amplicons  (Roche)


Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Roche amplicons
    (A) Matched pairs of normalized Ct values and alignment rate. Ct values (y-axis-left) for sets of RT-qPCR technical replicates were normalized and correlated to the alignment rate (y-axis-right) for the different <t>amplicons</t> using the Wilcoxon-Signed-Rank test for matched pairs (p
    Amplicons, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 895 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplicons/product/Roche
    Average 94 stars, based on 895 article reviews
    Price from $9.99 to $1999.99
    amplicons - by Bioz Stars, 2020-10
    94/100 stars

    Images

    1) Product Images from "HiDRA-seq: High-Throughput SARS-CoV-2 Detection by RNA Barcoding and Amplicon Sequencing"

    Article Title: HiDRA-seq: High-Throughput SARS-CoV-2 Detection by RNA Barcoding and Amplicon Sequencing

    Journal: bioRxiv

    doi: 10.1101/2020.06.02.130484

    (A) Matched pairs of normalized Ct values and alignment rate. Ct values (y-axis-left) for sets of RT-qPCR technical replicates were normalized and correlated to the alignment rate (y-axis-right) for the different amplicons using the Wilcoxon-Signed-Rank test for matched pairs (p
    Figure Legend Snippet: (A) Matched pairs of normalized Ct values and alignment rate. Ct values (y-axis-left) for sets of RT-qPCR technical replicates were normalized and correlated to the alignment rate (y-axis-right) for the different amplicons using the Wilcoxon-Signed-Rank test for matched pairs (p

    Techniques Used: Quantitative RT-PCR

    (A) Schematic representation of the protocol. Using a low volume liquid handling robot, the patients’ RNA is distributed in 384-well plates containing indexed oligo-dT primers. Barcoded cDNA is generated by reverse transcription and pooled into a single tube. Libraries are produced from SARS-CoV-2-specific amplicons and sequenced. Reads are de-multiplexed based on both a plate and a sample barcode and used for downstream diagnostic analysis. (B) Amplicon primer design. The table contains the sequences of the forward primers used to generate the different amplicons. The reverse primer is common to all amplicons and it anneals to the 3’-end of the barcoded oligo-dT primers used to generate cDNA in the reverse transcription. The primer labels contain the position of the first sequenced base. Insert length was calculated using the start of the poly-A sequence. SARS-CoV-2 NC_045512_2 sequence and GAPDH NM_002046.4 sequence were used as reference. For the theoretical size of the amplicon after PCR 1 the Nextera Tag (34bp), the length of the barcoded Oligo-dT-primer (80bp) and the primer sequence was added.
    Figure Legend Snippet: (A) Schematic representation of the protocol. Using a low volume liquid handling robot, the patients’ RNA is distributed in 384-well plates containing indexed oligo-dT primers. Barcoded cDNA is generated by reverse transcription and pooled into a single tube. Libraries are produced from SARS-CoV-2-specific amplicons and sequenced. Reads are de-multiplexed based on both a plate and a sample barcode and used for downstream diagnostic analysis. (B) Amplicon primer design. The table contains the sequences of the forward primers used to generate the different amplicons. The reverse primer is common to all amplicons and it anneals to the 3’-end of the barcoded oligo-dT primers used to generate cDNA in the reverse transcription. The primer labels contain the position of the first sequenced base. Insert length was calculated using the start of the poly-A sequence. SARS-CoV-2 NC_045512_2 sequence and GAPDH NM_002046.4 sequence were used as reference. For the theoretical size of the amplicon after PCR 1 the Nextera Tag (34bp), the length of the barcoded Oligo-dT-primer (80bp) and the primer sequence was added.

    Techniques Used: Generated, Produced, Diagnostic Assay, Amplification, Sequencing, Polymerase Chain Reaction

    (A) Read distribution in the different wells of the plate. The histogram shows the read numbers obtained in the different wells of the plate for the different amplicons. As the input for the protocols was not normalized, a wide distribution in the number of reads is observed. Wells with
    Figure Legend Snippet: (A) Read distribution in the different wells of the plate. The histogram shows the read numbers obtained in the different wells of the plate for the different amplicons. As the input for the protocols was not normalized, a wide distribution in the number of reads is observed. Wells with

    Techniques Used:

    2) Product Images from "Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance"

    Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance

    Journal: Molecular Neurodegeneration

    doi: 10.1186/1750-1326-4-37

    Distributions of heteroplasmic mutations in sPD and CTL brain mtDNA . mtDNA's from six sPD and six CTL brains were amplified using primer pairs A-H. The amplicons were subject to Surveyor Nuclease treatment and separation/analysis of products using Experion 12K DNA chips. Bands from 1000-1900 bp size are included in the Figure. The Y-axes are DNA levels and X-axes are product sizes in bp.
    Figure Legend Snippet: Distributions of heteroplasmic mutations in sPD and CTL brain mtDNA . mtDNA's from six sPD and six CTL brains were amplified using primer pairs A-H. The amplicons were subject to Surveyor Nuclease treatment and separation/analysis of products using Experion 12K DNA chips. Bands from 1000-1900 bp size are included in the Figure. The Y-axes are DNA levels and X-axes are product sizes in bp.

