative Analysis of Photosynthetic Gene Expression in Prochlorococcus

Journal: PLoS ONE

doi: 10.1371/journal.pone.0133207

Representation of amplicon melting temperature (Tm) values, in°C, plotted against Cp values (in cycles) obtained for field samples at the three sampled depths: Surface (orange), DCM (green) and DCM+40 (blue). For comparison, the graphs include the corresponding values from supplementary S3 Table . HL amplicons: Prochlorococcus strains MED4 (M4), MIT9515 (M5) and EQPAC1-C (EQ). LL amplicons: Prochlorococcus strains MIT9313 (M3), NATL2A (NA), and the Synechococcus strain WH7803 (WH).
Figure Legend Snippet: Representation of amplicon melting temperature (Tm) values, in°C, plotted against Cp values (in cycles) obtained for field samples at the three sampled depths: Surface (orange), DCM (green) and DCM+40 (blue). For comparison, the graphs include the corresponding values from supplementary S3 Table . HL amplicons: Prochlorococcus strains MED4 (M4), MIT9515 (M5) and EQPAC1-C (EQ). LL amplicons: Prochlorococcus strains MIT9313 (M3), NATL2A (NA), and the Synechococcus strain WH7803 (WH).

Techniques Used: Amplification

Cladograms of sequences from amplicons derived from field and laboratory samples compared to the closest sequences identified by BLAST. Two qRT-PCR products were sequenced for each sample from Atlantic, Indian and Pacific 1 stations, and only one for Pacific 2 samples (more information in supplementary S4 Table ). Amplicons from surface, DCM, and DCM+40 samples from the different stations are identified with
Figure Legend Snippet: Cladograms of sequences from amplicons derived from field and laboratory samples compared to the closest sequences identified by BLAST. Two qRT-PCR products were sequenced for each sample from Atlantic, Indian and Pacific 1 stations, and only one for Pacific 2 samples (more information in supplementary S4 Table ). Amplicons from surface, DCM, and DCM+40 samples from the different stations are identified with "S", "D" and "D40" letters. Panels a-c correspond to HL amplicons, whereas panels d-f correspond to LL amplicons. For each ecotype, cladograms corresponding to rnp B (a,d), rbc L (b,e) and psb A (c,f) genes are presented. The trees also include sequences from the GenBank. LL Prochlorococcus , HL Prochlorococcus , and Synechococcus (Syn.) sequences are indicated by dark green, light green and red colors, respectively. Amplicons from MIT9313 and MED4 strains grown in the lab were also sequenced and included in the analysis as MIT9313-Lab and MED4-Lab, respectively. Sequences for uncultured microorganism isolates are marked as U.P. (identified as Prochlorococcus ), U.Syn. (identified as Synechococcus ) or U.O, (not identified).

Techniques Used: Derivative Assay, Quantitative RT-PCR

qRT-PCR analysis, cloning and sequencing of amplicons from cultures and field samples
Figure Legend Snippet: qRT-PCR analysis, cloning and sequencing of amplicons from cultures and field samples

Techniques Used: Quantitative RT-PCR, Clone Assay, Sequencing

qRT-PCR analysis, cloning and sequencing of amplicons from cultures and field samples
Figure Legend Snippet: qRT-PCR analysis, cloning and sequencing of amplicons from cultures and field samples

Techniques Used: Quantitative RT-PCR, Clone Assay, Sequencing

qRT-PCR analysis, cloning and sequencing of amplicons from cultures and field samples
Figure Legend Snippet: qRT-PCR analysis, cloning and sequencing of amplicons from cultures and field samples

Techniques Used: Quantitative RT-PCR, Clone Assay, Sequencing

13) Product Images from "Relationship between Altered miRNA Expression and DNA Methylation of the DLK1-DIO3 Region in Azacitidine-Treated Patients with Myelodysplastic Syndromes and Acute Myeloid Leukemia with Myelodysplasia-Related Changes"

Article Title: Relationship between Altered miRNA Expression and DNA Methylation of the DLK1-DIO3 Region in Azacitidine-Treated Patients with Myelodysplastic Syndromes and Acute Myeloid Leukemia with Myelodysplasia-Related Changes

Journal: Cells

doi: 10.3390/cells7090138

Genomic organization of the DLK1–DIO3 domain. ( A ) The region is located on chromosome 14q32.2. ( B ) It contains three paternally expressed protein-coding genes ( DLK1, RTL1 , and DIO3 ), three maternally expressed noncoding genes ( MEG3, MEG8, and antisense RTL1 ), many snoRNAs, and a large cluster of 54 miRNAs (striped bar). ( C ) The expression within the region is under the control of MEG3 -DMR that overlaps with the promoter and the 5′-end of the MEG3 gene. MEG3 -DMR contains several CTFC binding sites (gray bars) and CpG islands (black bars). ( D ) The schema shows localization of amplicons (A1–A3) in the region that were used for methylation analyses.
Figure Legend Snippet: Genomic organization of the DLK1–DIO3 domain. ( A ) The region is located on chromosome 14q32.2. ( B ) It contains three paternally expressed protein-coding genes ( DLK1, RTL1 , and DIO3 ), three maternally expressed noncoding genes ( MEG3, MEG8, and antisense RTL1 ), many snoRNAs, and a large cluster of 54 miRNAs (striped bar). ( C ) The expression within the region is under the control of MEG3 -DMR that overlaps with the promoter and the 5′-end of the MEG3 gene. MEG3 -DMR contains several CTFC binding sites (gray bars) and CpG islands (black bars). ( D ) The schema shows localization of amplicons (A1–A3) in the region that were used for methylation analyses.

Techniques Used: Expressing, Binding Assay, Methylation

14) Product Images from "Ultra-high resolution HLA genotyping and allele discovery by highly multiplexed cDNA amplicon pyrosequencing"

Article Title: Ultra-high resolution HLA genotyping and allele discovery by highly multiplexed cDNA amplicon pyrosequencing

Journal: BMC Genomics

doi: 10.1186/1471-2164-13-378

Positioning and sequence of HLA class I universal amplification primers. An alignment of > 4,000 known HLA class I alleles produced a variability profile. ( a ) The depth of coverage (i.e. the number of alleles at each position in the alignment) is shown in grey, along with the percentage of nucleotide sequence variability (red) and the positioning of the two genotyping amplicons. ( b ) The sequence and composition of universal amplification primers for amplicon 1 and 2. Note that for amplicon 1 the “A” and “B” adapters were swapped to avoid a primer amplification problem.
Figure Legend Snippet: Positioning and sequence of HLA class I universal amplification primers. An alignment of > 4,000 known HLA class I alleles produced a variability profile. ( a ) The depth of coverage (i.e. the number of alleles at each position in the alignment) is shown in grey, along with the percentage of nucleotide sequence variability (red) and the positioning of the two genotyping amplicons. ( b ) The sequence and composition of universal amplification primers for amplicon 1 and 2. Note that for amplicon 1 the “A” and “B” adapters were swapped to avoid a primer amplification problem.

Techniques Used: Sequencing, Amplification, Produced

The HLA class I allele calls from the first genotyping experiment, designed to test the use of the two-tiled class I amplicons, are shown. Calls in blue were completely unambiguous to the allele level. Calls in green were four-digit ambiguous based on distinguishing SNPs outside the amplified region. The call in orange was only recovered using the modified, lower-stringency analysis pipeline, while the call in pink was expected but not observed for both amplicons. Calls in purple were examples of reference typing undergoing correction, or the detection of a putative novel allele.
Figure Legend Snippet: The HLA class I allele calls from the first genotyping experiment, designed to test the use of the two-tiled class I amplicons, are shown. Calls in blue were completely unambiguous to the allele level. Calls in green were four-digit ambiguous based on distinguishing SNPs outside the amplified region. The call in orange was only recovered using the modified, lower-stringency analysis pipeline, while the call in pink was expected but not observed for both amplicons. Calls in purple were examples of reference typing undergoing correction, or the detection of a putative novel allele.

Techniques Used: Amplification, Modification

15) Product Images from "Multiplex PCR Method for Detection of Three Aeromonas Enterotoxin Genes ▿"

Article Title: Multiplex PCR Method for Detection of Three Aeromonas Enterotoxin Genes ▿

Journal: Applied and Environmental Microbiology

doi: 10.1128/AEM.01357-09

Molecular characterization and confirmation of the predicted and unpredicted amplicons.
Figure Legend Snippet: Molecular characterization and confirmation of the predicted and unpredicted amplicons.

Techniques Used:

16) Product Images from "Next generation sequencing and comparative analyses of Xenopus mitogenomes"

Article Title: Next generation sequencing and comparative analyses of Xenopus mitogenomes

Journal: BMC Genomics

doi: 10.1186/1471-2164-13-496

Xenopus borealis mitochondrial genome. The complete mitochondrial genome of Xenopus borealis (17,474 bp, drawn to scale) All 13 protein coding genes are shown as open arrows, 2 ribosomal RNAs as shaded arrows and 22 tRNAs as arrowed lines. Each tRNA is shown by its single letter amino acid code. The two leucine and two serine tRNAs are differentiated by their respective anti-codons. The direction of transcription is indicated by the arrows. Also shown is the non-coding D-loop (control region, black) and the position of the primers (LongF1/R2 and LongF2/R1) used to generate the two long-PCR amplicons, which were pooled and sequenced using 454 technology.
Figure Legend Snippet: Xenopus borealis mitochondrial genome. The complete mitochondrial genome of Xenopus borealis (17,474 bp, drawn to scale) All 13 protein coding genes are shown as open arrows, 2 ribosomal RNAs as shaded arrows and 22 tRNAs as arrowed lines. Each tRNA is shown by its single letter amino acid code. The two leucine and two serine tRNAs are differentiated by their respective anti-codons. The direction of transcription is indicated by the arrows. Also shown is the non-coding D-loop (control region, black) and the position of the primers (LongF1/R2 and LongF2/R1) used to generate the two long-PCR amplicons, which were pooled and sequenced using 454 technology.

Techniques Used: Polymerase Chain Reaction

Long PCR, COX1, 16S, primer region 1 and primer region 2 amplicons. Agarose gel electrophoresis of ( A ) Xenopus borealis (XB; lanes 1 and 2) and X. victorianus (XV; lanes 3 and 4) PCR fragments using Long F1/R2 (lanes 1 and 3) and Long F2/R1 primers (lanes 2 and 4). ( B ) XB (lanes 1 and 2) and XV (lane 3) PCR fragments using COX1 (lane 1) and 16SA-Lmod/H (lanes 2 and 3) primers. ( C ) XB (lanes 1-2 and 5-6) and XV (lanes 3-4 and 7-8) PCR fragments using AMP1F/R (lanes 1-4) and AMP2F/R (lanes 5-8) primers. M1 and M2 = 1kb and 100bp DNA ladders, respectively.
Figure Legend Snippet: Long PCR, COX1, 16S, primer region 1 and primer region 2 amplicons. Agarose gel electrophoresis of ( A ) Xenopus borealis (XB; lanes 1 and 2) and X. victorianus (XV; lanes 3 and 4) PCR fragments using Long F1/R2 (lanes 1 and 3) and Long F2/R1 primers (lanes 2 and 4). ( B ) XB (lanes 1 and 2) and XV (lane 3) PCR fragments using COX1 (lane 1) and 16SA-Lmod/H (lanes 2 and 3) primers. ( C ) XB (lanes 1-2 and 5-6) and XV (lanes 3-4 and 7-8) PCR fragments using AMP1F/R (lanes 1-4) and AMP2F/R (lanes 5-8) primers. M1 and M2 = 1kb and 100bp DNA ladders, respectively.

Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

17) Product Images from "Ultra-high resolution HLA genotyping and allele discovery by highly multiplexed cDNA amplicon pyrosequencing"

Article Title: Ultra-high resolution HLA genotyping and allele discovery by highly multiplexed cDNA amplicon pyrosequencing

Journal: BMC Genomics

doi: 10.1186/1471-2164-13-378

Positioning and sequence of HLA class I universal amplification primers. An alignment of > 4,000 known HLA class I alleles produced a variability profile. ( a ) The depth of coverage (i.e. the number of alleles at each position in the alignment) is shown in grey, along with the percentage of nucleotide sequence variability (red) and the positioning of the two genotyping amplicons. ( b ) The sequence and composition of universal amplification primers for amplicon 1 and 2. Note that for amplicon 1 the “A” and “B” adapters were swapped to avoid a primer amplification problem.
Figure Legend Snippet: Positioning and sequence of HLA class I universal amplification primers. An alignment of > 4,000 known HLA class I alleles produced a variability profile. ( a ) The depth of coverage (i.e. the number of alleles at each position in the alignment) is shown in grey, along with the percentage of nucleotide sequence variability (red) and the positioning of the two genotyping amplicons. ( b ) The sequence and composition of universal amplification primers for amplicon 1 and 2. Note that for amplicon 1 the “A” and “B” adapters were swapped to avoid a primer amplification problem.

Techniques Used: Sequencing, Amplification, Produced

The HLA class I allele calls from the first genotyping experiment, designed to test the use of the two-tiled class I amplicons, are shown. Calls in blue were completely unambiguous to the allele level. Calls in green were four-digit ambiguous based on distinguishing SNPs outside the amplified region. The call in orange was only recovered using the modified, lower-stringency analysis pipeline, while the call in pink was expected but not observed for both amplicons. Calls in purple were examples of reference typing undergoing correction, or the detection of a putative novel allele.
Figure Legend Snippet: The HLA class I allele calls from the first genotyping experiment, designed to test the use of the two-tiled class I amplicons, are shown. Calls in blue were completely unambiguous to the allele level. Calls in green were four-digit ambiguous based on distinguishing SNPs outside the amplified region. The call in orange was only recovered using the modified, lower-stringency analysis pipeline, while the call in pink was expected but not observed for both amplicons. Calls in purple were examples of reference typing undergoing correction, or the detection of a putative novel allele.

Techniques Used: Amplification, Modification

18) Product Images from "Genetic mapping and marker development for resistance of wheat against the root lesion nematode Pratylenchus neglectus"

Article Title: Genetic mapping and marker development for resistance of wheat against the root lesion nematode Pratylenchus neglectus

Journal: BMC Plant Biology

doi: 10.1186/1471-2229-13-230

High-resolution melting curves for amplicons of the co-dominant marker wri1 . Normalized and temperature- shifted difference plot for products amplified from genomic DNA of, Excalibur and 11 other cultivars known to carry Rlnn1 and/or known to carry Lr20 / Sr15 (Group 1: Excalibur, Bindawarra, Bowie, Vectis, Wyalkatchem, Orion; Group 2: Aroona, Tatiara, Thew, Cascades; Group 3: BT- Schomburgk, Krichauff) and Kukri and 14 other cultivars known to lack Rlnn1 and/or known to lack Lr20 / Sr15 (Group 4: Kukri, Sunbri, Calingiri, Sunlin, Sunvale, AGT Scythe, Annuello, Machete; Group 5: Sunstate, Chara, Babbler, Hartog, Buckley, Gladius, Yitpi).
Figure Legend Snippet: High-resolution melting curves for amplicons of the co-dominant marker wri1 . Normalized and temperature- shifted difference plot for products amplified from genomic DNA of, Excalibur and 11 other cultivars known to carry Rlnn1 and/or known to carry Lr20 / Sr15 (Group 1: Excalibur, Bindawarra, Bowie, Vectis, Wyalkatchem, Orion; Group 2: Aroona, Tatiara, Thew, Cascades; Group 3: BT- Schomburgk, Krichauff) and Kukri and 14 other cultivars known to lack Rlnn1 and/or known to lack Lr20 / Sr15 (Group 4: Kukri, Sunbri, Calingiri, Sunlin, Sunvale, AGT Scythe, Annuello, Machete; Group 5: Sunstate, Chara, Babbler, Hartog, Buckley, Gladius, Yitpi).

Techniques Used: Marker, Amplification

Amplicons of markers wri1 , wri2, wri3, wri4 and wri5 separated by agarose gel electrophoresis. (A) wri1 , (B) wri2, (C) wri3, (D) wri4, (E) wri5, (1) GeneRuler® 100 bp DNA ladder (Thermo Fisher Scientific Inc.), (2) Excalibur, (3) Kukri, (4) 1:1 mixture of Excalibur and Kukri DNA (artificial heterozygote), the Chinese Spring nullisomic-tetrasomic lines (5) CS N7A-T7B, (6) CS N7A-T7D, (7) CS N7B-T7A, (8) CS N7B-T7D, (9) CS N7D-T7A, (10) CS N7D-T7B and (11) water.
Figure Legend Snippet: Amplicons of markers wri1 , wri2, wri3, wri4 and wri5 separated by agarose gel electrophoresis. (A) wri1 , (B) wri2, (C) wri3, (D) wri4, (E) wri5, (1) GeneRuler® 100 bp DNA ladder (Thermo Fisher Scientific Inc.), (2) Excalibur, (3) Kukri, (4) 1:1 mixture of Excalibur and Kukri DNA (artificial heterozygote), the Chinese Spring nullisomic-tetrasomic lines (5) CS N7A-T7B, (6) CS N7A-T7D, (7) CS N7B-T7A, (8) CS N7B-T7D, (9) CS N7D-T7A, (10) CS N7D-T7B and (11) water.

Techniques Used: Agarose Gel Electrophoresis

High-resolution melting curves for amplicons of markers wri1 (A) and wri3 (B). Above: Normalised and shifted melting curves; Below: Normalised and temperature-shifted difference plot. Curves are shown for products amplified from genomic DNA of Excalibur, Kukri and a 1:1 mixture of Excalibur and Kukri DNA (artificial heterozygote).
Figure Legend Snippet: High-resolution melting curves for amplicons of markers wri1 (A) and wri3 (B). Above: Normalised and shifted melting curves; Below: Normalised and temperature-shifted difference plot. Curves are shown for products amplified from genomic DNA of Excalibur, Kukri and a 1:1 mixture of Excalibur and Kukri DNA (artificial heterozygote).

Techniques Used: Amplification

19) Product Images from "A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples"

Article Title: A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples

Journal: Genome Biology

doi: 10.1186/gb-2012-13-7-r60

The eukaryotic ribosomal DNA locus and the targets of amplicons studied here . (a) Part of the rRNA gene locus showing primer binding sites (not to scale). (b) Comparison of sequence complementarity for the 18S-0067a-deg primer against various eukaryotic groups. Clades belonging to Excavate (E) or Opisthokont (O) groups [ 27 , 41 ] are marked on the left. Apusozoa consist of ciliated protozoans [ 42 ]. Cryptophyta and Haptophyceae are subgroups of algae [ 27 ]. (c) Heat map indicating the edit distance (numbers of mismatches) between the 18S-0067a-deg primer and target sites in the indicated organisms. Colors are scaled to the relative proportion of each taxa represented at each edit distance.
Figure Legend Snippet: The eukaryotic ribosomal DNA locus and the targets of amplicons studied here . (a) Part of the rRNA gene locus showing primer binding sites (not to scale). (b) Comparison of sequence complementarity for the 18S-0067a-deg primer against various eukaryotic groups. Clades belonging to Excavate (E) or Opisthokont (O) groups [ 27 , 41 ] are marked on the left. Apusozoa consist of ciliated protozoans [ 42 ]. Cryptophyta and Haptophyceae are subgroups of algae [ 27 ]. (c) Heat map indicating the edit distance (numbers of mismatches) between the 18S-0067a-deg primer and target sites in the indicated organisms. Colors are scaled to the relative proportion of each taxa represented at each edit distance.

Techniques Used: Binding Assay, Sequencing

Analysis of DNA samples from known eukaryotes . (a) 18S rRNA gene amplicons. (b) ITS rRNA gene amplicons. The sample tested is listed along the x-axis. The y-axis shows the level of taxonomic placement of each OTU in each sample relative to the correct taxon indicated on the x-axis. The numbers of sequence reads are shown by the size of the point. Thus, large circles high up on the y-axis indicate correct placement of the major taxa.
Figure Legend Snippet: Analysis of DNA samples from known eukaryotes . (a) 18S rRNA gene amplicons. (b) ITS rRNA gene amplicons. The sample tested is listed along the x-axis. The y-axis shows the level of taxonomic placement of each OTU in each sample relative to the correct taxon indicated on the x-axis. The numbers of sequence reads are shown by the size of the point. Thus, large circles high up on the y-axis indicate correct placement of the major taxa.

Techniques Used: Sequencing

Rank-abundance plots for operational taxonomic units from stool samples . (a) 18S rRNA gene amplicons. (b) ITS rRNA gene amplicons. The rank (relative abundance) of each OTU is shown on the x-axis, with the most abundant on the left. The proportion contributed by that OTU is shown on the y-axis. The key in the upper right shows the color code for the different human subjects studied.
Figure Legend Snippet: Rank-abundance plots for operational taxonomic units from stool samples . (a) 18S rRNA gene amplicons. (b) ITS rRNA gene amplicons. The rank (relative abundance) of each OTU is shown on the x-axis, with the most abundant on the left. The proportion contributed by that OTU is shown on the y-axis. The key in the upper right shows the color code for the different human subjects studied.

