amicon ultra protein concentrator  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Millipore amicon ultra protein concentrator
    Amicon Ultra Protein Concentrator, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amicon ultra protein concentrator/product/Millipore
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    amicon ultra protein concentrator - by Bioz Stars, 2020-04
    93/100 stars

    Related Products / Commonly Used Together

    uv analysis
    bioa

    Images

    Related Articles

    Clone Assay:

    Article Title: Unexpected functional implication of a stable succinimide in the structural stability of Methanocaldococcus jannaschii glutaminase
    Article Snippet: The protein was concentrated using Amicon ultra protein concentrator (Millipore) with 10 kDa cutoff. .. The protein concentration was estimated by the method of Bradford using BSA as standard . (His)6 -tagged MjGATase was cloned, expressed and purified as described below.

    Article Title: Virtual Screening, pharmacophore development and structure based similarity search to identify inhibitors against IdeR, a transcription factor of Mycobacterium tuberculosis
    Article Snippet: Paragraph title: Cloning of the gene, expression and purification of IdeR ... Protein estimation of the eluted fractions was carried out by Bradford assay, analyzed by SDS-PAGE on a 12.5% gel and samples were pooled and dialyzed against the buffer (20 mM Tris, 50 mM NaCl and 1 mM DTT) and concentrated by using an Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa filter and the purified protein was stored in aliquots at −80 °C.

    Centrifugation:

    Article Title: Identification of Mycobacterium tuberculosis BioA inhibitors by using structure-based virtual screening
    Article Snippet: Purification of BioA For purification, the cells from the induced culture were harvested and resuspended in lysis buffer containing 20 mM Tris-HCl (pH 8.0), 10 mM imidazole, 500 mM NaCl, 5 mM β-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride and 100 μM PLP and lysed by sonication followed by centrifugation to remove cell debris (15,000× g , 45 minutes, 4°C). .. The fractions containing BioA were pooled, concentrated by Amicon Ultra Protein Concentrator (EMD Millipore) and loaded onto a Sephadex G-10 column equilibrated with 20 mM Tris-HCl (pH 8.0), 100 mM NaCl and 10 μM PLP.

    Article Title: Unexpected functional implication of a stable succinimide in the structural stability of Methanocaldococcus jannaschii glutaminase
    Article Snippet: Cells were collected by centrifugation at 4,000g , resuspended in a buffer containing 20 mM Tris HCl, pH 7.4, 10% glycerol, 2 mM DTT, 0.1 mM PMSF, and 0.1 mM EDTA and lysed using a French press. .. The protein was concentrated using Amicon ultra protein concentrator (Millipore) with 10 kDa cutoff.

    Article Title: Identification of Inhibitors against Mycobacterium tuberculosis Thiamin Phosphate Synthase, an Important Target for the Development of Anti-TB Drugs
    Article Snippet: Purification of MtTPS After induction at 15°C, the E.coli cells from a 2 litre LB culture were harvested by centrifugation at 4°C, 6000 g for 10 minutes and resuspended in 25 ml of resuspension buffer (20 mM Tris-HCl, 50 mM NaCl, 1 mM phenylmethylsulfonyl fluoride (PMSF), 2 mM β-mercaptoethanol, pH 8.0) followed by sonication. .. After determining the protein concentration by Bradford assay , the fractions were analyzed by SDS-PAGE using a 12.5% gel and the fractions containing TPS were pooled and concentrated by using Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa cutoff filter.

    Article Title: Virtual Screening, pharmacophore development and structure based similarity search to identify inhibitors against IdeR, a transcription factor of Mycobacterium tuberculosis
    Article Snippet: After induction for 3 hours, the E. coli cells were harvested by centrifugation at 4 °C, 6340 g for 10 minutes and resuspended in 30 ml lysis buffer (20 mM Tris-HCl (pH 8.0), 50 mM NaCl, 1 mM phenylmethylsulfonylfluoride (PMSF), 2 mM β-mercaptoethanol, and 5 mM Imidazole). .. Protein estimation of the eluted fractions was carried out by Bradford assay, analyzed by SDS-PAGE on a 12.5% gel and samples were pooled and dialyzed against the buffer (20 mM Tris, 50 mM NaCl and 1 mM DTT) and concentrated by using an Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa filter and the purified protein was stored in aliquots at −80 °C.