    Techniques Used: CTL Assay, Amplification

    3) Product Images from "The endothelial-specific regulatory mutation, Mvwf1, is a common mouse founder allele"

    Article Title: The endothelial-specific regulatory mutation, Mvwf1, is a common mouse founder allele

    Journal: Mammalian Genome

    doi: 10.1007/s00335-007-9079-4

    Mvwf1 haplotype block. A highly conserved Mvwf1 haplotype block (yellow) is shared by the Mvwf1 inbred strains and distinct from other wild-derived inbred strains representative of the M. m. musculus clade, M. spretus , and M. spicilegus . Strain ID numbers are indicated on the left (see Supplementary Table 1 ). Colors were assigned to similar sequences based upon PAUP phylogeny trees; missing data are white. The B4galnt2 exon 1 boundary is highlighted by the thick white vertical line. The Mvwf1 haplotype block is outlined in black. Shorter segments in seven additional strains (28, 64, 37, 38, 40, 31, 20) have two or more contiguous amplicons with sequence identity to the Mvwf1 strains (outlined in the red boxes)
    Figure Legend Snippet: Mvwf1 haplotype block. A highly conserved Mvwf1 haplotype block (yellow) is shared by the Mvwf1 inbred strains and distinct from other wild-derived inbred strains representative of the M. m. musculus clade, M. spretus , and M. spicilegus . Strain ID numbers are indicated on the left (see Supplementary Table 1 ). Colors were assigned to similar sequences based upon PAUP phylogeny trees; missing data are white. The B4galnt2 exon 1 boundary is highlighted by the thick white vertical line. The Mvwf1 haplotype block is outlined in black. Shorter segments in seven additional strains (28, 64, 37, 38, 40, 31, 20) have two or more contiguous amplicons with sequence identity to the Mvwf1 strains (outlined in the red boxes)

    Techniques Used: Blocking Assay, Derivative Assay, Sequencing

    4) Product Images from "Microbial drama in four acts - Extreme rain events cause cyclic succession in plankton communities"

    Article Title: Microbial drama in four acts - Extreme rain events cause cyclic succession in plankton communities

    Journal: bioRxiv

    doi: 10.1101/2020.07.23.217935

    Different dynamic types of read proportions among pond ASVs with highest read abundances. Circles connected with lines represent percentages of 16S rDNA amplicon reads, triangles represent percentages of 16S rRNA amplicons reads. Samples from the pond are depicted in blue, samples from the stream in orange. Background colors indicate different phases of the succession: violet – ‘K’ conservation phase, orange – ‘Ω’ collapse and release phase, light green – ‘α’ reorganization phase, and aquamarine – ‘r’ exploitation phase. Displayed taxonomy is based on naive Bayesian classifier method and trained Silva SSU database release 132 incorporated in the DADA2 pipeline; additionally, if available, 100% identity matches obtained with BLAST are shown in brackets, and CARD-FISH probes matching the ASVs (RBT-065 and opitu-346) are indicated in italics. a: type K , ASVs detectable only during conservation phase, K- strategists. b: type K(r) , ASVs displaying highest read proportions in conservation phases and already detectable in exploitation phases (fast recovering K- strategists). c: type Ω , ASVs displaying highest read proportions during the EREs (emigrants) that do not belong to the most common pond ASVs. d: type α , ASVs displaying highest reads proportions during reorganization phase (inlet associated r- strategists). e: type r , ASVs displaying highest reads proportions during exploitation phase (pond associated r- strategists). f: type all-rounders , ASVs displaying comparable read proportions during all phases except EREs.
    Figure Legend Snippet: Different dynamic types of read proportions among pond ASVs with highest read abundances. Circles connected with lines represent percentages of 16S rDNA amplicon reads, triangles represent percentages of 16S rRNA amplicons reads. Samples from the pond are depicted in blue, samples from the stream in orange. Background colors indicate different phases of the succession: violet – ‘K’ conservation phase, orange – ‘Ω’ collapse and release phase, light green – ‘α’ reorganization phase, and aquamarine – ‘r’ exploitation phase. Displayed taxonomy is based on naive Bayesian classifier method and trained Silva SSU database release 132 incorporated in the DADA2 pipeline; additionally, if available, 100% identity matches obtained with BLAST are shown in brackets, and CARD-FISH probes matching the ASVs (RBT-065 and opitu-346) are indicated in italics. a: type K , ASVs detectable only during conservation phase, K- strategists. b: type K(r) , ASVs displaying highest read proportions in conservation phases and already detectable in exploitation phases (fast recovering K- strategists). c: type Ω , ASVs displaying highest read proportions during the EREs (emigrants) that do not belong to the most common pond ASVs. d: type α , ASVs displaying highest reads proportions during reorganization phase (inlet associated r- strategists). e: type r , ASVs displaying highest reads proportions during exploitation phase (pond associated r- strategists). f: type all-rounders , ASVs displaying comparable read proportions during all phases except EREs.