Techniques Used:

20) Product Images from "Development of oligonucleotide microarrays for simultaneous multi‐species identification of Phellinus tree‐pathogenic fungi"

Article Title: Development of oligonucleotide microarrays for simultaneous multi‐species identification of Phellinus tree‐pathogenic fungi

Journal: Microbial Biotechnology

doi: 10.1111/1751-7915.12341

Sensitivity analysis of the P hellinus microarray. Agarose gel electrophoresis ( GE ) and reverse dot‐blot hybridization against microarrays were performed with PCR ‐amplified (A) P . weirii or (B) P . noxius ITS primers that were serially diluted to derive samples respectively containing 1 ng, 100 pg, 10 pg, 1 pg, 100 fg or 10 fg of starting DNA . Biotin – PVC : Biotin‐labelled primer amplicons hybridized to probes on PVC chip; DIG – PVC : DIG ‐labelled primer amplicons hybridized to probes on PVC chip; Biotin – NY‐M : Biotin‐labelled primer amplicons hybridized to probes on nylon membrane; DIG – NY‐M : DIG ‐labelled primer amplicons hybridized to probes on nylon membrane.
Figure Legend Snippet: Sensitivity analysis of the P hellinus microarray. Agarose gel electrophoresis ( GE ) and reverse dot‐blot hybridization against microarrays were performed with PCR ‐amplified (A) P . weirii or (B) P . noxius ITS primers that were serially diluted to derive samples respectively containing 1 ng, 100 pg, 10 pg, 1 pg, 100 fg or 10 fg of starting DNA . Biotin – PVC : Biotin‐labelled primer amplicons hybridized to probes on PVC chip; DIG – PVC : DIG ‐labelled primer amplicons hybridized to probes on PVC chip; Biotin – NY‐M : Biotin‐labelled primer amplicons hybridized to probes on nylon membrane; DIG – NY‐M : DIG ‐labelled primer amplicons hybridized to probes on nylon membrane.

Techniques Used: Microarray, Agarose Gel Electrophoresis, Dot Blot, Hybridization, Polymerase Chain Reaction, Amplification, Chromatin Immunoprecipitation

Arrangement and reverse dot‐blot hybridization results of the P hellinus oligonucleotide microarray. A. Arrangement of P hellinus species‐specific probes on microarrays. P hapi: P hellinus apiahynus ; P hces: P . cesatii ; P hgil: P . gilvus ; P hlin: P . linteus ; P hine: P . inermis ; P hlav: P . laevigatus ; P hmel: P . melleoporus ; P hmem: P . membranaceus ; P hnox: P . noxius ; P hpin: P . pini ; P hque: P . quercinus ; P hrib: P . ribis ; P hign: P . igniarius ; P hfor: P . formosanus ; P hpac: P . pachyphloeus ; P htor: P . torulosus ; P hwei: P . weirii ; PM : position marker labelled with O ligo‐( dT )10; HC : hybridization control; PC : positive control. B. Reverse dot‐blot hybridization of biotin‐primer‐labelled amplicons from target reference strains to probes on nylon membrane. C. Reverse dot‐blot hybridization of DIG ‐primer‐labelled amplicons from target reference strains to probes on PVC chip.
Figure Legend Snippet: Arrangement and reverse dot‐blot hybridization results of the P hellinus oligonucleotide microarray. A. Arrangement of P hellinus species‐specific probes on microarrays. P hapi: P hellinus apiahynus ; P hces: P . cesatii ; P hgil: P . gilvus ; P hlin: P . linteus ; P hine: P . inermis ; P hlav: P . laevigatus ; P hmel: P . melleoporus ; P hmem: P . membranaceus ; P hnox: P . noxius ; P hpin: P . pini ; P hque: P . quercinus ; P hrib: P . ribis ; P hign: P . igniarius ; P hfor: P . formosanus ; P hpac: P . pachyphloeus ; P htor: P . torulosus ; P hwei: P . weirii ; PM : position marker labelled with O ligo‐( dT )10; HC : hybridization control; PC : positive control. B. Reverse dot‐blot hybridization of biotin‐primer‐labelled amplicons from target reference strains to probes on nylon membrane. C. Reverse dot‐blot hybridization of DIG ‐primer‐labelled amplicons from target reference strains to probes on PVC chip.

Techniques Used: Dot Blot, Hybridization, Microarray, Marker, Positive Control, Chromatin Immunoprecipitation

21) Product Images from "Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions"

Article Title: Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions

Journal: Stem Cells (Dayton, Ohio)

doi: 10.1634/stemcells.2008-0696

Experimental strategy for mapping retroviral insertion sites in iPS clones. DNA was extracted from individual iPS cell clones, and the fragments between the retroviral 5′ long terminal repeats and mouse genomic DNA were amplified by LM-PCR. The resulting amplicons were then sequenced either after cloning in bacterial plasmids or directly by high-throughput sequencing. Retroviral insertions were then determined by performing Ensembl BLAST searches against a mouse genome database. Abbreviations: iPS, induced pluripotent stem; LM-PCR, ligation-mediated polymerase chain reaction.
Figure Legend Snippet: Experimental strategy for mapping retroviral insertion sites in iPS clones. DNA was extracted from individual iPS cell clones, and the fragments between the retroviral 5′ long terminal repeats and mouse genomic DNA were amplified by LM-PCR. The resulting amplicons were then sequenced either after cloning in bacterial plasmids or directly by high-throughput sequencing. Retroviral insertions were then determined by performing Ensembl BLAST searches against a mouse genome database. Abbreviations: iPS, induced pluripotent stem; LM-PCR, ligation-mediated polymerase chain reaction.

Techniques Used: Clone Assay, Amplification, Polymerase Chain Reaction, Next-Generation Sequencing, Ligation

22) Product Images from "HIV-1 Drug Resistance in the iPrEx Preexposure Prophylaxis Trial"

Article Title: HIV-1 Drug Resistance in the iPrEx Preexposure Prophylaxis Trial

Journal: The Journal of Infectious Diseases

doi: 10.1093/infdis/jiu233

Schematic of the qMVA for low-level drug resistance. A , FTC/TDF selected mutations measured by the qMVA. DNA amplicons spanning TDF-associated mutations K65R, K70E, and FTC-associated mutations M184V/I are generated by nested RT-PCR from plasma HIV-1 virions, representing the predominant and minor quasispecies. The example shows a hypothetical viral mixture at rt 65 with 99% WT (consensus B codon AAA, Lys) and 1.0% Mut (consensus B codon AGA, Arg) where the mutant sequence is undetectable by population sequencing. B , Cure PCR step. The cure PCR step is performed prior to the AS-PCR step to normalize possible sequence heterogeneity in the AS-PCR primer target sites that can reduce PCR efficiency and result in inaccurate quantification of the minor variant population. The example portrays a virus that differs from the discriminatory AS-PCR primer at 2 sites upstream from the SNP conferring resistance. A low-stringency PCR with limited cycle number is performed on the mixed WT (99%) and Mut (1%) DNA amplicons, using a consensus sequence-based primer pair covering the AS-PCR target sites adjacent to but not including the SNP conferring resistance. When paired with another consensus primer, AS-PCR target amplicons are generated representing the original WT:Mut SNP mixtures, but with AS-PCR target sequences normalized to HIV-1 consensus sequences. C , AS-PCR reaction. Amplicons generated by the cure PCR are diluted appropriately and duplicate PCR reactions are performed with primers specific for the WT or Mut SNP. The discriminatory capability of the AS-PCR primers is enhanced by incorporating a 3′, -2 base mismatch into the AS-PCR primer [ 36 ]. D , Determining percent mutant by ΔCt. The percent minor variant in a mixture of WT:Mut amplicons is determined by ΔCt measurements from real-time PCR using WT- and Mut-specific discriminatory primers. When extrapolated by linear regression against a 6-point standard curve run simultaneously (0.1% to 24.3% Mut input in WT background), the percent minor variant (65R) can be derived. Abbreviations: AS-PCR, allele-specific polymerase chain reaction; FTC, emtricitabine; HIV, human immunodeficiency virus; Mut, mutant; PCR, polymerase chain reaction; qMVA, quantitative minor variant assay; RT-PCR, reverse-transcriptase PCR; SNP, single nucleotide polymorphism; TDF, tenofovir disoproxil fumarate; WT, wild-type.
Figure Legend Snippet: Schematic of the qMVA for low-level drug resistance. A , FTC/TDF selected mutations measured by the qMVA. DNA amplicons spanning TDF-associated mutations K65R, K70E, and FTC-associated mutations M184V/I are generated by nested RT-PCR from plasma HIV-1 virions, representing the predominant and minor quasispecies. The example shows a hypothetical viral mixture at rt 65 with 99% WT (consensus B codon AAA, Lys) and 1.0% Mut (consensus B codon AGA, Arg) where the mutant sequence is undetectable by population sequencing. B , Cure PCR step. The cure PCR step is performed prior to the AS-PCR step to normalize possible sequence heterogeneity in the AS-PCR primer target sites that can reduce PCR efficiency and result in inaccurate quantification of the minor variant population. The example portrays a virus that differs from the discriminatory AS-PCR primer at 2 sites upstream from the SNP conferring resistance. A low-stringency PCR with limited cycle number is performed on the mixed WT (99%) and Mut (1%) DNA amplicons, using a consensus sequence-based primer pair covering the AS-PCR target sites adjacent to but not including the SNP conferring resistance. When paired with another consensus primer, AS-PCR target amplicons are generated representing the original WT:Mut SNP mixtures, but with AS-PCR target sequences normalized to HIV-1 consensus sequences. C , AS-PCR reaction. Amplicons generated by the cure PCR are diluted appropriately and duplicate PCR reactions are performed with primers specific for the WT or Mut SNP. The discriminatory capability of the AS-PCR primers is enhanced by incorporating a 3′, -2 base mismatch into the AS-PCR primer [ 36 ]. D , Determining percent mutant by ΔCt. The percent minor variant in a mixture of WT:Mut amplicons is determined by ΔCt measurements from real-time PCR using WT- and Mut-specific discriminatory primers. When extrapolated by linear regression against a 6-point standard curve run simultaneously (0.1% to 24.3% Mut input in WT background), the percent minor variant (65R) can be derived. Abbreviations: AS-PCR, allele-specific polymerase chain reaction; FTC, emtricitabine; HIV, human immunodeficiency virus; Mut, mutant; PCR, polymerase chain reaction; qMVA, quantitative minor variant assay; RT-PCR, reverse-transcriptase PCR; SNP, single nucleotide polymorphism; TDF, tenofovir disoproxil fumarate; WT, wild-type.

Techniques Used: Generated, Reverse Transcription Polymerase Chain Reaction, Mutagenesis, Sequencing, Polymerase Chain Reaction, Variant Assay, Real-time Polymerase Chain Reaction, Derivative Assay

23) Product Images from "Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance"

Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance

Journal: Molecular Neurodegeneration

doi: 10.1186/1750-1326-4-37

Distributions of heteroplasmic mutations in sPD and CTL brain mtDNA . mtDNA's from six sPD and six CTL brains were amplified using primer pairs A-H. The amplicons were subject to Surveyor Nuclease treatment and separation/analysis of products using Experion 12K DNA chips. Bands from 1000-1900 bp size are included in the Figure. The Y-axes are DNA levels and X-axes are product sizes in bp.
Figure Legend Snippet: Distributions of heteroplasmic mutations in sPD and CTL brain mtDNA . mtDNA's from six sPD and six CTL brains were amplified using primer pairs A-H. The amplicons were subject to Surveyor Nuclease treatment and separation/analysis of products using Experion 12K DNA chips. Bands from 1000-1900 bp size are included in the Figure. The Y-axes are DNA levels and X-axes are product sizes in bp.

