ampicillin resistance genes  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88

    Structured Review

    Thermo Fisher ampicillin resistance genes
    Ampicillin Resistance Genes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ampicillin resistance genes/product/Thermo Fisher
    Average 88 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    ampicillin resistance genes - by Bioz Stars, 2020-09
    88/100 stars

    Images

    Related Articles

    Selection:

    Article Title: Improving Transformation of Staphylococcus aureus Belonging to the CC1, CC5 and CC8 Clonal Complexes
    Article Snippet: .. To facilitate antibiotic selection of other plasmids by ampicillin, the ampicillin resistance gene of pCR2.1 TOPO (Invitrogen) was disrupted by using Bpm I and Bsa I (New England Biolabs) followed by blunt-end ligation. .. Ampicillin sensitivity of the resulting plasmid, named pCR2.1-AmpS, was verified by plating the strain on LB/kanamycin and LB/ampicillin agar.

    Ligation:

    Article Title: Improving Transformation of Staphylococcus aureus Belonging to the CC1, CC5 and CC8 Clonal Complexes
    Article Snippet: .. To facilitate antibiotic selection of other plasmids by ampicillin, the ampicillin resistance gene of pCR2.1 TOPO (Invitrogen) was disrupted by using Bpm I and Bsa I (New England Biolabs) followed by blunt-end ligation. .. Ampicillin sensitivity of the resulting plasmid, named pCR2.1-AmpS, was verified by plating the strain on LB/kanamycin and LB/ampicillin agar.

    Generated:

    Article Title: Efficient Intracellular Assembly of Papillomaviral Vectors
    Article Snippet: .. The target plasmid pSU-5697 was generated by replacing the ampicillin resistance gene of pU-5864 with an SV40 Ori/blasticidin S deaminase cassette derived from pUb6-V5-HisA (Invitrogen). pUP-7665, which carries a putative packaging signal identified by Zhao and colleagues ( , ), was generated by ligating a Sma I- Avr II fragment of the BPV1 genome (bases 948 to 2770) in sense orientation upstream of the URR in the plasmid pU-5864. .. The BPV1 E1, E2, or E1-IRES-E2 expression plasmids were all engineered to contain the intron and PRE cassette from pCI-PRE.

    Derivative Assay:

    Article Title: Efficient Intracellular Assembly of Papillomaviral Vectors
    Article Snippet: .. The target plasmid pSU-5697 was generated by replacing the ampicillin resistance gene of pU-5864 with an SV40 Ori/blasticidin S deaminase cassette derived from pUb6-V5-HisA (Invitrogen). pUP-7665, which carries a putative packaging signal identified by Zhao and colleagues ( , ), was generated by ligating a Sma I- Avr II fragment of the BPV1 genome (bases 948 to 2770) in sense orientation upstream of the URR in the plasmid pU-5864. .. The BPV1 E1, E2, or E1-IRES-E2 expression plasmids were all engineered to contain the intron and PRE cassette from pCI-PRE.

    Article Title: Enzyme-Linked Immunosorbent Assays Using Novel Japanese Encephalitis Virus Antigen Improve the Accuracy of Clinical Diagnosis of Flavivirus Infections
    Article Snippet: .. The ampicillin resistance gene in pCBJE was replaced by a kanamycin resistance gene derived from the pVAX plasmid (Invitrogen, Carlsbad, CA) to generate pVJE. .. In addition, the chimeric human β-globin gene intron sequence derived from the pCI expression vector (Promega, Madison, WI) was PCR amplified and inserted between nucleotides 1240 and 1241 of the E gene to generate pVJEi.

    Expressing:

    Article Title: Toxin-Antitoxin Systems on the Large Defense Plasmid pSYSA of Synechocystis sp. PCC 6803 *
    Article Snippet: .. The ampicillin resistance gene of expression vector pBAD/Myc-His B (Invitrogen) was exchanged with the chloramphenicol or streptomycin resistance gene, respectively, resulting in plasmids pBAD_Cm and pBAD_Strep. .. Antitoxin gene ssl7004 was also cloned in expression vector pET28a (Novagen).

    Polymerase Chain Reaction:

    Article Title: Effects of the presence of ColE1 plasmid DNA in Escherichia coli on the host cell metabolism
    Article Snippet: .. Another PCR reaction was used to amplify an ampicillin-resistance gene from pUC18 plasmid (Invitrogen, CA) with the forward primer: 5' GAG TAA ACT TGG TCT GAC AGT 3' and reverse primer: 5' GGT TAA TGT CAT GAT AAT AAT 3'. .. The blunt-end PCR product of ColE1 replication origin region was linked with 5' phosphorylated blunt-end PCR product of an ampicillin-resistance gene to construct plasmid pOri1.

    Activated Clotting Time Assay:

    Article Title: Effects of the presence of ColE1 plasmid DNA in Escherichia coli on the host cell metabolism
    Article Snippet: .. Another PCR reaction was used to amplify an ampicillin-resistance gene from pUC18 plasmid (Invitrogen, CA) with the forward primer: 5' GAG TAA ACT TGG TCT GAC AGT 3' and reverse primer: 5' GGT TAA TGT CAT GAT AAT AAT 3'. .. The blunt-end PCR product of ColE1 replication origin region was linked with 5' phosphorylated blunt-end PCR product of an ampicillin-resistance gene to construct plasmid pOri1.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Effects of the presence of ColE1 plasmid DNA in Escherichia coli on the host cell metabolism
    Article Snippet: .. Another PCR reaction was used to amplify an ampicillin-resistance gene from pUC18 plasmid (Invitrogen, CA) with the forward primer: 5' GAG TAA ACT TGG TCT GAC AGT 3' and reverse primer: 5' GGT TAA TGT CAT GAT AAT AAT 3'. .. The blunt-end PCR product of ColE1 replication origin region was linked with 5' phosphorylated blunt-end PCR product of an ampicillin-resistance gene to construct plasmid pOri1.

    Plasmid Preparation:

    Article Title: Toxin-Antitoxin Systems on the Large Defense Plasmid pSYSA of Synechocystis sp. PCC 6803 *
    Article Snippet: .. The ampicillin resistance gene of expression vector pBAD/Myc-His B (Invitrogen) was exchanged with the chloramphenicol or streptomycin resistance gene, respectively, resulting in plasmids pBAD_Cm and pBAD_Strep. .. Antitoxin gene ssl7004 was also cloned in expression vector pET28a (Novagen).

    Article Title: Efficient Intracellular Assembly of Papillomaviral Vectors
    Article Snippet: .. The target plasmid pSU-5697 was generated by replacing the ampicillin resistance gene of pU-5864 with an SV40 Ori/blasticidin S deaminase cassette derived from pUb6-V5-HisA (Invitrogen). pUP-7665, which carries a putative packaging signal identified by Zhao and colleagues ( , ), was generated by ligating a Sma I- Avr II fragment of the BPV1 genome (bases 948 to 2770) in sense orientation upstream of the URR in the plasmid pU-5864. .. The BPV1 E1, E2, or E1-IRES-E2 expression plasmids were all engineered to contain the intron and PRE cassette from pCI-PRE.

    Article Title: Enzyme-Linked Immunosorbent Assays Using Novel Japanese Encephalitis Virus Antigen Improve the Accuracy of Clinical Diagnosis of Flavivirus Infections
    Article Snippet: .. The ampicillin resistance gene in pCBJE was replaced by a kanamycin resistance gene derived from the pVAX plasmid (Invitrogen, Carlsbad, CA) to generate pVJE. .. In addition, the chimeric human β-globin gene intron sequence derived from the pCI expression vector (Promega, Madison, WI) was PCR amplified and inserted between nucleotides 1240 and 1241 of the E gene to generate pVJEi.

    Article Title: Effects of the presence of ColE1 plasmid DNA in Escherichia coli on the host cell metabolism
    Article Snippet: .. Another PCR reaction was used to amplify an ampicillin-resistance gene from pUC18 plasmid (Invitrogen, CA) with the forward primer: 5' GAG TAA ACT TGG TCT GAC AGT 3' and reverse primer: 5' GGT TAA TGT CAT GAT AAT AAT 3'. .. The blunt-end PCR product of ColE1 replication origin region was linked with 5' phosphorylated blunt-end PCR product of an ampicillin-resistance gene to construct plasmid pOri1.

    Article Title: Pyrrolysyl-tRNA Synthetase with a Unique Architecture Enhances the Availability of Lysine Derivatives in Synthetic Genetic Codes
    Article Snippet: .. Each gene was fused with a DNA fragment carrying the LacI gene and T5/LacO promoter from pCDF-Mm2 [ ], which is the ampicillin-resistance gene, a pBR322 replication origin, and the rrnB terminator from the pBAD vector (Invitrogen, Thermo Fisher Scientific K. K., Tokyo, Japan). .. The plasmids harboring PylRS gene were amplified by inverse PCR using primers with two split tRNAPyl sequences that have an overlap of 15 bases.

    Article Title: Improved and simplified recombineering approach for influenza virus reverse genetics
    Article Snippet: .. The primer set A (Primer A-plus 5' GAATTCTGCAGATATCCTCGAG CATGCATCTAG3'; Primer A-negative 5' TGTTCTTTCCTGCGCCGCTACA GGGCGCGTGG3') was used for amplifying the ampicillin resistance gene, the pBR322 E. coli origin of replication and the human cytomegalovirus (CMV) immediate early promoter of the pCDNA3.0 vector (Invitrogen). .. Primer set B (Primer B-plus 5' TGTAGCGGCGCAGGAAAGAACA TGTGAGCAAA3'; Primer B-negative 5' CTCGAGGATATCTGCAGAATTC CAGCACAC3') was designed to amplify the bovine growth hormone (BGH) and the polyadenylation signal site from the pIRES-EGFP vector (Invitrogen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Thermo Fisher ampicillin resistance gene
    Ampicillin Resistance Gene, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ampicillin resistance gene/product/Thermo Fisher
    Average 91 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    ampicillin resistance gene - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    Image Search Results