    Techniques Used: Amplification, Fluorescence In Situ Hybridization

    Bacterial succession in the pond following the adaptive cycle. a : Representation of the adaptive cycle 22 ; α and Ω phases comprising the back-loop, r and K phases represent the fore-loop of the cycle. X indicates the path to an alternative development b : Multidimensional scaling (MDS) based on 16S rRNA gene amplicons from pond bacterial communities (Kruskal's stress: 0.17; Anosim test for 4 phases: R=0.95, P=0.0001). A line connects samples following chronological order. The diameters of the circles are proportional to the Pielou’s evenness of the samples (varying between 0.3 and 0.4). Pie charts depict the bacterial diversity at the class-phylum level. Letters and associated colors visualize the phases of observed succession. *: Gammaproteobacteria are represented without Betaproteobacteriales, which are shown separately. ‘ K ’ and violet color indicate conservation-phase, ‘ Ω ’ and orange – collapse and release phase, ‘ α ’ and light-green – reorganization-phase, ‘ r ’ and aquamarine – exploitation-phase. c-g : Radial plots depicting percentages of bacterial groups obtained by CARD-FISH (in % of hybridized bacteria). Radial axes represent percentages. Angular axes represent time. Colors of segments and symbols correspond to succession-phases: The time series start with circles: from violet (first K-phase) to aquamarine (first r-phase). Subsequent samples in triangles represent the second Ω-phase (orange), second α-phase (light-green), second r-phase (aquamarine), and final K-phase (violet).This graph design enables easy comparisons between samples taken in the same phase. c : Relative abundances of general bacterial groups. d : Relative abundances of selected Actinobacteria groups. e : Relative abundances of Verrucomicrobia groups. f : Relative abundances of selected Betaproteobacteriales groups.
    Figure Legend Snippet: Bacterial succession in the pond following the adaptive cycle. a : Representation of the adaptive cycle 22 ; α and Ω phases comprising the back-loop, r and K phases represent the fore-loop of the cycle. X indicates the path to an alternative development b : Multidimensional scaling (MDS) based on 16S rRNA gene amplicons from pond bacterial communities (Kruskal's stress: 0.17; Anosim test for 4 phases: R=0.95, P=0.0001). A line connects samples following chronological order. The diameters of the circles are proportional to the Pielou’s evenness of the samples (varying between 0.3 and 0.4). Pie charts depict the bacterial diversity at the class-phylum level. Letters and associated colors visualize the phases of observed succession. *: Gammaproteobacteria are represented without Betaproteobacteriales, which are shown separately. ‘ K ’ and violet color indicate conservation-phase, ‘ Ω ’ and orange – collapse and release phase, ‘ α ’ and light-green – reorganization-phase, ‘ r ’ and aquamarine – exploitation-phase. c-g : Radial plots depicting percentages of bacterial groups obtained by CARD-FISH (in % of hybridized bacteria). Radial axes represent percentages. Angular axes represent time. Colors of segments and symbols correspond to succession-phases: The time series start with circles: from violet (first K-phase) to aquamarine (first r-phase). Subsequent samples in triangles represent the second Ω-phase (orange), second α-phase (light-green), second r-phase (aquamarine), and final K-phase (violet).This graph design enables easy comparisons between samples taken in the same phase. c : Relative abundances of general bacterial groups. d : Relative abundances of selected Actinobacteria groups. e : Relative abundances of Verrucomicrobia groups. f : Relative abundances of selected Betaproteobacteriales groups.

    Techniques Used: Fluorescence In Situ Hybridization

    5) Product Images from "Ultra-high resolution HLA genotyping and allele discovery by highly multiplexed cDNA amplicon pyrosequencing"

    Article Title: Ultra-high resolution HLA genotyping and allele discovery by highly multiplexed cDNA amplicon pyrosequencing

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-13-378

    Positioning and sequence of HLA class I universal amplification primers. An alignment of > 4,000 known HLA class I alleles produced a variability profile. ( a ) The depth of coverage (i.e. the number of alleles at each position in the alignment) is shown in grey, along with the percentage of nucleotide sequence variability (red) and the positioning of the two genotyping amplicons. ( b ) The sequence and composition of universal amplification primers for amplicon 1 and 2. Note that for amplicon 1 the “A” and “B” adapters were swapped to avoid a primer amplification problem.
    Figure Legend Snippet: Positioning and sequence of HLA class I universal amplification primers. An alignment of > 4,000 known HLA class I alleles produced a variability profile. ( a ) The depth of coverage (i.e. the number of alleles at each position in the alignment) is shown in grey, along with the percentage of nucleotide sequence variability (red) and the positioning of the two genotyping amplicons. ( b ) The sequence and composition of universal amplification primers for amplicon 1 and 2. Note that for amplicon 1 the “A” and “B” adapters were swapped to avoid a primer amplification problem.

    Techniques Used: Sequencing, Amplification, Produced

    The HLA class I allele calls from the first genotyping experiment, designed to test the use of the two-tiled class I amplicons, are shown. Calls in blue were completely unambiguous to the allele level. Calls in green were four-digit ambiguous based on distinguishing SNPs outside the amplified region. The call in orange was only recovered using the modified, lower-stringency analysis pipeline, while the call in pink was expected but not observed for both amplicons. Calls in purple were examples of reference typing undergoing correction, or the detection of a putative novel allele.
    Figure Legend Snippet: The HLA class I allele calls from the first genotyping experiment, designed to test the use of the two-tiled class I amplicons, are shown. Calls in blue were completely unambiguous to the allele level. Calls in green were four-digit ambiguous based on distinguishing SNPs outside the amplified region. The call in orange was only recovered using the modified, lower-stringency analysis pipeline, while the call in pink was expected but not observed for both amplicons. Calls in purple were examples of reference typing undergoing correction, or the detection of a putative novel allele.

