Structured Review

Thermo Fisher agei
Agei, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/agei/product/Thermo Fisher
Average 94 stars, based on 26 article reviews
Price from $9.99 to $1999.99
agei - by Bioz Stars, 2020-04
94/100 stars

Images

Related Articles

Clone Assay:

Article Title: Caveolin 1 Inhibits HIV Replication by Transcriptional Repression Mediated through NF-?B ▿
Article Snippet: .. A green fluorescent protein (GFP)-expressing plasmid, pCMV-GFP, was constructed by cloning the cytomegalovirus (CMV) promoter into the AgeI and SspI sites of pEGFP.luc (Invitrogen, Carlsbad, CA). .. Similarly, a plasmid expressing GFP under the control of the HIV LTR, pLTR-GFP, was generated by first performing PCR amplification of HIV-1 LTR sequences from pNL4-3 provirus and then cloning them into the ClaI and AgeI restriction enzyme sites of pEGFP.luc.

Article Title: Cloning, Expression and Purification of the SRCR domains of glycoprotein 340
Article Snippet: Paragraph title: Initial Cloning of SRCR domains into pMT/V5-HisA vector ... Using restriction enzymes KpnI and AgeI , the PCR products and the pMT/V5-HisA vector (Invitrogen), which is an inducible Drosophila expression system (DES) vector containing a C-terminal 6 ×His-tag and an incorporated ampicillin selection gene were digested and thereafter ligated at 1:1 molar ratio using T4 DNA ligase (New England Biolabs, Inc).

Article Title: Complex Formation and Interactions between Transcription Factors Essential for Human Prolactin Receptor Gene Transcription ▿
Article Snippet: .. Enhanced yellow fluorescent protein (EYFP) and renilla luciferase (Rluc) genes were PCR amplified using pEYFP-N1 (BD Biosciences) and pRL (Promega) as templates, respectively, and cloned into either XhoI and AgeI or KpnI and BamHI sites of pcDNA3.1-V5/HIS (Invitrogen) to generate pcDNA–YFP and pcDNA-Rluc. .. Bioluminescence resonance energy transfer (BRET) constructs of ERα-YFP, ERα-Rluc, C/EBPβ-YFP, C/EBPβ-Rluc, and Rluc-SP1 were generated by ligating the coding sequences of ERα and C/EBPβ into KpnI and BamHI sites of both pcDNA-YFP and pcDNA-Rluc and SP1 into XhoI and AgeI sites of pcDNA-Rluc.

Article Title: Human APOBEC3 Proteins Can Inhibit Xenotropic Murine Leukemia Virus-Related Virus Infectivity
Article Snippet: Paragraph title: Molecular Clones ... Newly generated expression vectors include pTRIPZ-hA3G, which contains the full-length hA3G open reading frame inserted between the AgeI and MluI sites present in the Doxycycline-inducible lentiviral expression vector pTRIPZ (Open Biosystems).

Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
Article Snippet: The library oligonucleotides were then cloned downstream of the human U6 promoter in a lentiviral vector containing EGFP downstream of the human PGK promoter (pLKO.1-EGFP). .. The vector backbone was digested with AgeI and EcoRI, treated with FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific), purified on a 1% agarose gel followed by gel extraction (Qiagen).

Article Title: Role of Caspase-3 Cleaved IP3R1 on Ca2+ Homeostasis and Developmental Competence of Mouse Oocytes and Eggs
Article Snippet: The PCR fragment was cloned into the pcDNA6/myc-his A plasmid (Invitrogen, Carlsbad, CA). .. Plasmids were linearized with AgeI and then transcribed using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Amplification:

Article Title: Caveolin 1 Inhibits HIV Replication by Transcriptional Repression Mediated through NF-?B ▿
Article Snippet: A green fluorescent protein (GFP)-expressing plasmid, pCMV-GFP, was constructed by cloning the cytomegalovirus (CMV) promoter into the AgeI and SspI sites of pEGFP.luc (Invitrogen, Carlsbad, CA). .. Similarly, a plasmid expressing GFP under the control of the HIV LTR, pLTR-GFP, was generated by first performing PCR amplification of HIV-1 LTR sequences from pNL4-3 provirus and then cloning them into the ClaI and AgeI restriction enzyme sites of pEGFP.luc.

Article Title: Violacein as a genetically-controlled, enzymatically amplified and photobleaching-resistant chromophore for optoacoustic bacterial imaging
Article Snippet: .. MelA from Rhizobium etli was amplified from pTrc MelA (kindly provided by Dr. Guillermo Gosset Lagarda) and subcloned into pmCherry with AgeI and NotI. pVIO1-2 (kindly provided by Dr. José A. Salas), pmCherry (kind gift from Dr. Arie Geerlof, Helmholtz Zentrum München), pMelA and pUC19 (control bacteria) were transformed into TOP10 Chemically Competent E. coli (Invitrogen Carlsbad, CA, USA) according to the protocol of the manufacturer. ..

Article Title: Complex Formation and Interactions between Transcription Factors Essential for Human Prolactin Receptor Gene Transcription ▿
Article Snippet: .. Enhanced yellow fluorescent protein (EYFP) and renilla luciferase (Rluc) genes were PCR amplified using pEYFP-N1 (BD Biosciences) and pRL (Promega) as templates, respectively, and cloned into either XhoI and AgeI or KpnI and BamHI sites of pcDNA3.1-V5/HIS (Invitrogen) to generate pcDNA–YFP and pcDNA-Rluc. .. Bioluminescence resonance energy transfer (BRET) constructs of ERα-YFP, ERα-Rluc, C/EBPβ-YFP, C/EBPβ-Rluc, and Rluc-SP1 were generated by ligating the coding sequences of ERα and C/EBPβ into KpnI and BamHI sites of both pcDNA-YFP and pcDNA-Rluc and SP1 into XhoI and AgeI sites of pcDNA-Rluc.

Article Title: Effect of M-phase kinase phosphorylations on type 1 inositol 1,4,5-trisphosphate receptor-mediated Ca2+ responses in mouse eggs
Article Snippet: This DsRed fused sequence was amplified by PCR and subcloned into the pcDNA6/myc-His B vector by Dr. Cheon of the Fissore lab. .. Plasmids were linearized with AgeI and then transcribed from using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Article Title: Expression of recombinant Atlantic salmon serum C-type lectin in Drosophila melanogaster Schneider 2 cells
Article Snippet: The amplicon was ligated into pCR4Blunt-TOPO (Invitrogen) to generate pCR4_SSL_ Drosophila construct. .. The pCR4_SSL_ Drosophila vector was digested with BglII and AgeI and the 482-bp SSL cDNA fragment obtained was cloned between the same sites of pMT/Bip/V5-His A (Invitrogen), and confirmed by sequencing using MT_Forward 5′-CATCTCAGTGCAACTAAA-3′ and BGH_Reverse 5′-TAGAAGGCACAGTCGAGG-3′ primers.

Article Title: Screening for and Verification of Novel Mutations Associated with Drug Resistance in the HIV Type 1subtype B′ in China
Article Snippet: .. The primers used for amplification and site-directed mutagenesis were listed in .The targeted segments digested by the AgeI and SphI were subcloned into the plasmid pNL4-3, then the constructed plasmids were transfected into 293 T cells(at a density of 4×105 cells/ml) using Lipofectamine™ 2000 (Invitrogen) to obtain the virus. .. Transfection was conducted according to manufacturer's instructions (Lipofectamine™ 2000, Invitrogen).

Article Title: Role of Caspase-3 Cleaved IP3R1 on Ca2+ Homeostasis and Developmental Competence of Mouse Oocytes and Eggs
Article Snippet: For Venus construct, which encodes Venus fluorescence protein, Venus in PCs2 vector was used as a template ( ) and amplified using PCR flanked by HindIII and BamHI with Kozak sequence at the beginning and ligated into pcDNA6/myc-his B. .. Plasmids were linearized with AgeI and then transcribed using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Construct:

Article Title: Caveolin 1 Inhibits HIV Replication by Transcriptional Repression Mediated through NF-?B ▿
Article Snippet: .. A green fluorescent protein (GFP)-expressing plasmid, pCMV-GFP, was constructed by cloning the cytomegalovirus (CMV) promoter into the AgeI and SspI sites of pEGFP.luc (Invitrogen, Carlsbad, CA). .. Similarly, a plasmid expressing GFP under the control of the HIV LTR, pLTR-GFP, was generated by first performing PCR amplification of HIV-1 LTR sequences from pNL4-3 provirus and then cloning them into the ClaI and AgeI restriction enzyme sites of pEGFP.luc.

Article Title: Violacein as a genetically-controlled, enzymatically amplified and photobleaching-resistant chromophore for optoacoustic bacterial imaging
Article Snippet: Paragraph title: Genetic reporter constructs and bacterial growth ... MelA from Rhizobium etli was amplified from pTrc MelA (kindly provided by Dr. Guillermo Gosset Lagarda) and subcloned into pmCherry with AgeI and NotI. pVIO1-2 (kindly provided by Dr. José A. Salas), pmCherry (kind gift from Dr. Arie Geerlof, Helmholtz Zentrum München), pMelA and pUC19 (control bacteria) were transformed into TOP10 Chemically Competent E. coli (Invitrogen Carlsbad, CA, USA) according to the protocol of the manufacturer.

Article Title: Complex Formation and Interactions between Transcription Factors Essential for Human Prolactin Receptor Gene Transcription ▿
Article Snippet: Enhanced yellow fluorescent protein (EYFP) and renilla luciferase (Rluc) genes were PCR amplified using pEYFP-N1 (BD Biosciences) and pRL (Promega) as templates, respectively, and cloned into either XhoI and AgeI or KpnI and BamHI sites of pcDNA3.1-V5/HIS (Invitrogen) to generate pcDNA–YFP and pcDNA-Rluc. .. Bioluminescence resonance energy transfer (BRET) constructs of ERα-YFP, ERα-Rluc, C/EBPβ-YFP, C/EBPβ-Rluc, and Rluc-SP1 were generated by ligating the coding sequences of ERα and C/EBPβ into KpnI and BamHI sites of both pcDNA-YFP and pcDNA-Rluc and SP1 into XhoI and AgeI sites of pcDNA-Rluc.

Article Title: Alternative Transcripts and 3?UTR Elements Govern the Incorporation of Selenocysteine into Selenoprotein S
Article Snippet: Paragraph title: DNA constructs ... This was subsequently digested with SfuI and AgeI and ligated with the SfuI/AgeI insert from pcDNA3.1V5His (Invitrogen), which effectively switched the epitope tag from myc to V5.

Article Title: Effect of M-phase kinase phosphorylations on type 1 inositol 1,4,5-trisphosphate receptor-mediated Ca2+ responses in mouse eggs
Article Snippet: Paragraph title: DNA Constructs and cRNA preparation ... Plasmids were linearized with AgeI and then transcribed from using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Article Title: Expression of recombinant Atlantic salmon serum C-type lectin in Drosophila melanogaster Schneider 2 cells
Article Snippet: The amplicon was ligated into pCR4Blunt-TOPO (Invitrogen) to generate pCR4_SSL_ Drosophila construct. .. The pCR4_SSL_ Drosophila vector was digested with BglII and AgeI and the 482-bp SSL cDNA fragment obtained was cloned between the same sites of pMT/Bip/V5-His A (Invitrogen), and confirmed by sequencing using MT_Forward 5′-CATCTCAGTGCAACTAAA-3′ and BGH_Reverse 5′-TAGAAGGCACAGTCGAGG-3′ primers.

Article Title: The Role of 14-3-3? Interaction with Phosphorylated Cdc25B at Its Ser321 in the Release of the Mouse Oocyte from Prophase I Arrest
Article Snippet: .. In Vitro Transcription As described in our previous report , all pcDNA3.1-Myc constructs were linearized with AgeI. pcDNA3.1-ZEO-HA-14-3-3ε was linearized with XbaI and transcribed in vitro into 5′-capped mRNA for microinjection using a mMESSAGE mMACHINE kit (Ambion). .. Microinjection and Morphological Analysis Various Cdc25B mRNAs or plasmids and HA-Tagged 14-3-3ε mRNA or plasmids were microinjected into the cytoplasm or nucleus of GV-Stage oocytes using a micropipette and Eppendorf manipulators mounted on an Olympus inverted microscope, as in our previous report .

Article Title: Screening for and Verification of Novel Mutations Associated with Drug Resistance in the HIV Type 1subtype B′ in China
Article Snippet: .. The primers used for amplification and site-directed mutagenesis were listed in .The targeted segments digested by the AgeI and SphI were subcloned into the plasmid pNL4-3, then the constructed plasmids were transfected into 293 T cells(at a density of 4×105 cells/ml) using Lipofectamine™ 2000 (Invitrogen) to obtain the virus. .. Transfection was conducted according to manufacturer's instructions (Lipofectamine™ 2000, Invitrogen).

Article Title: Role of Caspase-3 Cleaved IP3R1 on Ca2+ Homeostasis and Developmental Competence of Mouse Oocytes and Eggs
Article Snippet: Paragraph title: DNA Constructs and cRNA preparation ... Plasmids were linearized with AgeI and then transcribed using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Electrophoresis:

Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
Article Snippet: The PCR-amplified library was then purified (Qiagen), digested with BbsI (New England Biolabs) at 37 °C overnight, and purified by electrophoresis on a 2% agarose gel and recovered using gel extraction kit (Qiagen). .. The vector backbone was digested with AgeI and EcoRI, treated with FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific), purified on a 1% agarose gel followed by gel extraction (Qiagen).

Luciferase:

Article Title: Complex Formation and Interactions between Transcription Factors Essential for Human Prolactin Receptor Gene Transcription ▿
Article Snippet: .. Enhanced yellow fluorescent protein (EYFP) and renilla luciferase (Rluc) genes were PCR amplified using pEYFP-N1 (BD Biosciences) and pRL (Promega) as templates, respectively, and cloned into either XhoI and AgeI or KpnI and BamHI sites of pcDNA3.1-V5/HIS (Invitrogen) to generate pcDNA–YFP and pcDNA-Rluc. .. Bioluminescence resonance energy transfer (BRET) constructs of ERα-YFP, ERα-Rluc, C/EBPβ-YFP, C/EBPβ-Rluc, and Rluc-SP1 were generated by ligating the coding sequences of ERα and C/EBPβ into KpnI and BamHI sites of both pcDNA-YFP and pcDNA-Rluc and SP1 into XhoI and AgeI sites of pcDNA-Rluc.

Article Title: Alternative Transcripts and 3?UTR Elements Govern the Incorporation of Selenocysteine into Selenoprotein S
Article Snippet: All of the other luciferase constructs are derived from the SelS variant 2 mRNA. .. This was subsequently digested with SfuI and AgeI and ligated with the SfuI/AgeI insert from pcDNA3.1V5His (Invitrogen), which effectively switched the epitope tag from myc to V5.

Article Title: Human APOBEC3 Proteins Can Inhibit Xenotropic Murine Leukemia Virus-Related Virus Infectivity
Article Snippet: The MLV-based luciferase expression vector pFB-Luc was obtained from Stratagene. pHIT/G is a previously described VSV G expression plasmid ( ). .. Newly generated expression vectors include pTRIPZ-hA3G, which contains the full-length hA3G open reading frame inserted between the AgeI and MluI sites present in the Doxycycline-inducible lentiviral expression vector pTRIPZ (Open Biosystems).

Introduce:

Article Title: Expression of recombinant Atlantic salmon serum C-type lectin in Drosophila melanogaster Schneider 2 cells
Article Snippet: The primers were designed to introduce BglII and AgeI restriction sites (underlined), respectively. .. The pCR4_SSL_ Drosophila vector was digested with BglII and AgeI and the 482-bp SSL cDNA fragment obtained was cloned between the same sites of pMT/Bip/V5-His A (Invitrogen), and confirmed by sequencing using MT_Forward 5′-CATCTCAGTGCAACTAAA-3′ and BGH_Reverse 5′-TAGAAGGCACAGTCGAGG-3′ primers.

Expressing:

Article Title: Caveolin 1 Inhibits HIV Replication by Transcriptional Repression Mediated through NF-?B ▿
Article Snippet: An expression plasmid for vesicular stomatitis virus (VSV) envelope G protein (pCI-VSV) was kindly provided by Garry Nolan of Stanford University. .. A green fluorescent protein (GFP)-expressing plasmid, pCMV-GFP, was constructed by cloning the cytomegalovirus (CMV) promoter into the AgeI and SspI sites of pEGFP.luc (Invitrogen, Carlsbad, CA).

Article Title: Cloning, Expression and Purification of the SRCR domains of glycoprotein 340
Article Snippet: .. Using restriction enzymes KpnI and AgeI , the PCR products and the pMT/V5-HisA vector (Invitrogen), which is an inducible Drosophila expression system (DES) vector containing a C-terminal 6 ×His-tag and an incorporated ampicillin selection gene were digested and thereafter ligated at 1:1 molar ratio using T4 DNA ligase (New England Biolabs, Inc). .. The ligated products were purified and transformed into chemically competent E. coli DH5α cells (Invitrogen, Inc).

Article Title: Effect of M-phase kinase phosphorylations on type 1 inositol 1,4,5-trisphosphate receptor-mediated Ca2+ responses in mouse eggs
Article Snippet: To construct the expression vector for ER-DsRed, the full-length sequence encoding for Discosoma sp . red fluorescent protein (DsRed2) with the ER targeting sequence of Calreticulin fused to the 5′ end and the ER retention sequence, KDEL fused to the 3′ end was a gift from Dr. Mohamed Trebak (The Centre for Cardiovascular Sciences, Albany Medical College, Albany, NY) to Dr. Wakai of the Fissore laboratory. .. Plasmids were linearized with AgeI and then transcribed from using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Article Title: Human APOBEC3 Proteins Can Inhibit Xenotropic Murine Leukemia Virus-Related Virus Infectivity
Article Snippet: .. Newly generated expression vectors include pTRIPZ-hA3G, which contains the full-length hA3G open reading frame inserted between the AgeI and MluI sites present in the Doxycycline-inducible lentiviral expression vector pTRIPZ (Open Biosystems). .. Also novel are expression vectors for the XMRV gag/pol and env genes.

Article Title: Expression of recombinant Atlantic salmon serum C-type lectin in Drosophila melanogaster Schneider 2 cells
Article Snippet: The pCR4_SSL_ Drosophila vector was digested with BglII and AgeI and the 482-bp SSL cDNA fragment obtained was cloned between the same sites of pMT/Bip/V5-His A (Invitrogen), and confirmed by sequencing using MT_Forward 5′-CATCTCAGTGCAACTAAA-3′ and BGH_Reverse 5′-TAGAAGGCACAGTCGAGG-3′ primers. .. The resulting expression vector, pMT/Bip_SSL, contains the sequences encoding the Drosophila N-terminal immunoglobulin-binding protein (BiP) signal sequence fused in-frame with SSL, and a C-terminal hexahistidine tag in tandem to produce an rSSL fusion protein.

Transformation Assay:

Article Title: Violacein as a genetically-controlled, enzymatically amplified and photobleaching-resistant chromophore for optoacoustic bacterial imaging
Article Snippet: .. MelA from Rhizobium etli was amplified from pTrc MelA (kindly provided by Dr. Guillermo Gosset Lagarda) and subcloned into pmCherry with AgeI and NotI. pVIO1-2 (kindly provided by Dr. José A. Salas), pmCherry (kind gift from Dr. Arie Geerlof, Helmholtz Zentrum München), pMelA and pUC19 (control bacteria) were transformed into TOP10 Chemically Competent E. coli (Invitrogen Carlsbad, CA, USA) according to the protocol of the manufacturer. ..

Article Title: Cloning, Expression and Purification of the SRCR domains of glycoprotein 340
Article Snippet: Using restriction enzymes KpnI and AgeI , the PCR products and the pMT/V5-HisA vector (Invitrogen), which is an inducible Drosophila expression system (DES) vector containing a C-terminal 6 ×His-tag and an incorporated ampicillin selection gene were digested and thereafter ligated at 1:1 molar ratio using T4 DNA ligase (New England Biolabs, Inc). .. The ligated products were purified and transformed into chemically competent E. coli DH5α cells (Invitrogen, Inc).

Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
Article Snippet: The vector backbone was digested with AgeI and EcoRI, treated with FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific), purified on a 1% agarose gel followed by gel extraction (Qiagen). .. To ensure library diversity, colonies were collected from 15 bacterial plates after transformation of 10-beta electrocompetent cells (New England Biolabs).

Derivative Assay:

Article Title: Alternative Transcripts and 3?UTR Elements Govern the Incorporation of Selenocysteine into Selenoprotein S
Article Snippet: All of the other luciferase constructs are derived from the SelS variant 2 mRNA. .. This was subsequently digested with SfuI and AgeI and ligated with the SfuI/AgeI insert from pcDNA3.1V5His (Invitrogen), which effectively switched the epitope tag from myc to V5.

Transfection:

Article Title: Screening for and Verification of Novel Mutations Associated with Drug Resistance in the HIV Type 1subtype B′ in China
Article Snippet: .. The primers used for amplification and site-directed mutagenesis were listed in .The targeted segments digested by the AgeI and SphI were subcloned into the plasmid pNL4-3, then the constructed plasmids were transfected into 293 T cells(at a density of 4×105 cells/ml) using Lipofectamine™ 2000 (Invitrogen) to obtain the virus. .. Transfection was conducted according to manufacturer's instructions (Lipofectamine™ 2000, Invitrogen).

Ligation:

Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
Article Snippet: The vector backbone was digested with AgeI and EcoRI, treated with FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific), purified on a 1% agarose gel followed by gel extraction (Qiagen). .. Ligation was performed using Quick Ligase kit (New England Biolabs).

Infection:

Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
Article Snippet: The vector backbone was digested with AgeI and EcoRI, treated with FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific), purified on a 1% agarose gel followed by gel extraction (Qiagen). .. The pool of plasmids was prepared for infection using an endotoxin-free Maxi prep kit (Qiagen).

Generated:

Article Title: Caveolin 1 Inhibits HIV Replication by Transcriptional Repression Mediated through NF-?B ▿
Article Snippet: A green fluorescent protein (GFP)-expressing plasmid, pCMV-GFP, was constructed by cloning the cytomegalovirus (CMV) promoter into the AgeI and SspI sites of pEGFP.luc (Invitrogen, Carlsbad, CA). .. Similarly, a plasmid expressing GFP under the control of the HIV LTR, pLTR-GFP, was generated by first performing PCR amplification of HIV-1 LTR sequences from pNL4-3 provirus and then cloning them into the ClaI and AgeI restriction enzyme sites of pEGFP.luc.

Article Title: Complex Formation and Interactions between Transcription Factors Essential for Human Prolactin Receptor Gene Transcription ▿
Article Snippet: Enhanced yellow fluorescent protein (EYFP) and renilla luciferase (Rluc) genes were PCR amplified using pEYFP-N1 (BD Biosciences) and pRL (Promega) as templates, respectively, and cloned into either XhoI and AgeI or KpnI and BamHI sites of pcDNA3.1-V5/HIS (Invitrogen) to generate pcDNA–YFP and pcDNA-Rluc. .. Bioluminescence resonance energy transfer (BRET) constructs of ERα-YFP, ERα-Rluc, C/EBPβ-YFP, C/EBPβ-Rluc, and Rluc-SP1 were generated by ligating the coding sequences of ERα and C/EBPβ into KpnI and BamHI sites of both pcDNA-YFP and pcDNA-Rluc and SP1 into XhoI and AgeI sites of pcDNA-Rluc.

Article Title: Alternative Transcripts and 3?UTR Elements Govern the Incorporation of Selenocysteine into Selenoprotein S
Article Snippet: The SelS constructs with V5 epitope tags used for in vitro translation/immunoprecipitation were generated by PCR amplifying the ORF of SelS without the stop codon using the common forward primer listed above and the SelS minus stop reverse primer 5′ CACTTCGAAGCCTCATCCGCCAGATGA . .. This was subsequently digested with SfuI and AgeI and ligated with the SfuI/AgeI insert from pcDNA3.1V5His (Invitrogen), which effectively switched the epitope tag from myc to V5.

Article Title: Human APOBEC3 Proteins Can Inhibit Xenotropic Murine Leukemia Virus-Related Virus Infectivity
Article Snippet: .. Newly generated expression vectors include pTRIPZ-hA3G, which contains the full-length hA3G open reading frame inserted between the AgeI and MluI sites present in the Doxycycline-inducible lentiviral expression vector pTRIPZ (Open Biosystems). .. Also novel are expression vectors for the XMRV gag/pol and env genes.

DNA Sequencing:

Article Title: Cloning, Expression and Purification of the SRCR domains of glycoprotein 340
Article Snippet: Using restriction enzymes KpnI and AgeI , the PCR products and the pMT/V5-HisA vector (Invitrogen), which is an inducible Drosophila expression system (DES) vector containing a C-terminal 6 ×His-tag and an incorporated ampicillin selection gene were digested and thereafter ligated at 1:1 molar ratio using T4 DNA ligase (New England Biolabs, Inc). .. Appropriate insertion of SRCR genes into the pMT/V5-HisA vector were verified by DNA sequencing (UAB Heflin sequencing center).

Polymerase Chain Reaction:

Article Title: Caveolin 1 Inhibits HIV Replication by Transcriptional Repression Mediated through NF-?B ▿
Article Snippet: A green fluorescent protein (GFP)-expressing plasmid, pCMV-GFP, was constructed by cloning the cytomegalovirus (CMV) promoter into the AgeI and SspI sites of pEGFP.luc (Invitrogen, Carlsbad, CA). .. Similarly, a plasmid expressing GFP under the control of the HIV LTR, pLTR-GFP, was generated by first performing PCR amplification of HIV-1 LTR sequences from pNL4-3 provirus and then cloning them into the ClaI and AgeI restriction enzyme sites of pEGFP.luc.

Article Title: Cloning, Expression and Purification of the SRCR domains of glycoprotein 340
Article Snippet: .. Using restriction enzymes KpnI and AgeI , the PCR products and the pMT/V5-HisA vector (Invitrogen), which is an inducible Drosophila expression system (DES) vector containing a C-terminal 6 ×His-tag and an incorporated ampicillin selection gene were digested and thereafter ligated at 1:1 molar ratio using T4 DNA ligase (New England Biolabs, Inc). .. The ligated products were purified and transformed into chemically competent E. coli DH5α cells (Invitrogen, Inc).

Article Title: Complex Formation and Interactions between Transcription Factors Essential for Human Prolactin Receptor Gene Transcription ▿
Article Snippet: .. Enhanced yellow fluorescent protein (EYFP) and renilla luciferase (Rluc) genes were PCR amplified using pEYFP-N1 (BD Biosciences) and pRL (Promega) as templates, respectively, and cloned into either XhoI and AgeI or KpnI and BamHI sites of pcDNA3.1-V5/HIS (Invitrogen) to generate pcDNA–YFP and pcDNA-Rluc. .. Bioluminescence resonance energy transfer (BRET) constructs of ERα-YFP, ERα-Rluc, C/EBPβ-YFP, C/EBPβ-Rluc, and Rluc-SP1 were generated by ligating the coding sequences of ERα and C/EBPβ into KpnI and BamHI sites of both pcDNA-YFP and pcDNA-Rluc and SP1 into XhoI and AgeI sites of pcDNA-Rluc.

Article Title: Alternative Transcripts and 3?UTR Elements Govern the Incorporation of Selenocysteine into Selenoprotein S
Article Snippet: The PCR product was digested and subcloned into the KpnI/SfuI sites of pcDNA3.1mycHISA (Invitrogen), generating SelSmycHIS. .. This was subsequently digested with SfuI and AgeI and ligated with the SfuI/AgeI insert from pcDNA3.1V5His (Invitrogen), which effectively switched the epitope tag from myc to V5.

Article Title: Effect of M-phase kinase phosphorylations on type 1 inositol 1,4,5-trisphosphate receptor-mediated Ca2+ responses in mouse eggs
Article Snippet: This DsRed fused sequence was amplified by PCR and subcloned into the pcDNA6/myc-His B vector by Dr. Cheon of the Fissore lab. .. Plasmids were linearized with AgeI and then transcribed from using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Article Title: Human APOBEC3 Proteins Can Inhibit Xenotropic Murine Leukemia Virus-Related Virus Infectivity
Article Snippet: Newly generated expression vectors include pTRIPZ-hA3G, which contains the full-length hA3G open reading frame inserted between the AgeI and MluI sites present in the Doxycycline-inducible lentiviral expression vector pTRIPZ (Open Biosystems). .. The PCR product was digested with EcoRI/NotI, and inserted into the pCAGGS expression vector.

Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
Article Snippet: The PCR-amplified library was then purified (Qiagen), digested with BbsI (New England Biolabs) at 37 °C overnight, and purified by electrophoresis on a 2% agarose gel and recovered using gel extraction kit (Qiagen). .. The vector backbone was digested with AgeI and EcoRI, treated with FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific), purified on a 1% agarose gel followed by gel extraction (Qiagen).

Article Title: Expression of recombinant Atlantic salmon serum C-type lectin in Drosophila melanogaster Schneider 2 cells
Article Snippet: The cDNA encoding SSL isoform 2 (GenBank Accession No. ) was amplified by PCR using the sense primer SSL_ BglII 5′-CGGG AGATCT ACAGGAGCTAAGG-3′ and the antisense primer SSL_ AgeI 5′-TGATG ACCGGT GTTTTTCTGGATTTCACAG-3′. .. The pCR4_SSL_ Drosophila vector was digested with BglII and AgeI and the 482-bp SSL cDNA fragment obtained was cloned between the same sites of pMT/Bip/V5-His A (Invitrogen), and confirmed by sequencing using MT_Forward 5′-CATCTCAGTGCAACTAAA-3′ and BGH_Reverse 5′-TAGAAGGCACAGTCGAGG-3′ primers.

Article Title: Role of Caspase-3 Cleaved IP3R1 on Ca2+ Homeostasis and Developmental Competence of Mouse Oocytes and Eggs
Article Snippet: For Venus construct, which encodes Venus fluorescence protein, Venus in PCs2 vector was used as a template ( ) and amplified using PCR flanked by HindIII and BamHI with Kozak sequence at the beginning and ligated into pcDNA6/myc-his B. .. Plasmids were linearized with AgeI and then transcribed using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Fluorescence:

Article Title: Role of Caspase-3 Cleaved IP3R1 on Ca2+ Homeostasis and Developmental Competence of Mouse Oocytes and Eggs
Article Snippet: For Venus construct, which encodes Venus fluorescence protein, Venus in PCs2 vector was used as a template ( ) and amplified using PCR flanked by HindIII and BamHI with Kozak sequence at the beginning and ligated into pcDNA6/myc-his B. .. Plasmids were linearized with AgeI and then transcribed using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Mutagenesis:

Article Title: Effect of M-phase kinase phosphorylations on type 1 inositol 1,4,5-trisphosphate receptor-mediated Ca2+ responses in mouse eggs
Article Snippet: Mutagenesis was carried out using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) according to the manufacture’s protocol. .. Plasmids were linearized with AgeI and then transcribed from using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Article Title: Screening for and Verification of Novel Mutations Associated with Drug Resistance in the HIV Type 1subtype B′ in China
Article Snippet: .. The primers used for amplification and site-directed mutagenesis were listed in .The targeted segments digested by the AgeI and SphI were subcloned into the plasmid pNL4-3, then the constructed plasmids were transfected into 293 T cells(at a density of 4×105 cells/ml) using Lipofectamine™ 2000 (Invitrogen) to obtain the virus. .. Transfection was conducted according to manufacturer's instructions (Lipofectamine™ 2000, Invitrogen).

Subcloning:

Article Title: Violacein as a genetically-controlled, enzymatically amplified and photobleaching-resistant chromophore for optoacoustic bacterial imaging
Article Snippet: Genetic reporter constructs and bacterial growth pVIO1-2 was created by Sánchez et al. , by isolating the vio locus (VioA-E) from genomic DNA of Chromobacterium violaceum (ATCC12472) as an 8.9 kb MluI-XhoI fragment and subcloning it into lac promoter driven LITMUS 38 with MluI and SalI. .. MelA from Rhizobium etli was amplified from pTrc MelA (kindly provided by Dr. Guillermo Gosset Lagarda) and subcloned into pmCherry with AgeI and NotI. pVIO1-2 (kindly provided by Dr. José A. Salas), pmCherry (kind gift from Dr. Arie Geerlof, Helmholtz Zentrum München), pMelA and pUC19 (control bacteria) were transformed into TOP10 Chemically Competent E. coli (Invitrogen Carlsbad, CA, USA) according to the protocol of the manufacturer.

Size-exclusion Chromatography:

Article Title: Alternative Transcripts and 3?UTR Elements Govern the Incorporation of Selenocysteine into Selenoprotein S
Article Snippet: This was subsequently digested with SfuI and AgeI and ligated with the SfuI/AgeI insert from pcDNA3.1V5His (Invitrogen), which effectively switched the epitope tag from myc to V5. .. Sec-V5-v2 WT contains the full-length 3′UTR, while Sec-V5-v2ΔStem removes the first 60 nucleotides of the 3′UTR.

Purification:

Article Title: Cloning, Expression and Purification of the SRCR domains of glycoprotein 340
Article Snippet: Using restriction enzymes KpnI and AgeI , the PCR products and the pMT/V5-HisA vector (Invitrogen), which is an inducible Drosophila expression system (DES) vector containing a C-terminal 6 ×His-tag and an incorporated ampicillin selection gene were digested and thereafter ligated at 1:1 molar ratio using T4 DNA ligase (New England Biolabs, Inc). .. The ligated products were purified and transformed into chemically competent E. coli DH5α cells (Invitrogen, Inc).

Article Title: Effect of M-phase kinase phosphorylations on type 1 inositol 1,4,5-trisphosphate receptor-mediated Ca2+ responses in mouse eggs
Article Snippet: Plasmids were linearized with AgeI and then transcribed from using the mMessage/mMachine T7 Kit (Ambion, Austin, TX). .. Poly A tail was added to the produced cRNA by Poly (A) Tailing kit (Ambion, Austin, TX) followed by purification using the MEGAclear Kit (Ambion, Austin, TX). cRNA was stored at −80°C in single-use aliquots.

Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
Article Snippet: .. The vector backbone was digested with AgeI and EcoRI, treated with FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific), purified on a 1% agarose gel followed by gel extraction (Qiagen). .. Ligation was performed using Quick Ligase kit (New England Biolabs).

Article Title: Role of Caspase-3 Cleaved IP3R1 on Ca2+ Homeostasis and Developmental Competence of Mouse Oocytes and Eggs
Article Snippet: Plasmids were linearized with AgeI and then transcribed using the mMessage/mMachine T7 Kit (Ambion, Austin, TX). .. Poly A tail was added to the produced cRNA by Poly (A) Tailing kit (Ambion, Austin, TX) followed by purification using the MEGAclear Kit (Ambion, Austin, TX). cRNA was stored at −80°C in single-use aliquots.

Sequencing:

Article Title: Caveolin 1 Inhibits HIV Replication by Transcriptional Repression Mediated through NF-?B ▿
Article Snippet: A green fluorescent protein (GFP)-expressing plasmid, pCMV-GFP, was constructed by cloning the cytomegalovirus (CMV) promoter into the AgeI and SspI sites of pEGFP.luc (Invitrogen, Carlsbad, CA). .. The plasmid pTatz, expressing HIV-1 Tat, was constructed by inserting the HIV-1 Tat coding sequence downstream from a CMV promoter ( ).

Article Title: Cloning, Expression and Purification of the SRCR domains of glycoprotein 340
Article Snippet: Using restriction enzymes KpnI and AgeI , the PCR products and the pMT/V5-HisA vector (Invitrogen), which is an inducible Drosophila expression system (DES) vector containing a C-terminal 6 ×His-tag and an incorporated ampicillin selection gene were digested and thereafter ligated at 1:1 molar ratio using T4 DNA ligase (New England Biolabs, Inc). .. Appropriate insertion of SRCR genes into the pMT/V5-HisA vector were verified by DNA sequencing (UAB Heflin sequencing center).

Article Title: Effect of M-phase kinase phosphorylations on type 1 inositol 1,4,5-trisphosphate receptor-mediated Ca2+ responses in mouse eggs
Article Snippet: This DsRed fused sequence was amplified by PCR and subcloned into the pcDNA6/myc-His B vector by Dr. Cheon of the Fissore lab. .. Plasmids were linearized with AgeI and then transcribed from using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Article Title: Expression of recombinant Atlantic salmon serum C-type lectin in Drosophila melanogaster Schneider 2 cells
Article Snippet: .. The pCR4_SSL_ Drosophila vector was digested with BglII and AgeI and the 482-bp SSL cDNA fragment obtained was cloned between the same sites of pMT/Bip/V5-His A (Invitrogen), and confirmed by sequencing using MT_Forward 5′-CATCTCAGTGCAACTAAA-3′ and BGH_Reverse 5′-TAGAAGGCACAGTCGAGG-3′ primers. .. The resulting expression vector, pMT/Bip_SSL, contains the sequences encoding the Drosophila N-terminal immunoglobulin-binding protein (BiP) signal sequence fused in-frame with SSL, and a C-terminal hexahistidine tag in tandem to produce an rSSL fusion protein.

Article Title: Role of Caspase-3 Cleaved IP3R1 on Ca2+ Homeostasis and Developmental Competence of Mouse Oocytes and Eggs
Article Snippet: For Venus construct, which encodes Venus fluorescence protein, Venus in PCs2 vector was used as a template ( ) and amplified using PCR flanked by HindIII and BamHI with Kozak sequence at the beginning and ligated into pcDNA6/myc-his B. .. Plasmids were linearized with AgeI and then transcribed using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Plasmid Preparation:

Article Title: Caveolin 1 Inhibits HIV Replication by Transcriptional Repression Mediated through NF-?B ▿
Article Snippet: .. A green fluorescent protein (GFP)-expressing plasmid, pCMV-GFP, was constructed by cloning the cytomegalovirus (CMV) promoter into the AgeI and SspI sites of pEGFP.luc (Invitrogen, Carlsbad, CA). .. Similarly, a plasmid expressing GFP under the control of the HIV LTR, pLTR-GFP, was generated by first performing PCR amplification of HIV-1 LTR sequences from pNL4-3 provirus and then cloning them into the ClaI and AgeI restriction enzyme sites of pEGFP.luc.

Article Title: Violacein as a genetically-controlled, enzymatically amplified and photobleaching-resistant chromophore for optoacoustic bacterial imaging
Article Snippet: MelA from Rhizobium etli was amplified from pTrc MelA (kindly provided by Dr. Guillermo Gosset Lagarda) and subcloned into pmCherry with AgeI and NotI. pVIO1-2 (kindly provided by Dr. José A. Salas), pmCherry (kind gift from Dr. Arie Geerlof, Helmholtz Zentrum München), pMelA and pUC19 (control bacteria) were transformed into TOP10 Chemically Competent E. coli (Invitrogen Carlsbad, CA, USA) according to the protocol of the manufacturer. .. Plasmid retention was tested in vitro and showed that the bacteria retain the plasmid without selection pressure for at least 7 days without any significant loss of violacein production.

Article Title: Cloning, Expression and Purification of the SRCR domains of glycoprotein 340
Article Snippet: .. Using restriction enzymes KpnI and AgeI , the PCR products and the pMT/V5-HisA vector (Invitrogen), which is an inducible Drosophila expression system (DES) vector containing a C-terminal 6 ×His-tag and an incorporated ampicillin selection gene were digested and thereafter ligated at 1:1 molar ratio using T4 DNA ligase (New England Biolabs, Inc). .. The ligated products were purified and transformed into chemically competent E. coli DH5α cells (Invitrogen, Inc).

Article Title: Effect of M-phase kinase phosphorylations on type 1 inositol 1,4,5-trisphosphate receptor-mediated Ca2+ responses in mouse eggs
Article Snippet: This DsRed fused sequence was amplified by PCR and subcloned into the pcDNA6/myc-His B vector by Dr. Cheon of the Fissore lab. .. Plasmids were linearized with AgeI and then transcribed from using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Article Title: Human APOBEC3 Proteins Can Inhibit Xenotropic Murine Leukemia Virus-Related Virus Infectivity
Article Snippet: .. Newly generated expression vectors include pTRIPZ-hA3G, which contains the full-length hA3G open reading frame inserted between the AgeI and MluI sites present in the Doxycycline-inducible lentiviral expression vector pTRIPZ (Open Biosystems). .. Also novel are expression vectors for the XMRV gag/pol and env genes.

Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
Article Snippet: .. The vector backbone was digested with AgeI and EcoRI, treated with FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific), purified on a 1% agarose gel followed by gel extraction (Qiagen). .. Ligation was performed using Quick Ligase kit (New England Biolabs).

Article Title: Screening for and Verification of Novel Mutations Associated with Drug Resistance in the HIV Type 1subtype B′ in China
Article Snippet: .. The primers used for amplification and site-directed mutagenesis were listed in .The targeted segments digested by the AgeI and SphI were subcloned into the plasmid pNL4-3, then the constructed plasmids were transfected into 293 T cells(at a density of 4×105 cells/ml) using Lipofectamine™ 2000 (Invitrogen) to obtain the virus. .. Transfection was conducted according to manufacturer's instructions (Lipofectamine™ 2000, Invitrogen).

Article Title: Role of Caspase-3 Cleaved IP3R1 on Ca2+ Homeostasis and Developmental Competence of Mouse Oocytes and Eggs
Article Snippet: For Venus construct, which encodes Venus fluorescence protein, Venus in PCs2 vector was used as a template ( ) and amplified using PCR flanked by HindIII and BamHI with Kozak sequence at the beginning and ligated into pcDNA6/myc-his B. .. Plasmids were linearized with AgeI and then transcribed using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Selection:

Article Title: Violacein as a genetically-controlled, enzymatically amplified and photobleaching-resistant chromophore for optoacoustic bacterial imaging
Article Snippet: MelA from Rhizobium etli was amplified from pTrc MelA (kindly provided by Dr. Guillermo Gosset Lagarda) and subcloned into pmCherry with AgeI and NotI. pVIO1-2 (kindly provided by Dr. José A. Salas), pmCherry (kind gift from Dr. Arie Geerlof, Helmholtz Zentrum München), pMelA and pUC19 (control bacteria) were transformed into TOP10 Chemically Competent E. coli (Invitrogen Carlsbad, CA, USA) according to the protocol of the manufacturer. .. Plasmid retention was tested in vitro and showed that the bacteria retain the plasmid without selection pressure for at least 7 days without any significant loss of violacein production.

Article Title: Cloning, Expression and Purification of the SRCR domains of glycoprotein 340
Article Snippet: .. Using restriction enzymes KpnI and AgeI , the PCR products and the pMT/V5-HisA vector (Invitrogen), which is an inducible Drosophila expression system (DES) vector containing a C-terminal 6 ×His-tag and an incorporated ampicillin selection gene were digested and thereafter ligated at 1:1 molar ratio using T4 DNA ligase (New England Biolabs, Inc). .. The ligated products were purified and transformed into chemically competent E. coli DH5α cells (Invitrogen, Inc).

Agarose Gel Electrophoresis:

Article Title: Cloning, Expression and Purification of the SRCR domains of glycoprotein 340
Article Snippet: PCR products obtained from these reactions run over a DNA agarose gel indicated the presence of ~339 base pair (bp) and ~1125 bp bands, which corresponded to the SRCR1 and SRCR123 domains respectively. .. Using restriction enzymes KpnI and AgeI , the PCR products and the pMT/V5-HisA vector (Invitrogen), which is an inducible Drosophila expression system (DES) vector containing a C-terminal 6 ×His-tag and an incorporated ampicillin selection gene were digested and thereafter ligated at 1:1 molar ratio using T4 DNA ligase (New England Biolabs, Inc).

Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
Article Snippet: .. The vector backbone was digested with AgeI and EcoRI, treated with FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific), purified on a 1% agarose gel followed by gel extraction (Qiagen). .. Ligation was performed using Quick Ligase kit (New England Biolabs).

In Vitro:

Article Title: Violacein as a genetically-controlled, enzymatically amplified and photobleaching-resistant chromophore for optoacoustic bacterial imaging
Article Snippet: MelA from Rhizobium etli was amplified from pTrc MelA (kindly provided by Dr. Guillermo Gosset Lagarda) and subcloned into pmCherry with AgeI and NotI. pVIO1-2 (kindly provided by Dr. José A. Salas), pmCherry (kind gift from Dr. Arie Geerlof, Helmholtz Zentrum München), pMelA and pUC19 (control bacteria) were transformed into TOP10 Chemically Competent E. coli (Invitrogen Carlsbad, CA, USA) according to the protocol of the manufacturer. .. Plasmid retention was tested in vitro and showed that the bacteria retain the plasmid without selection pressure for at least 7 days without any significant loss of violacein production.

Article Title: Alternative Transcripts and 3?UTR Elements Govern the Incorporation of Selenocysteine into Selenoprotein S
Article Snippet: The SelS constructs with V5 epitope tags used for in vitro translation/immunoprecipitation were generated by PCR amplifying the ORF of SelS without the stop codon using the common forward primer listed above and the SelS minus stop reverse primer 5′ CACTTCGAAGCCTCATCCGCCAGATGA . .. This was subsequently digested with SfuI and AgeI and ligated with the SfuI/AgeI insert from pcDNA3.1V5His (Invitrogen), which effectively switched the epitope tag from myc to V5.

Article Title: Effect of M-phase kinase phosphorylations on type 1 inositol 1,4,5-trisphosphate receptor-mediated Ca2+ responses in mouse eggs
Article Snippet: After the sequences were confirmed (Genewiz, Cambridge, MA), the constructs were used for in vitro cRNA synthesis. .. Plasmids were linearized with AgeI and then transcribed from using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Article Title: The Role of 14-3-3? Interaction with Phosphorylated Cdc25B at Its Ser321 in the Release of the Mouse Oocyte from Prophase I Arrest
Article Snippet: .. In Vitro Transcription As described in our previous report , all pcDNA3.1-Myc constructs were linearized with AgeI. pcDNA3.1-ZEO-HA-14-3-3ε was linearized with XbaI and transcribed in vitro into 5′-capped mRNA for microinjection using a mMESSAGE mMACHINE kit (Ambion). .. Microinjection and Morphological Analysis Various Cdc25B mRNAs or plasmids and HA-Tagged 14-3-3ε mRNA or plasmids were microinjected into the cytoplasm or nucleus of GV-Stage oocytes using a micropipette and Eppendorf manipulators mounted on an Olympus inverted microscope, as in our previous report .

Article Title: Role of Caspase-3 Cleaved IP3R1 on Ca2+ Homeostasis and Developmental Competence of Mouse Oocytes and Eggs
Article Snippet: After the sequences were confirmed (Genewiz, Cambridge, MA), the constructs were used for in vitro cRNA synthesis. .. Plasmids were linearized with AgeI and then transcribed using the mMessage/mMachine T7 Kit (Ambion, Austin, TX).

Bioluminescence Resonance Energy Transfer:

Article Title: Complex Formation and Interactions between Transcription Factors Essential for Human Prolactin Receptor Gene Transcription ▿
Article Snippet: Paragraph title: BRET and BiLC assays. ... Enhanced yellow fluorescent protein (EYFP) and renilla luciferase (Rluc) genes were PCR amplified using pEYFP-N1 (BD Biosciences) and pRL (Promega) as templates, respectively, and cloned into either XhoI and AgeI or KpnI and BamHI sites of pcDNA3.1-V5/HIS (Invitrogen) to generate pcDNA–YFP and pcDNA-Rluc.

Produced:

Article Title: Effect of M-phase kinase phosphorylations on type 1 inositol 1,4,5-trisphosphate receptor-mediated Ca2+ responses in mouse eggs
Article Snippet: Plasmids were linearized with AgeI and then transcribed from using the mMessage/mMachine T7 Kit (Ambion, Austin, TX). .. Poly A tail was added to the produced cRNA by Poly (A) Tailing kit (Ambion, Austin, TX) followed by purification using the MEGAclear Kit (Ambion, Austin, TX). cRNA was stored at −80°C in single-use aliquots.

Article Title: Role of Caspase-3 Cleaved IP3R1 on Ca2+ Homeostasis and Developmental Competence of Mouse Oocytes and Eggs
Article Snippet: Plasmids were linearized with AgeI and then transcribed using the mMessage/mMachine T7 Kit (Ambion, Austin, TX). .. Poly A tail was added to the produced cRNA by Poly (A) Tailing kit (Ambion, Austin, TX) followed by purification using the MEGAclear Kit (Ambion, Austin, TX). cRNA was stored at −80°C in single-use aliquots.

Concentration Assay:

Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
Article Snippet: The custom oligonucleotide library was reconstituted in water to a final concentration of 0.01 pmol/µL and PCR-amplified using Q5 Hot Start Polymerase (New England Biolabs). .. The vector backbone was digested with AgeI and EcoRI, treated with FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific), purified on a 1% agarose gel followed by gel extraction (Qiagen).

Gel Extraction:

Article Title: SIRT6 haploinsufficiency induces BRAFV600E melanoma cell resistance to MAPK inhibitors via IGF signalling
Article Snippet: .. The vector backbone was digested with AgeI and EcoRI, treated with FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific), purified on a 1% agarose gel followed by gel extraction (Qiagen). .. Ligation was performed using Quick Ligase kit (New England Biolabs).

Variant Assay:

Article Title: Alternative Transcripts and 3?UTR Elements Govern the Incorporation of Selenocysteine into Selenoprotein S
Article Snippet: All of the other luciferase constructs are derived from the SelS variant 2 mRNA. .. This was subsequently digested with SfuI and AgeI and ligated with the SfuI/AgeI insert from pcDNA3.1V5His (Invitrogen), which effectively switched the epitope tag from myc to V5.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Thermo Fisher restriction enzymes agei
    Restriction Enzymes Agei, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzymes agei/product/Thermo Fisher
    Average 95 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    restriction enzymes agei - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    93
    Thermo Fisher agei recognition site
    Agei Recognition Site, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agei recognition site/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    agei recognition site - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    93
    Thermo Fisher agei mlui fragment
    Agei Mlui Fragment, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agei mlui fragment/product/Thermo Fisher
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    agei mlui fragment - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    Image Search Results