Techniques Used: CTL Assay, Amplification

24) Product Images from "Evolution of Extensively Fragmented Mitochondrial Genomes in the Lice of Humans"

Article Title: Evolution of Extensively Fragmented Mitochondrial Genomes in the Lice of Humans

Journal: Genome Biology and Evolution

doi: 10.1093/gbe/evs088

PCR amplicons from the mitochondrial genomes of the human head louse, Pediculus capitis ( A ) and the human pubic louse, Pthirus pubis ( B ). ( A ) Amplicons from PcF and PcR primers that span the entire coding regions of the mt minichromosomes of the head louse. ( B ) Amplicons from PpF and PpR1 primers that span the entire coding and NCRs of the mt minichromosomes of the pubic louse. ( C ) Amplicons from PpF and PpR2 primers that span the entire coding regions of the mt minichromosomes of the pubic louse.
Figure Legend Snippet: PCR amplicons from the mitochondrial genomes of the human head louse, Pediculus capitis ( A ) and the human pubic louse, Pthirus pubis ( B ). ( A ) Amplicons from PcF and PcR primers that span the entire coding regions of the mt minichromosomes of the head louse. ( B ) Amplicons from PpF and PpR1 primers that span the entire coding and NCRs of the mt minichromosomes of the pubic louse. ( C ) Amplicons from PpF and PpR2 primers that span the entire coding regions of the mt minichromosomes of the pubic louse.

Techniques Used: Polymerase Chain Reaction

25) Product Images from "Evolution of Extensively Fragmented Mitochondrial Genomes in the Lice of Humans"

Article Title: Evolution of Extensively Fragmented Mitochondrial Genomes in the Lice of Humans

Journal: Genome Biology and Evolution

doi: 10.1093/gbe/evs088

PCR amplicons from the mitochondrial genomes of the human head louse, Pediculus capitis ( A ) and the human pubic louse, Pthirus pubis ( B ). ( A ) Amplicons from PcF and PcR primers that span the entire coding regions of the mt minichromosomes of the head louse. ( B ) Amplicons from PpF and PpR1 primers that span the entire coding and NCRs of the mt minichromosomes of the pubic louse. ( C ) Amplicons from PpF and PpR2 primers that span the entire coding regions of the mt minichromosomes of the pubic louse.
Figure Legend Snippet: PCR amplicons from the mitochondrial genomes of the human head louse, Pediculus capitis ( A ) and the human pubic louse, Pthirus pubis ( B ). ( A ) Amplicons from PcF and PcR primers that span the entire coding regions of the mt minichromosomes of the head louse. ( B ) Amplicons from PpF and PpR1 primers that span the entire coding and NCRs of the mt minichromosomes of the pubic louse. ( C ) Amplicons from PpF and PpR2 primers that span the entire coding regions of the mt minichromosomes of the pubic louse.

Techniques Used: Polymerase Chain Reaction

26) Product Images from "Validation of an Oligonucleotide Ligation Assay for Quantification of Human Immunodeficiency Virus Type 1 Drug-Resistant Mutants by Use of Massively Parallel Sequencing"

Article Title: Validation of an Oligonucleotide Ligation Assay for Quantification of Human Immunodeficiency Virus Type 1 Drug-Resistant Mutants by Use of Massively Parallel Sequencing

Journal: Journal of Clinical Microbiology

doi: 10.1128/JCM.00306-14

Correlation of mutant concentrations at specific HIV pol sites encoding NNRTI and lamivudine resistance, quantified by OLA and 454 pyrosequencing. (A) Concentrations of NNRTI resistance mutations K103N, V106M, Y181C, and G190A detected in amplicons from
Figure Legend Snippet: Correlation of mutant concentrations at specific HIV pol sites encoding NNRTI and lamivudine resistance, quantified by OLA and 454 pyrosequencing. (A) Concentrations of NNRTI resistance mutations K103N, V106M, Y181C, and G190A detected in amplicons from

Techniques Used: Mutagenesis

27) Product Images from "Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions"

Article Title: Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions

Journal: Stem Cells (Dayton, Ohio)

doi: 10.1634/stemcells.2008-0696

Experimental strategy for mapping retroviral insertion sites in iPS clones. DNA was extracted from individual iPS cell clones, and the fragments between the retroviral 5′ long terminal repeats and mouse genomic DNA were amplified by LM-PCR. The resulting amplicons were then sequenced either after cloning in bacterial plasmids or directly by high-throughput sequencing. Retroviral insertions were then determined by performing Ensembl BLAST searches against a mouse genome database. Abbreviations: iPS, induced pluripotent stem; LM-PCR, ligation-mediated polymerase chain reaction.
Figure Legend Snippet: Experimental strategy for mapping retroviral insertion sites in iPS clones. DNA was extracted from individual iPS cell clones, and the fragments between the retroviral 5′ long terminal repeats and mouse genomic DNA were amplified by LM-PCR. The resulting amplicons were then sequenced either after cloning in bacterial plasmids or directly by high-throughput sequencing. Retroviral insertions were then determined by performing Ensembl BLAST searches against a mouse genome database. Abbreviations: iPS, induced pluripotent stem; LM-PCR, ligation-mediated polymerase chain reaction.

Techniques Used: Clone Assay, Amplification, Polymerase Chain Reaction, Next-Generation Sequencing, Ligation

28) Product Images from "The endothelial-specific regulatory mutation, Mvwf1, is a common mouse founder allele"

Article Title: The endothelial-specific regulatory mutation, Mvwf1, is a common mouse founder allele

Journal: Mammalian Genome

doi: 10.1007/s00335-007-9079-4

Mvwf1 haplotype block. A highly conserved Mvwf1 haplotype block (yellow) is shared by the Mvwf1 inbred strains and distinct from other wild-derived inbred strains representative of the M. m. musculus clade, M. spretus , and M. spicilegus . Strain ID numbers are indicated on the left (see Supplementary Table 1 ). Colors were assigned to similar sequences based upon PAUP phylogeny trees; missing data are white. The B4galnt2 exon 1 boundary is highlighted by the thick white vertical line. The Mvwf1 haplotype block is outlined in black. Shorter segments in seven additional strains (28, 64, 37, 38, 40, 31, 20) have two or more contiguous amplicons with sequence identity to the Mvwf1 strains (outlined in the red boxes)
Figure Legend Snippet: Mvwf1 haplotype block. A highly conserved Mvwf1 haplotype block (yellow) is shared by the Mvwf1 inbred strains and distinct from other wild-derived inbred strains representative of the M. m. musculus clade, M. spretus , and M. spicilegus . Strain ID numbers are indicated on the left (see Supplementary Table 1 ). Colors were assigned to similar sequences based upon PAUP phylogeny trees; missing data are white. The B4galnt2 exon 1 boundary is highlighted by the thick white vertical line. The Mvwf1 haplotype block is outlined in black. Shorter segments in seven additional strains (28, 64, 37, 38, 40, 31, 20) have two or more contiguous amplicons with sequence identity to the Mvwf1 strains (outlined in the red boxes)

Techniques Used: Blocking Assay, Derivative Assay, Sequencing

29) Product Images from "Improved Efficiency and Reliability of NGS Amplicon Sequencing Data Analysis for Genetic Diagnostic Procedures Using AGSA Software"

Article Title: Improved Efficiency and Reliability of NGS Amplicon Sequencing Data Analysis for Genetic Diagnostic Procedures Using AGSA Software

Journal: BioMed Research International

doi: 10.1155/2016/5623089

250 patients were studied for BRCA mutations by Access Array Fluidigm combined with 454 pyrosequencing and AGSA analysis. This sequencing methodology was compared to Sanger analysis in terms of percentage of amplicons to be reanalysed for BRCA1 (a) and BRCA2 (b), cost per patient (c), and time required to analyse 96 patients (d).
Figure Legend Snippet: 250 patients were studied for BRCA mutations by Access Array Fluidigm combined with 454 pyrosequencing and AGSA analysis. This sequencing methodology was compared to Sanger analysis in terms of percentage of amplicons to be reanalysed for BRCA1 (a) and BRCA2 (b), cost per patient (c), and time required to analyse 96 patients (d).

Techniques Used: Sequencing

30) Product Images from "VH1 Family Immunoglobulin Repertoire Sequencing after Allogeneic Hematopoietic Stem Cell Transplantation"

Article Title: VH1 Family Immunoglobulin Repertoire Sequencing after Allogeneic Hematopoietic Stem Cell Transplantation

Journal: PLoS ONE

doi: 10.1371/journal.pone.0168096

Human bone marrow samples show highly individual Ig-Repertoires. (a) Schematic overview of human VDJ-amplicons. Amplicon libraries for each Ig class contain framework (FR2, 3) and complementary determining regions (CDR1, 2, 3). (b) In a set of 4000 IgG-sequences per bone marrow sample, clones with 95% CDR3 sequence identity and identical VJ-usage were clustered as clonotypes. Frequencies of clonotypes are indicated by color code; clonotypes comprising more than 5% of the repertoire are highlighted in blue and numbers indicate their frequencies; grey color indicates absence of a given clonotype. Clontypes were sorted according to their frequency in healthy donor (HD) 1 and the 100 most frequent clonotypes of HD1 and their abundance in HD2-4 were displayed as heatmap. Similarity of repertoires was expressed as Morisita-Horn index (MHI), comparing 4000 clustered CDR3 sequences of HD1-4. Symbols represent pairwise comparisons. (c) The IgG-repertoire of HD4 (I) was re-investigated as independent V H1 DJ-amplificate (II) or de-novo cDNA plus V H1 DJ-amplificate (III). Repertoire-similarity of I to its technical replicates II and III is illustrated by heatmap and MHI, evaluating 2500 clustered sequences of each sample.
Figure Legend Snippet: Human bone marrow samples show highly individual Ig-Repertoires. (a) Schematic overview of human VDJ-amplicons. Amplicon libraries for each Ig class contain framework (FR2, 3) and complementary determining regions (CDR1, 2, 3). (b) In a set of 4000 IgG-sequences per bone marrow sample, clones with 95% CDR3 sequence identity and identical VJ-usage were clustered as clonotypes. Frequencies of clonotypes are indicated by color code; clonotypes comprising more than 5% of the repertoire are highlighted in blue and numbers indicate their frequencies; grey color indicates absence of a given clonotype. Clontypes were sorted according to their frequency in healthy donor (HD) 1 and the 100 most frequent clonotypes of HD1 and their abundance in HD2-4 were displayed as heatmap. Similarity of repertoires was expressed as Morisita-Horn index (MHI), comparing 4000 clustered CDR3 sequences of HD1-4. Symbols represent pairwise comparisons. (c) The IgG-repertoire of HD4 (I) was re-investigated as independent V H1 DJ-amplificate (II) or de-novo cDNA plus V H1 DJ-amplificate (III). Repertoire-similarity of I to its technical replicates II and III is illustrated by heatmap and MHI, evaluating 2500 clustered sequences of each sample.

