Structured Review

TaKaRa ampicillin resistance gene
Ampicillin Resistance Gene, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ampicillin resistance gene/product/TaKaRa
Average 90 stars, based on 5 article reviews
Price from $9.99 to $1999.99
ampicillin resistance gene - by Bioz Stars, 2020-09
90/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Deletion of the Human Cytomegalovirus US17 Gene Increases the Ratio of Genomes per Infectious Unit and Alters Regulation of Immune and Endoplasmic Reticulum Stress Response Genes at Early and Late Times after Infection
Article Snippet: .. An insertion cassette was created by PCR amplification using a set of primers (forward primer, ATCGCCACCGCCGTCgaagttcctattctctagaaagtataggaacttc AGACGTCAGGTGGCACTTTT ; reverse primer, AACGACGAGTTTTTCCGgaagttcctatactttctagagaataggaacttc AGCTCTTGATCCGGCAAAC ) consisting of a 5′ portion encoding 15 to 17 bp of DNA directly flanking the US17 open reading frame upstream of the start codon or downstream of the stop codon (capital letters), an inner portion encoding an FLP recombinase site (lowercase letters), and 20 bp at their 3′ ends complementary to the ampicillin resistance gene of plasmid pPur (underlined letters) (Clontech, Mountain View, CA). .. A second round of amplification used the product of the first reaction as the template and a set of primers consisting of 50 bases flanking the US17 ORF (upstream primer, ACACTCTATAAACGGTTTCTCATACGCGCCTTTTGATCGCCACCGCCGTC; downstream primer, TTGGTGGAGACGGCCGGCGCGGCGGGTGGGGGAAACGACGAGTTTTTCCG).

Clone Assay:

Article Title: A Highly Conserved Motif at the COOH Terminus Dictates Endoplasmic Reticulum Exit and Cell Surface Expression of NKCC2 *
Article Snippet: .. Subclonings were carried out with the following vectors: 1) pCMV-Myc and pCMV-HA (Clontech), containing c-Myc epitope or HA tag, a multiple cloning site, and an ampicillin resistance gene; 2) pEGFP-C2 (Clontech), which contains the green fluorescent protein (GFP) gene, a multiple cloning site, and a KANAr resistance gene; and 3) pcDNA3.1/V5-His-TOPO (Invitrogen), which contains epitope V5, a multiple cloning site, and an ampicillin resistance gene. ..

Article Title: Soluble lytic transglycosylase SLT of Francisella novicida is involved in intracellular growth and immune suppression
Article Snippet: .. The iglC gene (FTN_1322) of F . novicida encoding the T6SS effector protein was cloned using pOM5, as described above, and the ampicillin resistance gene (ampR ) derived from pCMV-HA-N (Takara Bio) was cloned downstream of IglC to generate pOM5-IglC-AmpR. .. To express the fusion protein of IglC and AmpR (IglC-AmpR), pOM5-IglC-AmpR were used to transform the Δbla , Δslt Δbla , or ΔdotU Δbla mutant.

Amplification:

Article Title: Deletion of the Human Cytomegalovirus US17 Gene Increases the Ratio of Genomes per Infectious Unit and Alters Regulation of Immune and Endoplasmic Reticulum Stress Response Genes at Early and Late Times after Infection
Article Snippet: .. An insertion cassette was created by PCR amplification using a set of primers (forward primer, ATCGCCACCGCCGTCgaagttcctattctctagaaagtataggaacttc AGACGTCAGGTGGCACTTTT ; reverse primer, AACGACGAGTTTTTCCGgaagttcctatactttctagagaataggaacttc AGCTCTTGATCCGGCAAAC ) consisting of a 5′ portion encoding 15 to 17 bp of DNA directly flanking the US17 open reading frame upstream of the start codon or downstream of the stop codon (capital letters), an inner portion encoding an FLP recombinase site (lowercase letters), and 20 bp at their 3′ ends complementary to the ampicillin resistance gene of plasmid pPur (underlined letters) (Clontech, Mountain View, CA). .. A second round of amplification used the product of the first reaction as the template and a set of primers consisting of 50 bases flanking the US17 ORF (upstream primer, ACACTCTATAAACGGTTTCTCATACGCGCCTTTTGATCGCCACCGCCGTC; downstream primer, TTGGTGGAGACGGCCGGCGCGGCGGGTGGGGGAAACGACGAGTTTTTCCG).

Plasmid Preparation:

Article Title: The Release of Norepinephrine in C57BL/6J Mice Treated with 6-Hydroxydopamine (6-OHDA) is Associated with Translocations in Enteric Escherichia coli via the QseC Histidine Kinase Receptor
Article Snippet: .. Establishment of tracer bacteria pEGFP, a plasmid containing an ampicillin resistance gene and a gene encoding green fluorescent protein (GFP), was obtained commercially (Clontech, Tokyo, Japan). .. To establish the tracer bacteria, pEGFP was transformed into E. coli BW25113 and qseC negative mutant strain BW25113ΔqseC to facilitate bacterial resistance and fluorescent labeling in later animal experiments (E. coli K-12 BW25113ΔqseC pQseC already has an ampicillin resistance gene and a GFP gene when constructing a qseC complementary vector).

Article Title: Deletion of the Human Cytomegalovirus US17 Gene Increases the Ratio of Genomes per Infectious Unit and Alters Regulation of Immune and Endoplasmic Reticulum Stress Response Genes at Early and Late Times after Infection
Article Snippet: .. An insertion cassette was created by PCR amplification using a set of primers (forward primer, ATCGCCACCGCCGTCgaagttcctattctctagaaagtataggaacttc AGACGTCAGGTGGCACTTTT ; reverse primer, AACGACGAGTTTTTCCGgaagttcctatactttctagagaataggaacttc AGCTCTTGATCCGGCAAAC ) consisting of a 5′ portion encoding 15 to 17 bp of DNA directly flanking the US17 open reading frame upstream of the start codon or downstream of the stop codon (capital letters), an inner portion encoding an FLP recombinase site (lowercase letters), and 20 bp at their 3′ ends complementary to the ampicillin resistance gene of plasmid pPur (underlined letters) (Clontech, Mountain View, CA). .. A second round of amplification used the product of the first reaction as the template and a set of primers consisting of 50 bases flanking the US17 ORF (upstream primer, ACACTCTATAAACGGTTTCTCATACGCGCCTTTTGATCGCCACCGCCGTC; downstream primer, TTGGTGGAGACGGCCGGCGCGGCGGGTGGGGGAAACGACGAGTTTTTCCG).

Derivative Assay:

Article Title: Soluble lytic transglycosylase SLT of Francisella novicida is involved in intracellular growth and immune suppression
Article Snippet: .. The iglC gene (FTN_1322) of F . novicida encoding the T6SS effector protein was cloned using pOM5, as described above, and the ampicillin resistance gene (ampR ) derived from pCMV-HA-N (Takara Bio) was cloned downstream of IglC to generate pOM5-IglC-AmpR. .. To express the fusion protein of IglC and AmpR (IglC-AmpR), pOM5-IglC-AmpR were used to transform the Δbla , Δslt Δbla , or ΔdotU Δbla mutant.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    TaKaRa aat ii eam 1105i fragment
    Aat Ii Eam 1105i Fragment, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aat ii eam 1105i fragment/product/TaKaRa
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aat ii eam 1105i fragment - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    90
    TaKaRa ampicillin resistance gene
    Ampicillin Resistance Gene, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ampicillin resistance gene/product/TaKaRa
    Average 90 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    ampicillin resistance gene - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    Image Search Results