    Techniques Used: Amplification, Modification

    6) Product Images from "Multiplex PCR Method for Detection of Three Aeromonas Enterotoxin Genes ▿"

    Article Title: Multiplex PCR Method for Detection of Three Aeromonas Enterotoxin Genes ▿

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.01357-09

    Molecular characterization and confirmation of the predicted and unpredicted amplicons.
    Figure Legend Snippet: Molecular characterization and confirmation of the predicted and unpredicted amplicons.

    Techniques Used:

    7) Product Images from "Validation of an Oligonucleotide Ligation Assay for Quantification of Human Immunodeficiency Virus Type 1 Drug-Resistant Mutants by Use of Massively Parallel Sequencing"

    Article Title: Validation of an Oligonucleotide Ligation Assay for Quantification of Human Immunodeficiency Virus Type 1 Drug-Resistant Mutants by Use of Massively Parallel Sequencing

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.00306-14

    Correlation of mutant concentrations at specific HIV pol sites encoding NNRTI and lamivudine resistance, quantified by OLA and 454 pyrosequencing. (A) Concentrations of NNRTI resistance mutations K103N, V106M, Y181C, and G190A detected in amplicons from
    Figure Legend Snippet: Correlation of mutant concentrations at specific HIV pol sites encoding NNRTI and lamivudine resistance, quantified by OLA and 454 pyrosequencing. (A) Concentrations of NNRTI resistance mutations K103N, V106M, Y181C, and G190A detected in amplicons from

    Techniques Used: Mutagenesis

    8) Product Images from "Affordable, Abbreviated Roche Monitor Assay for Quantification of Human Immunodeficiency Virus Type 1 RNA in Plasma"

    Article Title: Affordable, Abbreviated Roche Monitor Assay for Quantification of Human Immunodeficiency Virus Type 1 RNA in Plasma

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.43.8.4200-4202.2005

    Correlation between the four-well and eight-well assays in the prospective study. Plasma from 94 subtype C specimens tested in the manual assay (circles) and 105 subtype B specimens tested in the COBAS assay (triangles) were assayed following the package insert instructions and using all eight wells. Then the previously generated amplicons were redetected using only the 1:1, 1:25, and 1:625 HIV dilutions and the 1:1 QS dilution. r = 0.97.
    Figure Legend Snippet: Correlation between the four-well and eight-well assays in the prospective study. Plasma from 94 subtype C specimens tested in the manual assay (circles) and 105 subtype B specimens tested in the COBAS assay (triangles) were assayed following the package insert instructions and using all eight wells. Then the previously generated amplicons were redetected using only the 1:1, 1:25, and 1:625 HIV dilutions and the 1:1 QS dilution. r = 0.97.

    Techniques Used: Generated

    9) Product Images from "Large-scale genotyping of highly polymorphic loci by next-generation sequencing: how to overcome the challenges to reliably genotype individuals?"

    Article Title: Large-scale genotyping of highly polymorphic loci by next-generation sequencing: how to overcome the challenges to reliably genotype individuals?

    Journal: Heredity

    doi: 10.1038/hdy.2015.13

    Distribution of the reads according to the frequency of the variant ( i ) within the amplicon j ( F ij ) they belong over all amplicons with 12 or more reads for Mama-UB ( a ), Mama-UD ( b ), Mama-DRB1 ( c ) and Mama-DRB2 ( d ). White bars likely correspond to homozygous
    Figure Legend Snippet: Distribution of the reads according to the frequency of the variant ( i ) within the amplicon j ( F ij ) they belong over all amplicons with 12 or more reads for Mama-UB ( a ), Mama-UD ( b ), Mama-DRB1 ( c ) and Mama-DRB2 ( d ). White bars likely correspond to homozygous

    Techniques Used: Variant Assay, Amplification

    10) Product Images from "A chimeric bovine enteric calicivirus: evidence for genomic recombination in genogroup III of the Norovirus genus of the Caliciviridae"

    Article Title: A chimeric bovine enteric calicivirus: evidence for genomic recombination in genogroup III of the Norovirus genus of the Caliciviridae

    Journal: Virology

    doi: 10.1016/j.virol.2004.06.010

    HMA with the 316 bp M13-forward/M13-reverse amplicons from plasmids containing the 114 bp NI/E3 amplicons from the RdRp of BoCVs Bo/Newbury2/76/UK, Bo/Aberystwyth65/00/UK, and Bo/Thirsk10/00/UK. Lane A—Bo/Newbury2/76/UK, B—Bo/Thirsk10/00/UK, C—Bo/Aberystwyth65/00/UK, D—Bo/Newbury2/76/UK with Bo/Aberystwyth65/00/UK, E—Bo/Aberystwyth65/00/UK with Bo/Thirsk10/00/UK, F—Bo/Newbury2/76/UK with Bo/Thirsk10/00/UK. The dotted box outlines homoduplexes and the solid box outlines heteroduplexes. The figures in italics show nucleotide identities determined by sequence analysis between the 76-nucleotide fragments of the RdRp of the BoCVs in the relevant lane.
    Figure Legend Snippet: HMA with the 316 bp M13-forward/M13-reverse amplicons from plasmids containing the 114 bp NI/E3 amplicons from the RdRp of BoCVs Bo/Newbury2/76/UK, Bo/Aberystwyth65/00/UK, and Bo/Thirsk10/00/UK. Lane A—Bo/Newbury2/76/UK, B—Bo/Thirsk10/00/UK, C—Bo/Aberystwyth65/00/UK, D—Bo/Newbury2/76/UK with Bo/Aberystwyth65/00/UK, E—Bo/Aberystwyth65/00/UK with Bo/Thirsk10/00/UK, F—Bo/Newbury2/76/UK with Bo/Thirsk10/00/UK. The dotted box outlines homoduplexes and the solid box outlines heteroduplexes. The figures in italics show nucleotide identities determined by sequence analysis between the 76-nucleotide fragments of the RdRp of the BoCVs in the relevant lane.

    Techniques Used: Sequencing

    11) Product Images from "Deep profiling reveals substantial heterogeneity of integration outcomes in CRISPR knock-in experiments"

    Article Title: Deep profiling reveals substantial heterogeneity of integration outcomes in CRISPR knock-in experiments

    Journal: bioRxiv

    doi: 10.1101/841098

    SMRT sequencing and knock-knock analysis. A. SMRT sequencing. A given amplicon is sequenced across many subreads, from which a consensus sequence can be computed. Individual polymerase reads can have varying numbers (n) of subreads passes. B. Measurement of SMRT sequencing error rate after consensus calling, using reference amplicons of different lengths (1,500-4,800 bp). Sequencing error rates per kb can be decreased by limiting consensus calling to reads with increasing minimum number of subread passes. Boxes represent median + 25th and 75th percentiles; whiskers represent 5th and 95th percentiles. C. Barplot showing how subread passes stringency impacts the number of polymerase reads considered. D-I. Related to Fig. 1B-G . Examples of reads identified from knock-knock analysis of HEK293T cells edited
    Figure Legend Snippet: SMRT sequencing and knock-knock analysis. A. SMRT sequencing. A given amplicon is sequenced across many subreads, from which a consensus sequence can be computed. Individual polymerase reads can have varying numbers (n) of subreads passes. B. Measurement of SMRT sequencing error rate after consensus calling, using reference amplicons of different lengths (1,500-4,800 bp). Sequencing error rates per kb can be decreased by limiting consensus calling to reads with increasing minimum number of subread passes. Boxes represent median + 25th and 75th percentiles; whiskers represent 5th and 95th percentiles. C. Barplot showing how subread passes stringency impacts the number of polymerase reads considered. D-I. Related to Fig. 1B-G . Examples of reads identified from knock-knock analysis of HEK293T cells edited

    Techniques Used: Sequencing, Amplification

    Related Articles

    Multiplexing:

    Article Title: Ultra-high resolution HLA genotyping and allele discovery by highly multiplexed cDNA amplicon pyrosequencing
    Article Snippet: .. We attempted to sequence these amplicons over the course of two Roche/454 GS Junior sequencing runs to test the performance of the three amplicons and the multiplexing limit of the Roche/454 GS Junior for our assay respectively. .. Both sequencing runs performed well, yielding a variable number of sequence reads depending on multiplexing level, as well as the filter-pass performance of each amplicon at the augmented pooling ratios Table and Additional file : Table S4.

    Marker:

    Article Title: Multiplex PCR Method for Detection of Three Aeromonas Enterotoxin Genes ▿
    Article Snippet: .. The sizes of amplicons were determined using molecular size marker VIII (Roche Diagnostics, Montreal, Quebec, Canada). .. To confirm the specificity of the amplified amplicons, the alt and ast amplicons of the 25 molecularly characterized food isolates and the seven 148-bp amplicons of the fish moribund isolates were sequenced and analyzed.

    Size-exclusion Chromatography:

    Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance
    Article Snippet: .. Estimation of Heteroplasmic Mutations in mtDNA using Surveyor Nuclease ~2 kbase amplicons of the mtDNA coding region used primers A-H as described in Bannwarth, et al. [ ] qPCR conditions for these amplicons used SybrGreen detection and 25 nM [primers]; cycle conditions were 95°C for 3 min, then 50 cycles of 95°C for 30 sec, 57°C for 30 sec, 72°C for 4 min. Circular mtDNA standards for qPCR analysis of amplicons from these primers were made from Roche human genomic DNA treated with Plasmid-Safe exonuclease followed by purification on Mobio columns. .. Roche genomic DNA served as the standard for qPCR assays of 18S rRNA gene.

    Purification:

    Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance
    Article Snippet: .. Estimation of Heteroplasmic Mutations in mtDNA using Surveyor Nuclease ~2 kbase amplicons of the mtDNA coding region used primers A-H as described in Bannwarth, et al. [ ] qPCR conditions for these amplicons used SybrGreen detection and 25 nM [primers]; cycle conditions were 95°C for 3 min, then 50 cycles of 95°C for 30 sec, 57°C for 30 sec, 72°C for 4 min. Circular mtDNA standards for qPCR analysis of amplicons from these primers were made from Roche human genomic DNA treated with Plasmid-Safe exonuclease followed by purification on Mobio columns. .. Roche genomic DNA served as the standard for qPCR assays of 18S rRNA gene.

    Article Title: Validation of an Oligonucleotide Ligation Assay for Quantification of Human Immunodeficiency Virus Type 1 Drug-Resistant Mutants by Use of Massively Parallel Sequencing
    Article Snippet: .. Second-round amplicons were visualized on agarose gels, purified using a High Pure PCR product purification kit (Roche Applied Science, Mannheim, Germany), and quantified using a Quant-iT PicoGreen double-stranded DNA reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). .. Amplicons diluted to 1 × 107 molecules/μl were subjected to emulsion PCR and pyrosequencing on a 16-region gasket (Mozambican samples) or as pools of bar-coded amplicons from 14 subjects on a 2-region gasket (Kenyan samples) using a GS FLX Titanium system, according to the manufacturer's instructions (454 Life Sciences, Branford, CT, USA).

    Real-time Polymerase Chain Reaction:

    Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance
    Article Snippet: .. Estimation of Heteroplasmic Mutations in mtDNA using Surveyor Nuclease ~2 kbase amplicons of the mtDNA coding region used primers A-H as described in Bannwarth, et al. [ ] qPCR conditions for these amplicons used SybrGreen detection and 25 nM [primers]; cycle conditions were 95°C for 3 min, then 50 cycles of 95°C for 30 sec, 57°C for 30 sec, 72°C for 4 min. Circular mtDNA standards for qPCR analysis of amplicons from these primers were made from Roche human genomic DNA treated with Plasmid-Safe exonuclease followed by purification on Mobio columns. .. Roche genomic DNA served as the standard for qPCR assays of 18S rRNA gene.

    Sequencing:

    Article Title: Ultra-high resolution HLA genotyping and allele discovery by highly multiplexed cDNA amplicon pyrosequencing
    Article Snippet: .. We attempted to sequence these amplicons over the course of two Roche/454 GS Junior sequencing runs to test the performance of the three amplicons and the multiplexing limit of the Roche/454 GS Junior for our assay respectively. .. Both sequencing runs performed well, yielding a variable number of sequence reads depending on multiplexing level, as well as the filter-pass performance of each amplicon at the augmented pooling ratios Table and Additional file : Table S4.

    Article Title: Microbial drama in four acts - Extreme rain events cause cyclic succession in plankton communities
    Article Snippet: .. The amplicons were sequenced using the Roche 454 GS FLX Titanium platform at MR DNA laboratory (Shallowater, TX, USA) with an average sequencing depth of 50000 raw reads per sample. ..

    Polymerase Chain Reaction:

    Article Title: HiDRA-seq: High-Throughput SARS-CoV-2 Detection by RNA Barcoding and Amplicon Sequencing
    Article Snippet: .. Each PCR reaction was assembled by combining, in individual tubes, 5 ul of the three amplicons with 20 μl of PCR master mix containing 1.25X KAPA HiFi HotStart ReadyMix (Roche), 0.375 uM of the i5 primer (Microsynth AG) and 0.375 uM of the barcoded i7 primer (Illumina). ..

    Article Title: Validation of an Oligonucleotide Ligation Assay for Quantification of Human Immunodeficiency Virus Type 1 Drug-Resistant Mutants by Use of Massively Parallel Sequencing
    Article Snippet: .. Second-round amplicons were visualized on agarose gels, purified using a High Pure PCR product purification kit (Roche Applied Science, Mannheim, Germany), and quantified using a Quant-iT PicoGreen double-stranded DNA reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). .. Amplicons diluted to 1 × 107 molecules/μl were subjected to emulsion PCR and pyrosequencing on a 16-region gasket (Mozambican samples) or as pools of bar-coded amplicons from 14 subjects on a 2-region gasket (Kenyan samples) using a GS FLX Titanium system, according to the manufacturer's instructions (454 Life Sciences, Branford, CT, USA).

    Article Title: The endothelial-specific regulatory mutation, Mvwf1, is a common mouse founder allele
    Article Snippet: .. Genotyping Screening of a panel of DNA from multiple inbred mouse strains (Supplementary Table 1) was performed using RIIIS/J polymorphisms 5 kb and 10 kb upstream of B4galnt2 exon 1 by genomic PCR (primer sets 1 and 2 in Supplementary Table 2) using PfuTurboHotstart (Stratagene) for amplicons smaller than 3 kb or Expand Long Template PCR System (Roche) for amplicons larger than 3 kb per the manufacturer’s instructions. .. For a haplotype analysis, genomic sequencing was performed as described above (primer sets 1, 2, and 29–53 in Supplementary Table 2).

    Plasmid Preparation:

    Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance
    Article Snippet: .. Estimation of Heteroplasmic Mutations in mtDNA using Surveyor Nuclease ~2 kbase amplicons of the mtDNA coding region used primers A-H as described in Bannwarth, et al. [ ] qPCR conditions for these amplicons used SybrGreen detection and 25 nM [primers]; cycle conditions were 95°C for 3 min, then 50 cycles of 95°C for 30 sec, 57°C for 30 sec, 72°C for 4 min. Circular mtDNA standards for qPCR analysis of amplicons from these primers were made from Roche human genomic DNA treated with Plasmid-Safe exonuclease followed by purification on Mobio columns. .. Roche genomic DNA served as the standard for qPCR assays of 18S rRNA gene.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Roche full processing amplicon
    Relation between <t>amplicon</t> size and number of sequence reads. Mean number of reads (standard error of the mean) are plotted for the 28 different genes from the bacterial species L. pneumophila, S. aureus, P. aeruginosa, and S. pneumoniae . This relationship between size and number of reads is statistical significant (p-value
    Full Processing Amplicon, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 900 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/full processing amplicon/product/Roche
    Average 85 stars, based on 900 article reviews
    Price from $9.99 to $1999.99
    full processing amplicon - by Bioz Stars, 2020-10
    85/100 stars
      Buy from Supplier

    85
    Roche 454 amplicon dna library specific primers
    MEGAN comparison of the taxonomic profiles of (A) cDNA transcript-tags from <t>454</t> sequencing five individual lymph node samples and two lymph node sample pools and (B) genomic <t>DNA-tags</t> from four individual lymph node samples. Depicted are assignments with bit score cutoffs ≥50. Circle sizes are scaled logarithmically. Not assigned: sequencing-tags matching to sequences in the NCBI database that are not assigned to taxa; no hits: sequencing-tags not matching to any sequences in the NCBI database.
    454 Amplicon Dna Library Specific Primers, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/454 amplicon dna library specific primers/product/Roche
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    454 amplicon dna library specific primers - by Bioz Stars, 2020-10
    85/100 stars
      Buy from Supplier

    85
    Roche archaeal 16s rrna gene tag encoded flx titanium amplicon pyrosequencing bacterial
    Taxonomic classification of <t>archaeal</t> reads retrieved from different wells at genus levels from <t>16S</t> <t>rRNA</t> gene <t>pyrosequencing.</t>
    Archaeal 16s Rrna Gene Tag Encoded Flx Titanium Amplicon Pyrosequencing Bacterial, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/archaeal 16s rrna gene tag encoded flx titanium amplicon pyrosequencing bacterial/product/Roche
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    archaeal 16s rrna gene tag encoded flx titanium amplicon pyrosequencing bacterial - by Bioz Stars, 2020-10
    85/100 stars
      Buy from Supplier

    Image Search Results


    Relation between amplicon size and number of sequence reads. Mean number of reads (standard error of the mean) are plotted for the 28 different genes from the bacterial species L. pneumophila, S. aureus, P. aeruginosa, and S. pneumoniae . This relationship between size and number of reads is statistical significant (p-value

    Journal: PLoS ONE

    Article Title: High-Throughput Multilocus Sequence Typing: Bringing Molecular Typing to the Next Level

    doi: 10.1371/journal.pone.0039630

    Figure Lengend Snippet: Relation between amplicon size and number of sequence reads. Mean number of reads (standard error of the mean) are plotted for the 28 different genes from the bacterial species L. pneumophila, S. aureus, P. aeruginosa, and S. pneumoniae . This relationship between size and number of reads is statistical significant (p-value

    Article Snippet: Data Analysis NGS-data were automatically processed using the ‘Full Processing Amplicon’ pipeline available through the Run Wizard on the GS Junior Attendant PC (Roche).

    Techniques: Amplification, Sequencing, Significance Assay

    (A) Matched pairs of normalized Ct values and alignment rate. Ct values (y-axis-left) for sets of RT-qPCR technical replicates were normalized and correlated to the alignment rate (y-axis-right) for the different amplicons using the Wilcoxon-Signed-Rank test for matched pairs (p

    Journal: bioRxiv

    Article Title: HiDRA-seq: High-Throughput SARS-CoV-2 Detection by RNA Barcoding and Amplicon Sequencing

    doi: 10.1101/2020.06.02.130484

    Figure Lengend Snippet: (A) Matched pairs of normalized Ct values and alignment rate. Ct values (y-axis-left) for sets of RT-qPCR technical replicates were normalized and correlated to the alignment rate (y-axis-right) for the different amplicons using the Wilcoxon-Signed-Rank test for matched pairs (p

    Article Snippet: Each PCR reaction was assembled by combining, in individual tubes, 5 ul of the three amplicons with 20 μl of PCR master mix containing 1.25X KAPA HiFi HotStart ReadyMix (Roche), 0.375 uM of the i5 primer (Microsynth AG) and 0.375 uM of the barcoded i7 primer (Illumina).

    Techniques: Quantitative RT-PCR

    (A) Schematic representation of the protocol. Using a low volume liquid handling robot, the patients’ RNA is distributed in 384-well plates containing indexed oligo-dT primers. Barcoded cDNA is generated by reverse transcription and pooled into a single tube. Libraries are produced from SARS-CoV-2-specific amplicons and sequenced. Reads are de-multiplexed based on both a plate and a sample barcode and used for downstream diagnostic analysis. (B) Amplicon primer design. The table contains the sequences of the forward primers used to generate the different amplicons. The reverse primer is common to all amplicons and it anneals to the 3’-end of the barcoded oligo-dT primers used to generate cDNA in the reverse transcription. The primer labels contain the position of the first sequenced base. Insert length was calculated using the start of the poly-A sequence. SARS-CoV-2 NC_045512_2 sequence and GAPDH NM_002046.4 sequence were used as reference. For the theoretical size of the amplicon after PCR 1 the Nextera Tag (34bp), the length of the barcoded Oligo-dT-primer (80bp) and the primer sequence was added.