Techniques Used: Amplification, Clone Assay, Sequencing

31) Product Images from "Bacterial Community of the Rice Floodwater Using Cultivation-Independent Approaches"

Article Title: Bacterial Community of the Rice Floodwater Using Cultivation-Independent Approaches

Journal: International Journal of Microbiology

doi: 10.1155/2018/6280484

Rarefaction curves generated from 16S amplicons sampled from floodwaters from vegetative and reproductive rice stages. Rarefaction curves were generated using the rarefaction.single command in mothur with freq=100 and iters=10000.
Figure Legend Snippet: Rarefaction curves generated from 16S amplicons sampled from floodwaters from vegetative and reproductive rice stages. Rarefaction curves were generated using the rarefaction.single command in mothur with freq=100 and iters=10000.

Techniques Used: Generated

32) Product Images from "Bacterial overgrowth and diversification of microbiota in gastric cancer"

Article Title: Bacterial overgrowth and diversification of microbiota in gastric cancer

Journal: European Journal of Gastroenterology & Hepatology

doi: 10.1097/MEG.0000000000000542

Compositions of gastric microbiota at the phylum level. High-throughput sequencing of amplicons of the 16S rRNA gene was performed on 12 samples from patients with chronic gastritis (201–206) and gastric cancer (207–212).
Figure Legend Snippet: Compositions of gastric microbiota at the phylum level. High-throughput sequencing of amplicons of the 16S rRNA gene was performed on 12 samples from patients with chronic gastritis (201–206) and gastric cancer (207–212).

Techniques Used: Next-Generation Sequencing

33) Product Images from "Performance comparison of two commercial human whole-exome capture systems on formalin-fixed paraffin-embedded lung adenocarcinoma samples"

Article Title: Performance comparison of two commercial human whole-exome capture systems on formalin-fixed paraffin-embedded lung adenocarcinoma samples

Journal: BMC Cancer

doi: 10.1186/s12885-016-2720-4

Coverage distribution across 90 PCR-capture amplicons between FF and FFPE samples. Coverage distribution across the 90 ‘AmpliSeq Colon and Lung Cancer Panel’ regions displays a similar trend between the FF (blue) and FFPE (red) libraries in both Agilent SureSelect ( a ) and Roche NimbleGen ( b ) libraries respectively, with a slightly better coverage in FFPE samples. Each amplicon is identified by a number as reported in Additional file 3 : TableS7
Figure Legend Snippet: Coverage distribution across 90 PCR-capture amplicons between FF and FFPE samples. Coverage distribution across the 90 ‘AmpliSeq Colon and Lung Cancer Panel’ regions displays a similar trend between the FF (blue) and FFPE (red) libraries in both Agilent SureSelect ( a ) and Roche NimbleGen ( b ) libraries respectively, with a slightly better coverage in FFPE samples. Each amplicon is identified by a number as reported in Additional file 3 : TableS7

Techniques Used: Polymerase Chain Reaction, Formalin-fixed Paraffin-Embedded, Amplification

Comparison of coverage distribution across 90 PCR-capture amplicons of both WES systems. The comparison shows a lower uniformity across the amplicons in Agilent libraries, with a higher number of low read depth regions (20 amplicons with coverage
Figure Legend Snippet: Comparison of coverage distribution across 90 PCR-capture amplicons of both WES systems. The comparison shows a lower uniformity across the amplicons in Agilent libraries, with a higher number of low read depth regions (20 amplicons with coverage

Techniques Used: Polymerase Chain Reaction

34) Product Images from "Novel nuclear barcode regions for the identification of flatfish species"

Article Title: Novel nuclear barcode regions for the identification of flatfish species

Journal: Food Control

doi: 10.1016/j.foodcont.2017.04.009

Generation of reference barcode sequences . For each of the primer pairs, reference barcode regions for different species were generated using a mix of in silico and experimental procedures, that included: (A) Scanning the NCBI genome sequences by electronic PCR, (B) Scanning the std section of the ENA database with the ecoPCR tool, (C) Assembling NGS reads from NCBI's Sequence Read Archive and (D) Sequencing the amplicons produced in fish voucher samples. (E) List of species in the Pleuronectoidei family for which at least one reference sequence was obtained, showing the strategies available for each.
Figure Legend Snippet: Generation of reference barcode sequences . For each of the primer pairs, reference barcode regions for different species were generated using a mix of in silico and experimental procedures, that included: (A) Scanning the NCBI genome sequences by electronic PCR, (B) Scanning the std section of the ENA database with the ecoPCR tool, (C) Assembling NGS reads from NCBI's Sequence Read Archive and (D) Sequencing the amplicons produced in fish voucher samples. (E) List of species in the Pleuronectoidei family for which at least one reference sequence was obtained, showing the strategies available for each.

Techniques Used: Generated, In Silico, Polymerase Chain Reaction, Next-Generation Sequencing, Sequencing, Produced, Fluorescence In Situ Hybridization

35) Product Images from "Evaluation of bisulfite kits for DNA methylation profiling in terms of DNA fragmentation and DNA recovery using digital PCR"

Article Title: Evaluation of bisulfite kits for DNA methylation profiling in terms of DNA fragmentation and DNA recovery using digital PCR

Journal: PLoS ONE

doi: 10.1371/journal.pone.0199091

Cq values ± SD of the smallest and the largest amplicons. The data used are the geometric means of the average values from the five donor samples as shown in S3 Table . The data labels refer to the kit number as provided in Table 1 .
Figure Legend Snippet: Cq values ± SD of the smallest and the largest amplicons. The data used are the geometric means of the average values from the five donor samples as shown in S3 Table . The data labels refer to the kit number as provided in Table 1 .

Techniques Used:

36) Product Images from "Time-series metagenomic analysis reveals robustness of soil microbiome against chemical disturbance"

Article Title: Time-series metagenomic analysis reveals robustness of soil microbiome against chemical disturbance

Journal: DNA Research: An International Journal for Rapid Publication of Reports on Genes and Genomes

doi: 10.1093/dnares/dsv023

Phylum- and genus-level taxonomical succession of microbial communities in control and polluted soils. PCR amplicons of V3–V4 regions in the 16S rRNA genes from metagenomic samples were pyrosequenced, and taxonomically assigned by the RDP classifier (see the text for details). (A) Phylum-level succession. (B) Genus-level succession. C and M: metagenomic samples from the control and polluted soils, respectively. The numerals before C and M are the weeks after the pollution. Only the top 15 prokaryotic genera are shown for simplicity. Taxa with asterisks are genera incertae sedis .
Figure Legend Snippet: Phylum- and genus-level taxonomical succession of microbial communities in control and polluted soils. PCR amplicons of V3–V4 regions in the 16S rRNA genes from metagenomic samples were pyrosequenced, and taxonomically assigned by the RDP classifier (see the text for details). (A) Phylum-level succession. (B) Genus-level succession. C and M: metagenomic samples from the control and polluted soils, respectively. The numerals before C and M are the weeks after the pollution. Only the top 15 prokaryotic genera are shown for simplicity. Taxa with asterisks are genera incertae sedis .

Techniques Used: Polymerase Chain Reaction

Hierarchical clustering analysis of taxonomic and functional compositions of 11 soil metagenomic samples. Clustering of (A) taxonomic compositions of 97% OTUs of 16S rRNA gene amplicons, and (B) functional compositions of genes for KEGG KO-assigned proteins was performed by comparison of the Euclidean distances. See the text for details.
Figure Legend Snippet: Hierarchical clustering analysis of taxonomic and functional compositions of 11 soil metagenomic samples. Clustering of (A) taxonomic compositions of 97% OTUs of 16S rRNA gene amplicons, and (B) functional compositions of genes for KEGG KO-assigned proteins was performed by comparison of the Euclidean distances. See the text for details.

Techniques Used: Functional Assay

Time-course changes in taxonomic and functional diversity of metagenomes in control and polluted soils. (A) Taxonomic diversity. (B) Functional diversity. Open and closed circles: control and polluted soils, respectively. The Shannon-Wiener indices (H′) for taxonomic and functional diversities of the metagenomic samples were calculated from the compositions of 97% OTUs of the 16S rRNA gene amplicons and the compositions of genes for KO-assigned proteins, respectively.
Figure Legend Snippet: Time-course changes in taxonomic and functional diversity of metagenomes in control and polluted soils. (A) Taxonomic diversity. (B) Functional diversity. Open and closed circles: control and polluted soils, respectively. The Shannon-Wiener indices (H′) for taxonomic and functional diversities of the metagenomic samples were calculated from the compositions of 97% OTUs of the 16S rRNA gene amplicons and the compositions of genes for KO-assigned proteins, respectively.

Techniques Used: Functional Assay

37) Product Images from "High-Throughput Multilocus Sequence Typing: Bringing Molecular Typing to the Next Level"

Article Title: High-Throughput Multilocus Sequence Typing: Bringing Molecular Typing to the Next Level

Journal: PLoS ONE

doi: 10.1371/journal.pone.0039630

The workflow for profiling 96 bacterial isolates with HiMLST. MLST target genes are amplified by a two-step PCR in multi-well plates. These amplicons are pooled, quantified, clonally amplified by emulsion PCR and sequenced by NGS. The workflow ends with the ST profiling of the individual bacterial isolate. Figures in squares indicate the hands-on time for each individual step.
Figure Legend Snippet: The workflow for profiling 96 bacterial isolates with HiMLST. MLST target genes are amplified by a two-step PCR in multi-well plates. These amplicons are pooled, quantified, clonally amplified by emulsion PCR and sequenced by NGS. The workflow ends with the ST profiling of the individual bacterial isolate. Figures in squares indicate the hands-on time for each individual step.

Techniques Used: Amplification, Polymerase Chain Reaction, Next-Generation Sequencing

Two-Step PCR strategy for HiMLST. During the first PCR, the targeted MLST gene is amplified and universal tails are incorporated. During the second PCR, the amplicons of each isolate are provided with 454 sequencing-specific nucleotides and a unique DNA barcode, the multiplex identifier (MID).
Figure Legend Snippet: Two-Step PCR strategy for HiMLST. During the first PCR, the targeted MLST gene is amplified and universal tails are incorporated. During the second PCR, the amplicons of each isolate are provided with 454 sequencing-specific nucleotides and a unique DNA barcode, the multiplex identifier (MID).

Techniques Used: Polymerase Chain Reaction, Amplification, Sequencing, Multiplex Assay

38) Product Images from "Evaluation of next generation sequencing platforms for population targeted sequencing studies"

Article Title: Evaluation of next generation sequencing platforms for population targeted sequencing studies

Journal: Genome Biology

doi: 10.1186/gb-2009-10-3-r32

Non-uniform per-base sequence coverage. The 100-kb interval on chromosome 3 encoding the SCN5A gene (blue rectangles and joining lines) was amplified using eight LR-PCR amplicons (red filled rectangles in upper panel). On the y-axis, the fold sequence coverage scale is shown for each platform. The upper panel shows that amplicon end sequences are highly overrepresented. The y-axis was set to show the relative fold coverage of the sequences in the interval and therefore does not accurately represent the maximum fold coverage of the amplicon ends, which was 311, 195,473, and 15,041 for Roche 454, Illumina GA, and ABI SOLiD, respectively, in the sample shown. The lower panel shows the non-uniformity of sequence coverage across an approximately 17-kb region encompassing four exons of SCN5A . The locations of the repetitive elements (lower black/gray rectangles) in the interval are shown.
Figure Legend Snippet: Non-uniform per-base sequence coverage. The 100-kb interval on chromosome 3 encoding the SCN5A gene (blue rectangles and joining lines) was amplified using eight LR-PCR amplicons (red filled rectangles in upper panel). On the y-axis, the fold sequence coverage scale is shown for each platform. The upper panel shows that amplicon end sequences are highly overrepresented. The y-axis was set to show the relative fold coverage of the sequences in the interval and therefore does not accurately represent the maximum fold coverage of the amplicon ends, which was 311, 195,473, and 15,041 for Roche 454, Illumina GA, and ABI SOLiD, respectively, in the sample shown. The lower panel shows the non-uniformity of sequence coverage across an approximately 17-kb region encompassing four exons of SCN5A . The locations of the repetitive elements (lower black/gray rectangles) in the interval are shown.

Techniques Used: Sequencing, Amplification, Polymerase Chain Reaction

Overview of experimental design. Six genomic intervals, each encoding genes for K + /Na + voltage-gated channel proteins, were amplified using DNA from four individuals and LR-PCR reactions to generate 260 kb of target sequence per sample. Amplicons from each individual were pooled in equimolar amounts and then sequenced using the three NGS platforms. The 260 kb examined in this study is representative of human sequences containing 38% repeats and 4% coding sequence compared with 47% and 1%, respectively, genome-wide. For each sample 88 kb was amplified using short range PCR (SR-PCR) reactions targeting the exons and evolutionarily conserved intronic regions. Each SR-PCR amplicon was individually sequenced in the forward and reverse directions using the ABI-3730xL platform (Additional data file 2). Data generated from the NGS platforms were analyzed to identify bases variants from the reference sequence (build 36) and the quality of the variant calls was assessed using platform specific methodologies. A comparative analysis of the sequence data from the NGS platforms and ABI Sanger was then performed to determine accuracy, and false positive and false negative rates.
Figure Legend Snippet: Overview of experimental design. Six genomic intervals, each encoding genes for K + /Na + voltage-gated channel proteins, were amplified using DNA from four individuals and LR-PCR reactions to generate 260 kb of target sequence per sample. Amplicons from each individual were pooled in equimolar amounts and then sequenced using the three NGS platforms. The 260 kb examined in this study is representative of human sequences containing 38% repeats and 4% coding sequence compared with 47% and 1%, respectively, genome-wide. For each sample 88 kb was amplified using short range PCR (SR-PCR) reactions targeting the exons and evolutionarily conserved intronic regions. Each SR-PCR amplicon was individually sequenced in the forward and reverse directions using the ABI-3730xL platform (Additional data file 2). Data generated from the NGS platforms were analyzed to identify bases variants from the reference sequence (build 36) and the quality of the variant calls was assessed using platform specific methodologies. A comparative analysis of the sequence data from the NGS platforms and ABI Sanger was then performed to determine accuracy, and false positive and false negative rates.

Techniques Used: Amplification, Polymerase Chain Reaction, Sequencing, Next-Generation Sequencing, Genome Wide, Generated, Variant Assay

39) Product Images from "Affordable, Abbreviated Roche Monitor Assay for Quantification of Human Immunodeficiency Virus Type 1 RNA in Plasma"

Article Title: Affordable, Abbreviated Roche Monitor Assay for Quantification of Human Immunodeficiency Virus Type 1 RNA in Plasma

Journal: Journal of Clinical Microbiology

doi: 10.1128/JCM.43.8.4200-4202.2005

Correlation between the four-well and eight-well assays in the prospective study. Plasma from 94 subtype C specimens tested in the manual assay (circles) and 105 subtype B specimens tested in the COBAS assay (triangles) were assayed following the package insert instructions and using all eight wells. Then the previously generated amplicons were redetected using only the 1:1, 1:25, and 1:625 HIV dilutions and the 1:1 QS dilution. r = 0.97.
Figure Legend Snippet: Correlation between the four-well and eight-well assays in the prospective study. Plasma from 94 subtype C specimens tested in the manual assay (circles) and 105 subtype B specimens tested in the COBAS assay (triangles) were assayed following the package insert instructions and using all eight wells. Then the previously generated amplicons were redetected using only the 1:1, 1:25, and 1:625 HIV dilutions and the 1:1 QS dilution. r = 0.97.

Techniques Used: Generated

40) Product Images from "APOBEC3B can impair genomic stability by inducing base substitutions in genomic DNA in human cells"

Article Title: APOBEC3B can impair genomic stability by inducing base substitutions in genomic DNA in human cells

Journal: Scientific Reports

doi: 10.1038/srep00806

Foreign DNA editing by A3A, A3B, and AID. (A) Agarose gel analyses of 3D-PCR products from HEK293 cells. Cells were transfected with expression vector for A3A, A3B wild-type or mutant, or AID together with pEGFP-N3 and pEF-UGI. Total DNA was recovered 2 days after transfection, and EGFP gene was amplified by 3D-PCR at the indicated denaturation temperatures (Td). (B) Mutation matrices of hyperedited EGFP sequences derived from cloned amplicons at 83.8°C of Td. “n” indicates the number of bases sequenced. We sequenced 5 clones (2,225 base pairs in total) in each group. (C) Frequencies of C/G to T/A transitions in hyperedited EGFP genes. C/G to T/A transitions per 1,000 sequenced base pairs are shown. (D) Dinucleotide contexts in foreign DNA editing. The rates of indicated dinucleotide sequence at the C to T transitions are shown. Asterisks indicate statistical significance in a χ 2 test (p
Figure Legend Snippet: Foreign DNA editing by A3A, A3B, and AID. (A) Agarose gel analyses of 3D-PCR products from HEK293 cells. Cells were transfected with expression vector for A3A, A3B wild-type or mutant, or AID together with pEGFP-N3 and pEF-UGI. Total DNA was recovered 2 days after transfection, and EGFP gene was amplified by 3D-PCR at the indicated denaturation temperatures (Td). (B) Mutation matrices of hyperedited EGFP sequences derived from cloned amplicons at 83.8°C of Td. “n” indicates the number of bases sequenced. We sequenced 5 clones (2,225 base pairs in total) in each group. (C) Frequencies of C/G to T/A transitions in hyperedited EGFP genes. C/G to T/A transitions per 1,000 sequenced base pairs are shown. (D) Dinucleotide contexts in foreign DNA editing. The rates of indicated dinucleotide sequence at the C to T transitions are shown. Asterisks indicate statistical significance in a χ 2 test (p

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Transfection, Expressing, Plasmid Preparation, Mutagenesis, Amplification, Derivative Assay, Clone Assay, Sequencing

Expression of A3B and somatic mutations in oncogenes in human lymphoma cell lines. (A) Quantitative RT-PCR for A3A , A3B , and AID in lymphoma cell lines. The levels of target cDNA were normalized to the endogenous hypoxanthine phosphoribosyl transferase 1 ( HPRT1 ) and then compared to those in peripheral blood lymphocytes. (B) Mutational analyses of C-myc , Pax5 , and A20 in SUDH6 and KIS1 cells. We recovered total DNA from the cells and amplified the sequence between exon1 and intron1 of C-myc , Pax5 and A20 by PCR and performed direct sequencing of the amplicons. Locations of somatic mutations are shown below the loci with their positions. (C) The expression levels of transcripts of C-myc , Pax5 , and A20 in KIS1 and SUDHL6 cells. Quantitative RT-PCR was similarly performed with (a).
Figure Legend Snippet: Expression of A3B and somatic mutations in oncogenes in human lymphoma cell lines. (A) Quantitative RT-PCR for A3A , A3B , and AID in lymphoma cell lines. The levels of target cDNA were normalized to the endogenous hypoxanthine phosphoribosyl transferase 1 ( HPRT1 ) and then compared to those in peripheral blood lymphocytes. (B) Mutational analyses of C-myc , Pax5 , and A20 in SUDH6 and KIS1 cells. We recovered total DNA from the cells and amplified the sequence between exon1 and intron1 of C-myc , Pax5 and A20 by PCR and performed direct sequencing of the amplicons. Locations of somatic mutations are shown below the loci with their positions. (C) The expression levels of transcripts of C-myc , Pax5 , and A20 in KIS1 and SUDHL6 cells. Quantitative RT-PCR was similarly performed with (a).

Techniques Used: Expressing, Quantitative RT-PCR, Amplification, Sequencing, Polymerase Chain Reaction

Deep sequencing of EGFP genes in genomic DNA. (A) The distributions of C/G to T/A substitutions in the EGFP sequences. Total DNA was recovered form HEK293/EGFP cells 7 days after transfection with expression vector for A3A, A3B wild type or H66/253R or AID. We amplified a portion of EGFP sequence from thymine 47 to cytidine 504 (top schematic) by PCR with high-fidelity polymerase and sequenced the amplicons by GS-junior bench top system (Roche). Sequence data were analyzed with equipped software. “Coverage” indicates the total numbers of sequenced reads. (B) Frequencies of base substitutions in hyperedited EGFP genes. Base substitutions were classified to 6 groups and substituted base number of each group per 1,000 sequenced base pairs are show. (C) Dinucleotide contexts in genomic DNA editing. The rates of indicated dinucleotide sequence at the C to T transitions are shown. Deviations in the editing contexts do not reach statistical significance (p
Figure Legend Snippet: Deep sequencing of EGFP genes in genomic DNA. (A) The distributions of C/G to T/A substitutions in the EGFP sequences. Total DNA was recovered form HEK293/EGFP cells 7 days after transfection with expression vector for A3A, A3B wild type or H66/253R or AID. We amplified a portion of EGFP sequence from thymine 47 to cytidine 504 (top schematic) by PCR with high-fidelity polymerase and sequenced the amplicons by GS-junior bench top system (Roche). Sequence data were analyzed with equipped software. “Coverage” indicates the total numbers of sequenced reads. (B) Frequencies of base substitutions in hyperedited EGFP genes. Base substitutions were classified to 6 groups and substituted base number of each group per 1,000 sequenced base pairs are show. (C) Dinucleotide contexts in genomic DNA editing. The rates of indicated dinucleotide sequence at the C to T transitions are shown. Deviations in the editing contexts do not reach statistical significance (p

Techniques Used: Sequencing, Transfection, Expressing, Plasmid Preparation, Amplification, Polymerase Chain Reaction, Software

A3B induced somatic mutations into c-myc gene in human lymphoma cells. (A) Agarose gel analyses of 3D-PCR products of c-Myc genes in SUDHL6. We transfected expression vector for A3B wild-type or H66/253R or empty vector and recovered total DNA 7 days after transfection. C-myc genes were amplified by 3D-PCR at the indicated denaturation temperatures (Td). (B) Clonal sequencing of amplicons from A3B-WT expressing SUDHL6 cells. We sequenced 11 clones (5104 base pairs in total). Seventy six bases from thymine 310 to adenine 385 in which mutations are concentrated among sequenced 464 base pairs are shown. The numbers of C/G to T/A substitutions in sequenced 464 base pair length are shown at the right end. (C) Dinucleotide contexts of somatic mutations in c-Myc gene by A3B. The rates of indicated dinucleotide sequence at the C to T transitions are shown. Asterisks indicate statistical significance in a χ 2 test (p
Figure Legend Snippet: A3B induced somatic mutations into c-myc gene in human lymphoma cells. (A) Agarose gel analyses of 3D-PCR products of c-Myc genes in SUDHL6. We transfected expression vector for A3B wild-type or H66/253R or empty vector and recovered total DNA 7 days after transfection. C-myc genes were amplified by 3D-PCR at the indicated denaturation temperatures (Td). (B) Clonal sequencing of amplicons from A3B-WT expressing SUDHL6 cells. We sequenced 11 clones (5104 base pairs in total). Seventy six bases from thymine 310 to adenine 385 in which mutations are concentrated among sequenced 464 base pairs are shown. The numbers of C/G to T/A substitutions in sequenced 464 base pair length are shown at the right end. (C) Dinucleotide contexts of somatic mutations in c-Myc gene by A3B. The rates of indicated dinucleotide sequence at the C to T transitions are shown. Asterisks indicate statistical significance in a χ 2 test (p

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Transfection, Expressing, Plasmid Preparation, Amplification, Sequencing, Clone Assay

Related Articles

Next-Generation Sequencing:

Article Title: A Modified RNA-Seq Approach for Whole Genome Sequencing of RNA Viruses from Faecal and Blood Samples
Article Snippet: .. These amplicons can then be sequenced using Sanger sequencing or next-generation sequencing platforms such as Roche 454 and Illumina . ..

Article Title: Molecular diagnostics for congenital hearing loss including 15 deafness genes using a next generation sequencing platform
Article Snippet: .. Using patient specific identifiers, all amplicons were pooled and analyzed using the Roche 454 NGS technology. ..

Size-exclusion Chromatography:

Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance
Article Snippet: .. Estimation of Heteroplasmic Mutations in mtDNA using Surveyor Nuclease ~2 kbase amplicons of the mtDNA coding region used primers A-H as described in Bannwarth, et al. [ ] qPCR conditions for these amplicons used SybrGreen detection and 25 nM [primers]; cycle conditions were 95°C for 3 min, then 50 cycles of 95°C for 30 sec, 57°C for 30 sec, 72°C for 4 min. Circular mtDNA standards for qPCR analysis of amplicons from these primers were made from Roche human genomic DNA treated with Plasmid-Safe exonuclease followed by purification on Mobio columns. .. Roche genomic DNA served as the standard for qPCR assays of 18S rRNA gene.

Purification:

Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance
Article Snippet: .. Estimation of Heteroplasmic Mutations in mtDNA using Surveyor Nuclease ~2 kbase amplicons of the mtDNA coding region used primers A-H as described in Bannwarth, et al. [ ] qPCR conditions for these amplicons used SybrGreen detection and 25 nM [primers]; cycle conditions were 95°C for 3 min, then 50 cycles of 95°C for 30 sec, 57°C for 30 sec, 72°C for 4 min. Circular mtDNA standards for qPCR analysis of amplicons from these primers were made from Roche human genomic DNA treated with Plasmid-Safe exonuclease followed by purification on Mobio columns. .. Roche genomic DNA served as the standard for qPCR assays of 18S rRNA gene.

Article Title: Host Alternation of Chikungunya Virus Increases Fitness while Restricting Population Diversity and Adaptability to Novel Selective Pressures ▿Host Alternation of Chikungunya Virus Increases Fitness while Restricting Population Diversity and Adaptability to Novel Selective Pressures ▿ †Host Alternation of Chikungunya Virus Increases Fitness while Restricting Population Diversity and Adaptabili
Article Snippet: .. Two hundred nanograms of purified amplicons was digested with SacII (Roche) for 2 h at 37°C. .. The amount of marked clone (uncut) or passaged (cut) DNA in ethidium bromide-stained bands in 1% agarose gels was quantified for each sample by densitometry (AlphaInnotech).

Real-time Polymerase Chain Reaction:

Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance
Article Snippet: .. Estimation of Heteroplasmic Mutations in mtDNA using Surveyor Nuclease ~2 kbase amplicons of the mtDNA coding region used primers A-H as described in Bannwarth, et al. [ ] qPCR conditions for these amplicons used SybrGreen detection and 25 nM [primers]; cycle conditions were 95°C for 3 min, then 50 cycles of 95°C for 30 sec, 57°C for 30 sec, 72°C for 4 min. Circular mtDNA standards for qPCR analysis of amplicons from these primers were made from Roche human genomic DNA treated with Plasmid-Safe exonuclease followed by purification on Mobio columns. .. Roche genomic DNA served as the standard for qPCR assays of 18S rRNA gene.

Sequencing:

Article Title: A Modified RNA-Seq Approach for Whole Genome Sequencing of RNA Viruses from Faecal and Blood Samples
Article Snippet: .. These amplicons can then be sequenced using Sanger sequencing or next-generation sequencing platforms such as Roche 454 and Illumina . ..

Polymerase Chain Reaction:

Article Title: Haplotyping and copy number estimation of the highly polymorphic human beta-defensin locus on 8p23 by 454 amplicon sequencing
Article Snippet: .. The pools were diluted and subjected to emulsion PCR following the FLX emPCR protocol for amplicons (Roche Diagnostics, December 2007) using both emPCR kits II (primer A) and III (primer B) and sequenced on a GS FLX (Roche Diagnostics) by both primers on 1 lane/pool of a 16-lane gasket on a 70 × 75 FLX picotiterplate. .. The sequences from 1 lane were aligned to a backbone consisting of the merged PCR target regions derived from the human reference sequence (NCBI build 36.1, hg18, proximal gene cluster) and haplotype calls (HCs) were inferred using the GS Amplicon Variant Analyzer Software (Roche Diagnostics).

Article Title: HiDRA-seq: High-Throughput SARS-CoV-2 Detection by RNA Barcoding and Amplicon Sequencing
Article Snippet: .. Each PCR reaction was assembled by combining, in individual tubes, 5 ul of the three amplicons with 20 μl of PCR master mix containing 1.25X KAPA HiFi HotStart ReadyMix (Roche), 0.375 uM of the i5 primer (Microsynth AG) and 0.375 uM of the barcoded i7 primer (Illumina). ..

Article Title: The endothelial-specific regulatory mutation, Mvwf1, is a common mouse founder allele
Article Snippet: .. Genotyping Screening of a panel of DNA from multiple inbred mouse strains (Supplementary Table 1) was performed using RIIIS/J polymorphisms 5 kb and 10 kb upstream of B4galnt2 exon 1 by genomic PCR (primer sets 1 and 2 in Supplementary Table 2) using PfuTurboHotstart (Stratagene) for amplicons smaller than 3 kb or Expand Long Template PCR System (Roche) for amplicons larger than 3 kb per the manufacturer’s instructions. .. For a haplotype analysis, genomic sequencing was performed as described above (primer sets 1, 2, and 29–53 in Supplementary Table 2).

Article Title: Sequence Polymorphism and Expression Variability of Crassostrea gigas Immune Related Genes Discriminate Two Oyster Lines Contrasted in Term of Resistance to Summer Mortalities
Article Snippet: .. Then, 1X Syber Green was added to the PCR product and melting temperatures of amplicons were obtained by applying melting curve program on the Light-Cycler 480 System (Roche). .. Amplicons from classical PCR showing differences of melting temperature as observed from qPCR were cloned using TOPO TA cloning kit with the pCR 2.1 TOPO vector (Invitrogen), according to manufacturer’s protocol.

Plasmid Preparation:

Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance
Article Snippet: .. Estimation of Heteroplasmic Mutations in mtDNA using Surveyor Nuclease ~2 kbase amplicons of the mtDNA coding region used primers A-H as described in Bannwarth, et al. [ ] qPCR conditions for these amplicons used SybrGreen detection and 25 nM [primers]; cycle conditions were 95°C for 3 min, then 50 cycles of 95°C for 30 sec, 57°C for 30 sec, 72°C for 4 min. Circular mtDNA standards for qPCR analysis of amplicons from these primers were made from Roche human genomic DNA treated with Plasmid-Safe exonuclease followed by purification on Mobio columns. .. Roche genomic DNA served as the standard for qPCR assays of 18S rRNA gene.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Roche cobas amplicor monitor version 1 5
    a. <t>COBAS</t> <t>Amplicor</t> HCV <t>Monitor</t> V2.0 and Versant HCV bDNA 3.0 correlation. Assay correlation was determined by processing 100 clinical samples by the COBAS Amplicor HCV Monitor V2.0 andVersant HCV bDNA 3.0 assays. Deming regression was Versant = 1.065 × (Amplicor) − 0.446 ( R 2 = 0.939; n = 80; SEE = 0.239). The dashed line represents unity. b. COBAS HCV TM-ASR and Versant HCV bDNA 3.0 (Versant) correlation. Assay correlation was determined by processing 100 clinical samples by the TM-ASR and Versant assays. Deming regression equation: TM-ASR = 1.188 × (Versant) − 0.663 ( R 2 = 0.829; n = 80; SEE = 0.473). The dashed line represents unity. c. COBAS HCV TM-ASR and COBAS Amplicor HCV Monitor V2.0 (Amplicor) correlation. Assay correlation was determined by processing 100 clinical samples by the TM-ASR and Amplicor assays. Deming regression: TM-ASR = 1.207 × (Amplicor) − 0.919 ( R 2 = 0.818; n = 86; SEE = 0.544). The dashed line represents unity.
    Cobas Amplicor Monitor Version 1 5, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cobas amplicor monitor version 1 5/product/Roche
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cobas amplicor monitor version 1 5 - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    85
    Roche full processing amplicon
    Relation between <t>amplicon</t> size and number of sequence reads. Mean number of reads (standard error of the mean) are plotted for the 28 different genes from the bacterial species L. pneumophila, S. aureus, P. aeruginosa, and S. pneumoniae . This relationship between size and number of reads is statistical significant (p-value
    Full Processing Amplicon, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/full processing amplicon/product/Roche
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    full processing amplicon - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    85
    Roche 454 amplicon dna library specific primers
    MEGAN comparison of the taxonomic profiles of (A) cDNA transcript-tags from <t>454</t> sequencing five individual lymph node samples and two lymph node sample pools and (B) genomic <t>DNA-tags</t> from four individual lymph node samples. Depicted are assignments with bit score cutoffs ≥50. Circle sizes are scaled logarithmically. Not assigned: sequencing-tags matching to sequences in the NCBI database that are not assigned to taxa; no hits: sequencing-tags not matching to any sequences in the NCBI database.
    454 Amplicon Dna Library Specific Primers, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/454 amplicon dna library specific primers/product/Roche
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    454 amplicon dna library specific primers - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    85
    Roche amplicor hbv monitor kit
    Log-log 10 graph showing the linear regression comparing VL data obtained from 47 matched samples of DBS vs. Plasma . Log 10 measurements of the <t>HBV</t> DNA in DBS and Plasma samples, assessed by Cobas Monitor <t>Amplicor.</t> The values for the DBS are plotted against the values for the matched plasma samples. The linear correlation between the two samples is shown (R 2 = 0.86). The Pearson correlation coefficient was 0.93.
    Amplicor Hbv Monitor Kit, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplicor hbv monitor kit/product/Roche
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    amplicor hbv monitor kit - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    Image Search Results


    a. COBAS Amplicor HCV Monitor V2.0 and Versant HCV bDNA 3.0 correlation. Assay correlation was determined by processing 100 clinical samples by the COBAS Amplicor HCV Monitor V2.0 andVersant HCV bDNA 3.0 assays. Deming regression was Versant = 1.065 × (Amplicor) − 0.446 ( R 2 = 0.939; n = 80; SEE = 0.239). The dashed line represents unity. b. COBAS HCV TM-ASR and Versant HCV bDNA 3.0 (Versant) correlation. Assay correlation was determined by processing 100 clinical samples by the TM-ASR and Versant assays. Deming regression equation: TM-ASR = 1.188 × (Versant) − 0.663 ( R 2 = 0.829; n = 80; SEE = 0.473). The dashed line represents unity. c. COBAS HCV TM-ASR and COBAS Amplicor HCV Monitor V2.0 (Amplicor) correlation. Assay correlation was determined by processing 100 clinical samples by the TM-ASR and Amplicor assays. Deming regression: TM-ASR = 1.207 × (Amplicor) − 0.919 ( R 2 = 0.818; n = 86; SEE = 0.544). The dashed line represents unity.

    Journal: Journal of Clinical Microbiology

    Article Title: Evaluation of the COBAS Hepatitis C Virus (HCV) TaqMan Analyte-Specific Reagent Assay and Comparison to the COBAS Amplicor HCV Monitor V2.0 and Versant HCV bDNA 3.0 Assays

    doi: 10.1128/JCM.43.5.2133-2140.2005

    Figure Lengend Snippet: a. COBAS Amplicor HCV Monitor V2.0 and Versant HCV bDNA 3.0 correlation. Assay correlation was determined by processing 100 clinical samples by the COBAS Amplicor HCV Monitor V2.0 andVersant HCV bDNA 3.0 assays. Deming regression was Versant = 1.065 × (Amplicor) − 0.446 ( R 2 = 0.939; n = 80; SEE = 0.239). The dashed line represents unity. b. COBAS HCV TM-ASR and Versant HCV bDNA 3.0 (Versant) correlation. Assay correlation was determined by processing 100 clinical samples by the TM-ASR and Versant assays. Deming regression equation: TM-ASR = 1.188 × (Versant) − 0.663 ( R 2 = 0.829; n = 80; SEE = 0.473). The dashed line represents unity. c. COBAS HCV TM-ASR and COBAS Amplicor HCV Monitor V2.0 (Amplicor) correlation. Assay correlation was determined by processing 100 clinical samples by the TM-ASR and Amplicor assays. Deming regression: TM-ASR = 1.207 × (Amplicor) − 0.919 ( R 2 = 0.818; n = 86; SEE = 0.544). The dashed line represents unity.

    Article Snippet: Multicenter comparison of Roche COBAS AMPLICOR MONITOR version 1.5, Organon Teknika NucliSens QT with Extractor, and Bayer Quantiplex version 3.0 for quantification of human immunodeficiency virus type 1 RNA in plasma.

    Techniques: Two-Photon Excitation Fluorescence Cross-Correlation Assay

    a. COBAS HCV TM-ASR positive sample distribution. Data from 22,399 samples tested with the TM-ASR assay using calibration coefficients generated using Armored RNA and valid to a concentration of 143,000,000 HCV RNA IU/ml were plotted. Results presented include only samples with quantitative results greater than 100 IU/ml, stratified into 0.1-log IU/ml increments; results from 9,632 (43.0%) samples with results less than 100 IU/ml are not included. The arrows represent the predicted analytical measurement ranges of the COBAS Amplicor HCV Monitor V2.0 (arrow a) and Versant HCV bDNA 3.0 (arrow b) assays. The solid bar represents samples with results greater than log 8.0 HCV RNA IU/ml. b. Versant HCV bDNA 3.0 (Versant) positive sample distribution. Data from 4,037 samples tested with the Versant assay as per the manufacturer's instructions are presented. Results presented include only samples with quantitative results or results greater than 8,000,000 HCV RNA IU/ml, stratified into 0.1-log IU/ml increments, with results from 1,518 (37.6%) samples with results less than 615 IU/ml not included. The arrow represents the predicted analytical measurement range of the COBAS Amplicor HCV Monitor V2.0 assay. The solid bar represents samples with results greater than log 6.9 HCV RNA IU/ml.

    Journal: Journal of Clinical Microbiology

    Article Title: Evaluation of the COBAS Hepatitis C Virus (HCV) TaqMan Analyte-Specific Reagent Assay and Comparison to the COBAS Amplicor HCV Monitor V2.0 and Versant HCV bDNA 3.0 Assays

    doi: 10.1128/JCM.43.5.2133-2140.2005

    Figure Lengend Snippet: a. COBAS HCV TM-ASR positive sample distribution. Data from 22,399 samples tested with the TM-ASR assay using calibration coefficients generated using Armored RNA and valid to a concentration of 143,000,000 HCV RNA IU/ml were plotted. Results presented include only samples with quantitative results greater than 100 IU/ml, stratified into 0.1-log IU/ml increments; results from 9,632 (43.0%) samples with results less than 100 IU/ml are not included. The arrows represent the predicted analytical measurement ranges of the COBAS Amplicor HCV Monitor V2.0 (arrow a) and Versant HCV bDNA 3.0 (arrow b) assays. The solid bar represents samples with results greater than log 8.0 HCV RNA IU/ml. b. Versant HCV bDNA 3.0 (Versant) positive sample distribution. Data from 4,037 samples tested with the Versant assay as per the manufacturer's instructions are presented. Results presented include only samples with quantitative results or results greater than 8,000,000 HCV RNA IU/ml, stratified into 0.1-log IU/ml increments, with results from 1,518 (37.6%) samples with results less than 615 IU/ml not included. The arrow represents the predicted analytical measurement range of the COBAS Amplicor HCV Monitor V2.0 assay. The solid bar represents samples with results greater than log 6.9 HCV RNA IU/ml.

    Article Snippet: Multicenter comparison of Roche COBAS AMPLICOR MONITOR version 1.5, Organon Teknika NucliSens QT with Extractor, and Bayer Quantiplex version 3.0 for quantification of human immunodeficiency virus type 1 RNA in plasma.

    Techniques: Generated, Concentration Assay

    Relation between amplicon size and number of sequence reads. Mean number of reads (standard error of the mean) are plotted for the 28 different genes from the bacterial species L. pneumophila, S. aureus, P. aeruginosa, and S. pneumoniae . This relationship between size and number of reads is statistical significant (p-value

    Journal: PLoS ONE

    Article Title: High-Throughput Multilocus Sequence Typing: Bringing Molecular Typing to the Next Level

    doi: 10.1371/journal.pone.0039630

    Figure Lengend Snippet: Relation between amplicon size and number of sequence reads. Mean number of reads (standard error of the mean) are plotted for the 28 different genes from the bacterial species L. pneumophila, S. aureus, P. aeruginosa, and S. pneumoniae . This relationship between size and number of reads is statistical significant (p-value

    Article Snippet: Data Analysis NGS-data were automatically processed using the ‘Full Processing Amplicon’ pipeline available through the Run Wizard on the GS Junior Attendant PC (Roche).

    Techniques: Amplification, Sequencing, Significance Assay

    MEGAN comparison of the taxonomic profiles of (A) cDNA transcript-tags from 454 sequencing five individual lymph node samples and two lymph node sample pools and (B) genomic DNA-tags from four individual lymph node samples. Depicted are assignments with bit score cutoffs ≥50. Circle sizes are scaled logarithmically. Not assigned: sequencing-tags matching to sequences in the NCBI database that are not assigned to taxa; no hits: sequencing-tags not matching to any sequences in the NCBI database.

    Journal: PLoS ONE

    Article Title: Nodeomics: Pathogen Detection in Vertebrate Lymph Nodes Using Meta-Transcriptomics

    doi: 10.1371/journal.pone.0013432

    Figure Lengend Snippet: MEGAN comparison of the taxonomic profiles of (A) cDNA transcript-tags from 454 sequencing five individual lymph node samples and two lymph node sample pools and (B) genomic DNA-tags from four individual lymph node samples. Depicted are assignments with bit score cutoffs ≥50. Circle sizes are scaled logarithmically. Not assigned: sequencing-tags matching to sequences in the NCBI database that are not assigned to taxa; no hits: sequencing-tags not matching to any sequences in the NCBI database.

    Article Snippet: Multiplex Amplicon Sequencing (Roche-454) Fusion-primers were designed including the sequences of the 454-Amplicon DNA library specific primers A and B, respectively, (GS FLX Amplicon DNA Library Preparation Method Manual, www.roche-applied-science.com ), 4-base barcode sequences for identifying amplicon products derived from mule deer specimen MD 257, MD OCT-pool, and MD 80228 (TGCA, ACGT, and CGAT, respectively), and the “universal” V6-specific PCR primer sequences V6F: 5′ TCGATGCAACGCGAAGAA 3′ and V6R: 5′ ACATTTCACAACACGAGCTGACGA 3′ (designed to conserved regions flanking V6 based on comparison of 110 bacterial DNA sequences ).

    Techniques: Sequencing

    Log-log 10 graph showing the linear regression comparing VL data obtained from 47 matched samples of DBS vs. Plasma . Log 10 measurements of the HBV DNA in DBS and Plasma samples, assessed by Cobas Monitor Amplicor. The values for the DBS are plotted against the values for the matched plasma samples. The linear correlation between the two samples is shown (R 2 = 0.86). The Pearson correlation coefficient was 0.93.

    Journal: Virology Journal

    Article Title: Use of dried blood samples for monitoring hepatitis B virus infection

    doi: 10.1186/1743-422X-6-153

    Figure Lengend Snippet: Log-log 10 graph showing the linear regression comparing VL data obtained from 47 matched samples of DBS vs. Plasma . Log 10 measurements of the HBV DNA in DBS and Plasma samples, assessed by Cobas Monitor Amplicor. The values for the DBS are plotted against the values for the matched plasma samples. The linear correlation between the two samples is shown (R 2 = 0.86). The Pearson correlation coefficient was 0.93.

    Article Snippet: c) Plasma viral load (VL) quantification The levels of HBV DNA in 100 μl of plasma were quantified by using the Amplicor HBV Monitor kit (Roche Molecular Systems, Inc.) according to the manufacturer's instructions.

    Techniques: