ampicillin resistance gene  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Ampicillin
    Description:
    Chemical structure ß lactam
    Catalog Number:
    a1593
    Price:
    None
    Applications:
    Used to select for ampicillin resistance in mutated and transformed cells.
    Buy from Supplier


    Structured Review

    Millipore ampicillin resistance gene
    Ampicillin
    Chemical structure ß lactam
    https://www.bioz.com/result/ampicillin resistance gene/product/Millipore
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    ampicillin resistance gene - by Bioz Stars, 2020-09
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Gain-of-function mutations indicate that Escherichia coli Kch forms a functional K+ conduit in vivo
    Article Snippet: .. The empty pB11d plasmid (ampicillin resistance) was created by substituting the multiple cloning site-containing Pst I– Xba I fragment of pB10b ( ) with that of pET21d (Novagen, USA). .. To create pGEM-WT (Figure A), a Bam HI-tagged 5′ primer (5′-CG GGATCC GATTTACTGGCTCAACCGTTATTGC-3′) and a Pst I-tagged 3′ primer (5′-AA CTGCAG TCCTTTTGAAAGCGCATTGTTAT GAG-3′) were used for PCR to clone the kch coding and flanking region from wild-type FRAG1 genomic DNA, and the resulting Bam HI– Pst I fragment was inserted in pGEM-3Zf(+) vector (Promega, USA).

    Article Title: Complex stability and dynamic subunit interchange modulates the disparate activities of the yeast moonlighting proteins Hal3 and Vhs3
    Article Snippet: .. The PDs were also cloned into the ampicillin resistant co-expression vector pETDuet-1 (Novagen), which allows for the simultaneous expression of two proteins: the first with an N-terminal 6 × His fusion tag, and the second as an untagged protein. .. Cab3PD was subcloned from pET28a-Cab3PD into the second multiple cloning site (MCS) of the vector using the NdeI/XhoI restriction sites.

    Positron Emission Tomography:

    Article Title: An Escherichia coli strain for expression of the connexin45 carboxyl terminus attached to the 4th transmembrane domain
    Article Snippet: .. Table provides the amino acid sequence and species used for each TM4-CT domain to clone and ligate into the pET-14b expression vector (N-terminal 6× His-tag, ampicillin resistance; Novagen). .. Each construct includes 10 residues prior to their predicted TM4 domain (e.g., TM4-Cx45CT, Figure ).

    Infection:

    Article Title: Fosmidomycin, an inhibitor of isoprenoid synthesis, induces persistence in Chlamydia by inhibiting peptidoglycan assembly
    Article Snippet: .. Chlamydia -infected HeLa cells treated with 1 μg/mL ampicillin (AMP) (Sigma-Aldrich, MO, USA) were harvested at 22 hpci. .. Pelleted bacterial samples were suspended for 1 h at room temperature in a solution of 2% formaldehyde (freshly prepared from paraformaldehyde crystals) and 2% EM grade glutaraldehyde (Electron Microscopy Sciences, Hatfield, PA) prepared in 0.1 M cacodylate buffer, pH 7.2.

    Expressing:

    Article Title: An Escherichia coli strain for expression of the connexin45 carboxyl terminus attached to the 4th transmembrane domain
    Article Snippet: .. Table provides the amino acid sequence and species used for each TM4-CT domain to clone and ligate into the pET-14b expression vector (N-terminal 6× His-tag, ampicillin resistance; Novagen). .. Each construct includes 10 residues prior to their predicted TM4 domain (e.g., TM4-Cx45CT, Figure ).

    Article Title: Complex stability and dynamic subunit interchange modulates the disparate activities of the yeast moonlighting proteins Hal3 and Vhs3
    Article Snippet: .. The PDs were also cloned into the ampicillin resistant co-expression vector pETDuet-1 (Novagen), which allows for the simultaneous expression of two proteins: the first with an N-terminal 6 × His fusion tag, and the second as an untagged protein. .. Cab3PD was subcloned from pET28a-Cab3PD into the second multiple cloning site (MCS) of the vector using the NdeI/XhoI restriction sites.

    Sequencing:

    Article Title: An Escherichia coli strain for expression of the connexin45 carboxyl terminus attached to the 4th transmembrane domain
    Article Snippet: .. Table provides the amino acid sequence and species used for each TM4-CT domain to clone and ligate into the pET-14b expression vector (N-terminal 6× His-tag, ampicillin resistance; Novagen). .. Each construct includes 10 residues prior to their predicted TM4 domain (e.g., TM4-Cx45CT, Figure ).

    Chick Chorioallantoic Membrane Assay:

    Article Title: Inhibitory Effects of Lactoferrin on Growth and Biofilm Formation of Porphyromonas gingivalis and Prevotella intermedia ▿
    Article Snippet: .. Ampicillin (ABPC), ciprofloxacin (CPFX), clarithromycin (CAM), and minocycline hydrochloride (MINO) were obtained from Sigma-Aldrich (Tokyo, Japan). ..

    Plasmid Preparation:

    Article Title: An Escherichia coli strain for expression of the connexin45 carboxyl terminus attached to the 4th transmembrane domain
    Article Snippet: .. Table provides the amino acid sequence and species used for each TM4-CT domain to clone and ligate into the pET-14b expression vector (N-terminal 6× His-tag, ampicillin resistance; Novagen). .. Each construct includes 10 residues prior to their predicted TM4 domain (e.g., TM4-Cx45CT, Figure ).

    Article Title: Gain-of-function mutations indicate that Escherichia coli Kch forms a functional K+ conduit in vivo
    Article Snippet: .. The empty pB11d plasmid (ampicillin resistance) was created by substituting the multiple cloning site-containing Pst I– Xba I fragment of pB10b ( ) with that of pET21d (Novagen, USA). .. To create pGEM-WT (Figure A), a Bam HI-tagged 5′ primer (5′-CG GGATCC GATTTACTGGCTCAACCGTTATTGC-3′) and a Pst I-tagged 3′ primer (5′-AA CTGCAG TCCTTTTGAAAGCGCATTGTTAT GAG-3′) were used for PCR to clone the kch coding and flanking region from wild-type FRAG1 genomic DNA, and the resulting Bam HI– Pst I fragment was inserted in pGEM-3Zf(+) vector (Promega, USA).

    Article Title: Cas13b is a Type VI-B CRISPR-associated RNA-Guided RNase differentially regulated by accessory proteins Csx27 and Csx28
    Article Snippet: .. To determine interference, 25 ng of the ampicillin resistant target plasmid and 25 ng of the chloramphenicol resistant bzcas13b or empty vector (pACYC) were added to 5 uL of NovaBlue GigaSingle cells (Novagen). .. Then, 95 uL of SOC was added to cells and they were incubated with shaking at 37°C for 90 minutes, before plating the entire outgrowth (100 uL) on plates containing both chloramphenicol and ampicillin.

    Article Title: Complex stability and dynamic subunit interchange modulates the disparate activities of the yeast moonlighting proteins Hal3 and Vhs3
    Article Snippet: .. The PDs were also cloned into the ampicillin resistant co-expression vector pETDuet-1 (Novagen), which allows for the simultaneous expression of two proteins: the first with an N-terminal 6 × His fusion tag, and the second as an untagged protein. .. Cab3PD was subcloned from pET28a-Cab3PD into the second multiple cloning site (MCS) of the vector using the NdeI/XhoI restriction sites.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore β lactamase bla gene encoding ampicillin resistance
    β Lactamase Bla Gene Encoding Ampicillin Resistance, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/β lactamase bla gene encoding ampicillin resistance/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    β lactamase bla gene encoding ampicillin resistance - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results