    Amplification:

    Article Title: Unexpected functional implication of a stable succinimide in the structural stability of Methanocaldococcus jannaschii glutaminase
    Article Snippet: The protein was concentrated using Amicon ultra protein concentrator (Millipore) with 10 kDa cutoff. .. Gene for MjGATase was PCR amplified using pST39_WTMjGATase plasmid as a template and cloned into modified pET21b vector using BamHI and SacI restriction sites to generate protein with N-terminal (His)6 -tag.

    Article Title: Virtual Screening, pharmacophore development and structure based similarity search to identify inhibitors against IdeR, a transcription factor of Mycobacterium tuberculosis
    Article Snippet: The amplified product was digested with Nde I and Hind III and cloned into pET28c digested with the same enzymes resulting in the construct pET28c/IdeR , which was subsequently used for carrying out the expression and purification studies. .. Protein estimation of the eluted fractions was carried out by Bradford assay, analyzed by SDS-PAGE on a 12.5% gel and samples were pooled and dialyzed against the buffer (20 mM Tris, 50 mM NaCl and 1 mM DTT) and concentrated by using an Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa filter and the purified protein was stored in aliquots at −80 °C.

    Construct:

    Article Title: Virtual Screening, pharmacophore development and structure based similarity search to identify inhibitors against IdeR, a transcription factor of Mycobacterium tuberculosis
    Article Snippet: The amplified product was digested with Nde I and Hind III and cloned into pET28c digested with the same enzymes resulting in the construct pET28c/IdeR , which was subsequently used for carrying out the expression and purification studies. .. Protein estimation of the eluted fractions was carried out by Bradford assay, analyzed by SDS-PAGE on a 12.5% gel and samples were pooled and dialyzed against the buffer (20 mM Tris, 50 mM NaCl and 1 mM DTT) and concentrated by using an Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa filter and the purified protein was stored in aliquots at −80 °C.

    Plasmid Purification:

    Article Title: Identification of Mycobacterium tuberculosis BioA inhibitors by using structure-based virtual screening
    Article Snippet: .. The fractions containing BioA were pooled, concentrated by Amicon Ultra Protein Concentrator (EMD Millipore) and loaded onto a Sephadex G-10 column equilibrated with 20 mM Tris-HCl (pH 8.0), 100 mM NaCl and 10 μM PLP. .. BioA enzyme assay Enzyme assays were performed as described by Mann et al with some modifications.

    Incubation:

    Article Title: Virtual Screening, pharmacophore development and structure based similarity search to identify inhibitors against IdeR, a transcription factor of Mycobacterium tuberculosis
    Article Snippet: The resuspended cells were sonicated and the lysate was centrifuged at 12,000 g for 45 minutes at 4 °C and the supernatant was incubated with 1.5 ml Ni-NTA resin pre-equilibrated with buffer containing 20 mM Tris-HCl (pH 8.0), 50 mM NaCl and 5 mM imidazole for 1 hour. .. Protein estimation of the eluted fractions was carried out by Bradford assay, analyzed by SDS-PAGE on a 12.5% gel and samples were pooled and dialyzed against the buffer (20 mM Tris, 50 mM NaCl and 1 mM DTT) and concentrated by using an Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa filter and the purified protein was stored in aliquots at −80 °C.

    Expressing:

    Article Title: Unexpected functional implication of a stable succinimide in the structural stability of Methanocaldococcus jannaschii glutaminase
    Article Snippet: Paragraph title: Protein expression and purification ... The protein was concentrated using Amicon ultra protein concentrator (Millipore) with 10 kDa cutoff.

    Article Title: Virtual Screening, pharmacophore development and structure based similarity search to identify inhibitors against IdeR, a transcription factor of Mycobacterium tuberculosis
    Article Snippet: Paragraph title: Cloning of the gene, expression and purification of IdeR ... Protein estimation of the eluted fractions was carried out by Bradford assay, analyzed by SDS-PAGE on a 12.5% gel and samples were pooled and dialyzed against the buffer (20 mM Tris, 50 mM NaCl and 1 mM DTT) and concentrated by using an Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa filter and the purified protein was stored in aliquots at −80 °C.

    Bradford Assay:

    Article Title: Identification of Inhibitors against Mycobacterium tuberculosis Thiamin Phosphate Synthase, an Important Target for the Development of Anti-TB Drugs
    Article Snippet: .. After determining the protein concentration by Bradford assay , the fractions were analyzed by SDS-PAGE using a 12.5% gel and the fractions containing TPS were pooled and concentrated by using Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa cutoff filter. .. NaCl and desthiobiotin were removed from the purified sample by passing it through a G-25 column (7 ml) equilibrated with 20 mM Tris-HCl, pH 8.0 and the purified protein was stored at −20°C in aliquots after adding 10% glycerol and 1 mM DTT.

    Article Title: Virtual Screening, pharmacophore development and structure based similarity search to identify inhibitors against IdeR, a transcription factor of Mycobacterium tuberculosis
    Article Snippet: .. Protein estimation of the eluted fractions was carried out by Bradford assay, analyzed by SDS-PAGE on a 12.5% gel and samples were pooled and dialyzed against the buffer (20 mM Tris, 50 mM NaCl and 1 mM DTT) and concentrated by using an Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa filter and the purified protein was stored in aliquots at −80 °C. .. Electrophoretic Mobility Shift Assay (EMSA) A synthetic double stranded oligonucleotide belonging to intergenic region between MbtA and MbtB containing IdeR binding region with sequence-5′ccctgttagcacaggctgccctaattttagtg3′ (sense strand) and Cy5 fluorophore label at 5′ end of both the strands was procured from Integrated DNA Technologies, Coralville, Iowa, U.S.A and used as a substrate for the assay.

    Modification:

    Article Title: Unexpected functional implication of a stable succinimide in the structural stability of Methanocaldococcus jannaschii glutaminase
    Article Snippet: The protein was concentrated using Amicon ultra protein concentrator (Millipore) with 10 kDa cutoff. .. Gene for MjGATase was PCR amplified using pST39_WTMjGATase plasmid as a template and cloned into modified pET21b vector using BamHI and SacI restriction sites to generate protein with N-terminal (His)6 -tag.

    Transformation Assay:

    Article Title: Virtual Screening, pharmacophore development and structure based similarity search to identify inhibitors against IdeR, a transcription factor of Mycobacterium tuberculosis
    Article Snippet: BL21 (λDE3) cells transformed with pET28c/IdeR were grown to an A600nm of 0.8–1.0 in LB media at 37 °C containing 25 µg/ml of kanamycin and synthesis of IdeR protein was induced by the addition of 1 mM isopropyl-1-thio-β-D-galactopyranoside (IPTG) at 37 °C. .. Protein estimation of the eluted fractions was carried out by Bradford assay, analyzed by SDS-PAGE on a 12.5% gel and samples were pooled and dialyzed against the buffer (20 mM Tris, 50 mM NaCl and 1 mM DTT) and concentrated by using an Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa filter and the purified protein was stored in aliquots at −80 °C.

    High Performance Liquid Chromatography:

    Article Title: Unexpected functional implication of a stable succinimide in the structural stability of Methanocaldococcus jannaschii glutaminase
    Article Snippet: Thereafter, the supernatant was loaded on to a Q-sepharose column (HR 16/10) attached to AKTA Basic HPLC (GE Healthcare) for anion exchange chromatography. .. The protein was concentrated using Amicon ultra protein concentrator (Millipore) with 10 kDa cutoff.

    Chromatography:

    Article Title: Unexpected functional implication of a stable succinimide in the structural stability of Methanocaldococcus jannaschii glutaminase
    Article Snippet: Thereafter, the supernatant was loaded on to a Q-sepharose column (HR 16/10) attached to AKTA Basic HPLC (GE Healthcare) for anion exchange chromatography. .. The protein was concentrated using Amicon ultra protein concentrator (Millipore) with 10 kDa cutoff.

    Protein Concentration:

    Article Title: Unexpected functional implication of a stable succinimide in the structural stability of Methanocaldococcus jannaschii glutaminase
    Article Snippet: The protein was concentrated using Amicon ultra protein concentrator (Millipore) with 10 kDa cutoff. .. The protein concentration was estimated by the method of Bradford using BSA as standard . (His)6 -tagged MjGATase was cloned, expressed and purified as described below.

    Article Title: Identification of Inhibitors against Mycobacterium tuberculosis Thiamin Phosphate Synthase, an Important Target for the Development of Anti-TB Drugs
    Article Snippet: .. After determining the protein concentration by Bradford assay , the fractions were analyzed by SDS-PAGE using a 12.5% gel and the fractions containing TPS were pooled and concentrated by using Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa cutoff filter. .. NaCl and desthiobiotin were removed from the purified sample by passing it through a G-25 column (7 ml) equilibrated with 20 mM Tris-HCl, pH 8.0 and the purified protein was stored at −20°C in aliquots after adding 10% glycerol and 1 mM DTT.

    Polymerase Chain Reaction:

    Article Title: Unexpected functional implication of a stable succinimide in the structural stability of Methanocaldococcus jannaschii glutaminase
    Article Snippet: The protein was concentrated using Amicon ultra protein concentrator (Millipore) with 10 kDa cutoff. .. Gene for MjGATase was PCR amplified using pST39_WTMjGATase plasmid as a template and cloned into modified pET21b vector using BamHI and SacI restriction sites to generate protein with N-terminal (His)6 -tag.

    Sonication:

    Article Title: Identification of Mycobacterium tuberculosis BioA inhibitors by using structure-based virtual screening
    Article Snippet: Purification of BioA For purification, the cells from the induced culture were harvested and resuspended in lysis buffer containing 20 mM Tris-HCl (pH 8.0), 10 mM imidazole, 500 mM NaCl, 5 mM β-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride and 100 μM PLP and lysed by sonication followed by centrifugation to remove cell debris (15,000× g , 45 minutes, 4°C). .. The fractions containing BioA were pooled, concentrated by Amicon Ultra Protein Concentrator (EMD Millipore) and loaded onto a Sephadex G-10 column equilibrated with 20 mM Tris-HCl (pH 8.0), 100 mM NaCl and 10 μM PLP.

    Article Title: Identification of Inhibitors against Mycobacterium tuberculosis Thiamin Phosphate Synthase, an Important Target for the Development of Anti-TB Drugs
    Article Snippet: After sonication, the cell lysate was centrifuged at 12,000 g for 1 hour at 4°C and the supernatant was loaded onto a pre-equilibrated 4 ml strep - tactin superflow column. .. After determining the protein concentration by Bradford assay , the fractions were analyzed by SDS-PAGE using a 12.5% gel and the fractions containing TPS were pooled and concentrated by using Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa cutoff filter.

    Article Title: Virtual Screening, pharmacophore development and structure based similarity search to identify inhibitors against IdeR, a transcription factor of Mycobacterium tuberculosis
    Article Snippet: The resuspended cells were sonicated and the lysate was centrifuged at 12,000 g for 45 minutes at 4 °C and the supernatant was incubated with 1.5 ml Ni-NTA resin pre-equilibrated with buffer containing 20 mM Tris-HCl (pH 8.0), 50 mM NaCl and 5 mM imidazole for 1 hour. .. Protein estimation of the eluted fractions was carried out by Bradford assay, analyzed by SDS-PAGE on a 12.5% gel and samples were pooled and dialyzed against the buffer (20 mM Tris, 50 mM NaCl and 1 mM DTT) and concentrated by using an Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa filter and the purified protein was stored in aliquots at −80 °C.

    Nucleic Acid Electrophoresis:

    Article Title: Unexpected functional implication of a stable succinimide in the structural stability of Methanocaldococcus jannaschii glutaminase
    Article Snippet: The protein was concentrated using Amicon ultra protein concentrator (Millipore) with 10 kDa cutoff. .. The purified protein was analysed by SDS–polyacrylamide gel electrophoresis (PAGE) .

    Purification:

    Article Title: Identification of Mycobacterium tuberculosis BioA inhibitors by using structure-based virtual screening
    Article Snippet: Paragraph title: Purification of BioA ... The fractions containing BioA were pooled, concentrated by Amicon Ultra Protein Concentrator (EMD Millipore) and loaded onto a Sephadex G-10 column equilibrated with 20 mM Tris-HCl (pH 8.0), 100 mM NaCl and 10 μM PLP.

    Article Title: Unexpected functional implication of a stable succinimide in the structural stability of Methanocaldococcus jannaschii glutaminase
    Article Snippet: Paragraph title: Protein expression and purification ... The protein was concentrated using Amicon ultra protein concentrator (Millipore) with 10 kDa cutoff.

    Article Title: Identification of Inhibitors against Mycobacterium tuberculosis Thiamin Phosphate Synthase, an Important Target for the Development of Anti-TB Drugs
    Article Snippet: Paragraph title: Purification of MtTPS ... After determining the protein concentration by Bradford assay , the fractions were analyzed by SDS-PAGE using a 12.5% gel and the fractions containing TPS were pooled and concentrated by using Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa cutoff filter.

    Article Title: Virtual Screening, pharmacophore development and structure based similarity search to identify inhibitors against IdeR, a transcription factor of Mycobacterium tuberculosis
    Article Snippet: .. Protein estimation of the eluted fractions was carried out by Bradford assay, analyzed by SDS-PAGE on a 12.5% gel and samples were pooled and dialyzed against the buffer (20 mM Tris, 50 mM NaCl and 1 mM DTT) and concentrated by using an Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa filter and the purified protein was stored in aliquots at −80 °C. .. Electrophoretic Mobility Shift Assay (EMSA) A synthetic double stranded oligonucleotide belonging to intergenic region between MbtA and MbtB containing IdeR binding region with sequence-5′ccctgttagcacaggctgccctaattttagtg3′ (sense strand) and Cy5 fluorophore label at 5′ end of both the strands was procured from Integrated DNA Technologies, Coralville, Iowa, U.S.A and used as a substrate for the assay.

    Affinity Column:

    Article Title: Identification of Mycobacterium tuberculosis BioA inhibitors by using structure-based virtual screening
    Article Snippet: Clarified lysate was loaded onto a Ni-NTA metal affinity column pre-equilibrated with lysis buffer. .. The fractions containing BioA were pooled, concentrated by Amicon Ultra Protein Concentrator (EMD Millipore) and loaded onto a Sephadex G-10 column equilibrated with 20 mM Tris-HCl (pH 8.0), 100 mM NaCl and 10 μM PLP.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Unexpected functional implication of a stable succinimide in the structural stability of Methanocaldococcus jannaschii glutaminase
    Article Snippet: The protein was concentrated using Amicon ultra protein concentrator (Millipore) with 10 kDa cutoff. .. The purified protein was analysed by SDS–polyacrylamide gel electrophoresis (PAGE) .

    SDS Page:

    Article Title: Identification of Mycobacterium tuberculosis BioA inhibitors by using structure-based virtual screening
    Article Snippet: The protein was eluted with buffer containing 250 mM imidazole, and the purity of the protein was analyzed by SDS-PAGE by using a 12.5% polyacrylamide gel. .. The fractions containing BioA were pooled, concentrated by Amicon Ultra Protein Concentrator (EMD Millipore) and loaded onto a Sephadex G-10 column equilibrated with 20 mM Tris-HCl (pH 8.0), 100 mM NaCl and 10 μM PLP.

    Article Title: Identification of Inhibitors against Mycobacterium tuberculosis Thiamin Phosphate Synthase, an Important Target for the Development of Anti-TB Drugs
    Article Snippet: .. After determining the protein concentration by Bradford assay , the fractions were analyzed by SDS-PAGE using a 12.5% gel and the fractions containing TPS were pooled and concentrated by using Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa cutoff filter. .. NaCl and desthiobiotin were removed from the purified sample by passing it through a G-25 column (7 ml) equilibrated with 20 mM Tris-HCl, pH 8.0 and the purified protein was stored at −20°C in aliquots after adding 10% glycerol and 1 mM DTT.

    Article Title: Virtual Screening, pharmacophore development and structure based similarity search to identify inhibitors against IdeR, a transcription factor of Mycobacterium tuberculosis
    Article Snippet: .. Protein estimation of the eluted fractions was carried out by Bradford assay, analyzed by SDS-PAGE on a 12.5% gel and samples were pooled and dialyzed against the buffer (20 mM Tris, 50 mM NaCl and 1 mM DTT) and concentrated by using an Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa filter and the purified protein was stored in aliquots at −80 °C. .. Electrophoretic Mobility Shift Assay (EMSA) A synthetic double stranded oligonucleotide belonging to intergenic region between MbtA and MbtB containing IdeR binding region with sequence-5′ccctgttagcacaggctgccctaattttagtg3′ (sense strand) and Cy5 fluorophore label at 5′ end of both the strands was procured from Integrated DNA Technologies, Coralville, Iowa, U.S.A and used as a substrate for the assay.

    Plasmid Preparation:

    Article Title: Unexpected functional implication of a stable succinimide in the structural stability of Methanocaldococcus jannaschii glutaminase
    Article Snippet: The protein was concentrated using Amicon ultra protein concentrator (Millipore) with 10 kDa cutoff. .. Gene for MjGATase was PCR amplified using pST39_WTMjGATase plasmid as a template and cloned into modified pET21b vector using BamHI and SacI restriction sites to generate protein with N-terminal (His)6 -tag.

    Lysis:

    Article Title: Identification of Mycobacterium tuberculosis BioA inhibitors by using structure-based virtual screening
    Article Snippet: Clarified lysate was loaded onto a Ni-NTA metal affinity column pre-equilibrated with lysis buffer. .. The fractions containing BioA were pooled, concentrated by Amicon Ultra Protein Concentrator (EMD Millipore) and loaded onto a Sephadex G-10 column equilibrated with 20 mM Tris-HCl (pH 8.0), 100 mM NaCl and 10 μM PLP.

    Article Title: Virtual Screening, pharmacophore development and structure based similarity search to identify inhibitors against IdeR, a transcription factor of Mycobacterium tuberculosis
    Article Snippet: After induction for 3 hours, the E. coli cells were harvested by centrifugation at 4 °C, 6340 g for 10 minutes and resuspended in 30 ml lysis buffer (20 mM Tris-HCl (pH 8.0), 50 mM NaCl, 1 mM phenylmethylsulfonylfluoride (PMSF), 2 mM β-mercaptoethanol, and 5 mM Imidazole). .. Protein estimation of the eluted fractions was carried out by Bradford assay, analyzed by SDS-PAGE on a 12.5% gel and samples were pooled and dialyzed against the buffer (20 mM Tris, 50 mM NaCl and 1 mM DTT) and concentrated by using an Amicon Ultra protein concentrator (Millipore, Billerica, MA, USA) with a 5 kDa filter and the purified protein was stored in aliquots at −80 °C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Millipore amicon ultra protein concentrators
    Amicon Ultra Protein Concentrators, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amicon ultra protein concentrators/product/Millipore
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    amicon ultra protein concentrators - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    93
    Millipore amicon ultra protein concentrator
    Amicon Ultra Protein Concentrator, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amicon ultra protein concentrator/product/Millipore
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    amicon ultra protein concentrator - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    Image Search Results