    Journal: bioRxiv

    Article Title: HiDRA-seq: High-Throughput SARS-CoV-2 Detection by RNA Barcoding and Amplicon Sequencing

    doi: 10.1101/2020.06.02.130484

    Figure Lengend Snippet: (A) Schematic representation of the protocol. Using a low volume liquid handling robot, the patients’ RNA is distributed in 384-well plates containing indexed oligo-dT primers. Barcoded cDNA is generated by reverse transcription and pooled into a single tube. Libraries are produced from SARS-CoV-2-specific amplicons and sequenced. Reads are de-multiplexed based on both a plate and a sample barcode and used for downstream diagnostic analysis. (B) Amplicon primer design. The table contains the sequences of the forward primers used to generate the different amplicons. The reverse primer is common to all amplicons and it anneals to the 3’-end of the barcoded oligo-dT primers used to generate cDNA in the reverse transcription. The primer labels contain the position of the first sequenced base. Insert length was calculated using the start of the poly-A sequence. SARS-CoV-2 NC_045512_2 sequence and GAPDH NM_002046.4 sequence were used as reference. For the theoretical size of the amplicon after PCR 1 the Nextera Tag (34bp), the length of the barcoded Oligo-dT-primer (80bp) and the primer sequence was added.

    Article Snippet: Each PCR reaction was assembled by combining, in individual tubes, 5 ul of the three amplicons with 20 μl of PCR master mix containing 1.25X KAPA HiFi HotStart ReadyMix (Roche), 0.375 uM of the i5 primer (Microsynth AG) and 0.375 uM of the barcoded i7 primer (Illumina).

    Techniques: Generated, Produced, Diagnostic Assay, Amplification, Sequencing, Polymerase Chain Reaction

    (A) Read distribution in the different wells of the plate. The histogram shows the read numbers obtained in the different wells of the plate for the different amplicons. As the input for the protocols was not normalized, a wide distribution in the number of reads is observed. Wells with

    Journal: bioRxiv

    Article Title: HiDRA-seq: High-Throughput SARS-CoV-2 Detection by RNA Barcoding and Amplicon Sequencing

    doi: 10.1101/2020.06.02.130484

    Figure Lengend Snippet: (A) Read distribution in the different wells of the plate. The histogram shows the read numbers obtained in the different wells of the plate for the different amplicons. As the input for the protocols was not normalized, a wide distribution in the number of reads is observed. Wells with

    Article Snippet: Each PCR reaction was assembled by combining, in individual tubes, 5 ul of the three amplicons with 20 μl of PCR master mix containing 1.25X KAPA HiFi HotStart ReadyMix (Roche), 0.375 uM of the i5 primer (Microsynth AG) and 0.375 uM of the barcoded i7 primer (Illumina).

    Techniques:

    MEGAN comparison of the taxonomic profiles of (A) cDNA transcript-tags from 454 sequencing five individual lymph node samples and two lymph node sample pools and (B) genomic DNA-tags from four individual lymph node samples. Depicted are assignments with bit score cutoffs ≥50. Circle sizes are scaled logarithmically. Not assigned: sequencing-tags matching to sequences in the NCBI database that are not assigned to taxa; no hits: sequencing-tags not matching to any sequences in the NCBI database.

    Journal: PLoS ONE

    Article Title: Nodeomics: Pathogen Detection in Vertebrate Lymph Nodes Using Meta-Transcriptomics

    doi: 10.1371/journal.pone.0013432

    Figure Lengend Snippet: MEGAN comparison of the taxonomic profiles of (A) cDNA transcript-tags from 454 sequencing five individual lymph node samples and two lymph node sample pools and (B) genomic DNA-tags from four individual lymph node samples. Depicted are assignments with bit score cutoffs ≥50. Circle sizes are scaled logarithmically. Not assigned: sequencing-tags matching to sequences in the NCBI database that are not assigned to taxa; no hits: sequencing-tags not matching to any sequences in the NCBI database.

    Article Snippet: Multiplex Amplicon Sequencing (Roche-454) Fusion-primers were designed including the sequences of the 454-Amplicon DNA library specific primers A and B, respectively, (GS FLX Amplicon DNA Library Preparation Method Manual, www.roche-applied-science.com ), 4-base barcode sequences for identifying amplicon products derived from mule deer specimen MD 257, MD OCT-pool, and MD 80228 (TGCA, ACGT, and CGAT, respectively), and the “universal” V6-specific PCR primer sequences V6F: 5′ TCGATGCAACGCGAAGAA 3′ and V6R: 5′ ACATTTCACAACACGAGCTGACGA 3′ (designed to conserved regions flanking V6 based on comparison of 110 bacterial DNA sequences ).

    Techniques: Sequencing

    Taxonomic classification of archaeal reads retrieved from different wells at genus levels from 16S rRNA gene pyrosequencing.

    Journal: PLoS ONE

    Article Title: Diversity of Microbial Communities in Production and Injection Waters of Algerian Oilfields Revealed by 16S rRNA Gene Amplicon 454 Pyrosequencing

    doi: 10.1371/journal.pone.0066588

    Figure Lengend Snippet: Taxonomic classification of archaeal reads retrieved from different wells at genus levels from 16S rRNA gene pyrosequencing.

    Article Snippet: Bacterial and Archaeal 16S rRNA Gene Tag-encoded FLX-titanium Amplicon Pyrosequencing Bacterial and archaeal tag-encoded FLX gene amplicon pyrosequencing (bTEFAP and aTEFAP, respectively) analysis were carried out by means of a Roche 454 FLX instrument with titanium reagents.

    Techniques: