Structured Review

TaKaRa agei
Agei, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/agei/product/TaKaRa
Average 93 stars, based on 11 article reviews
Price from $9.99 to $1999.99
agei - by Bioz Stars, 2020-10
93/100 stars

Images

Related Articles

Clone Assay:

Article Title: RAD51 paralogs promote homology-directed repair at diversifying immunoglobulin V regions
Article Snippet: .. PCR products were cloned into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA), excised with BglII and AgeI, and subcloned into the pEGFP-N1 vector (Clontech, Mountain View, CA) to generate pRAD51D-GFP and pRAD51D, respectively. .. XRCC2 cDNA was similarly amplified with the forward primer 5'-CACCATGTGTAGTGCCTTCCATAGGGCTGAGTCT-3' and the reverse primer 5'-TCAACAAAATTCAACCCCACTTTCTCC-3' containing an in-frame stop codon and cloned into the pcDNA3.1/V5-His-D-TOPO vector (Invitrogen, Carlsbad, CA) to generate pXRCC2; or cDNA amplified with the primers 5'-AAAAAGGTACCGATGTGTAGTGCCTTCCATAGGGC-3' and 5'AAAAAACCGGTCCAC-AAAATTCAACCCCACTTTCTC-3', excised with KpnI and AgeI, and cloned into the pEGFP-N1 vector to generate pXRCC2-GFP.

Article Title: Thyroid peroxidase forms thionamide-sensitive homodimers: relevance for immunomodulation of thyroid autoimmunity
Article Snippet: .. Cloning eGFP/FLAG-TPO Oligonucleotide primers were designed to flank and overlap the 3′ and 5′ ends of TPO cDNA, previously cloned into pcDNA3.1 (gift of Dr. B Rapoport, LA [ ]), and introduced a G to C base change into the stop codon to allow read-through to C-terminally tagged fusion protein, as well as XbaI and EcoRI sites for subsequent in-frame cloning into pCMV14-3xFLAG vector (Sigma) or AgeI and EcoRI for pEGFP-N1 (Clontech). .. The full-length cDNA was polymerase chain reaction (PCR)-amplified using high-fidelity Phusion polymerase (NEB, Beverly, MA, USA).

Article Title: CADM1 is expressed as multiple alternatively spliced functional and dysfunctional isoforms in human mast cells
Article Snippet: .. The cDNAs of SP4, SP1 and SP6 were re-amplified using oligonucleotides 5′ttcgaattcgacATGGCGAGTGTAGTGCTG and 5′ctcaccggtgAGATGAAGTACTCTTTCTTTTCTTC, cleaved with the restriction enzymes EcoRI and AgeI and cloned in frame into EcoRI–AgeI-cleaved pEGFP-N1 plasmid (Clontech, Takara Bio Europe, Saint-Germain-en-Laye, France) to express CADM1-EGFP-fusion proteins. .. Plasmids were isolated and sequenced to verify correct PCR amplification and cloning.

Amplification:

Article Title: The Prrx1 homeodomain transcription factor plays a central role in pancreatic regeneration and carcinogenesis
Article Snippet: .. Following PCR amplification, coding sequences were digested using XhoI and EcoRI or AgeI and MluI, respectively, and subcloned into pIRES2-EGFP (Clonetech) and pTRIPZ (RHS4743; Open Biosystems). ..

Construct:

Article Title: Ubiquitination switches EphA2 vesicular traffic from a continuous safeguard to a finite signalling mode
Article Snippet: .. Molecular biology All C-terminally tagged EphA2 constructs were generated by inserting human, full-length EphA2 (gift from T. Pawson) between AgeI and KpnI restriction sites of: mCitrine-N1, mCherry-N1 (Clontech); Tagbfp-N1 (Evrogen) or paGFP-N1 (gift from J. Lippincott-Schwartz, NIH). .. All FP used in this study carried the A206K mutation that renders them monomeric.

Sequencing:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: .. Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech). .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Generated:

Article Title: Ubiquitination switches EphA2 vesicular traffic from a continuous safeguard to a finite signalling mode
Article Snippet: .. Molecular biology All C-terminally tagged EphA2 constructs were generated by inserting human, full-length EphA2 (gift from T. Pawson) between AgeI and KpnI restriction sites of: mCitrine-N1, mCherry-N1 (Clontech); Tagbfp-N1 (Evrogen) or paGFP-N1 (gift from J. Lippincott-Schwartz, NIH). .. All FP used in this study carried the A206K mutation that renders them monomeric.

Expressing:

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: .. The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus. .. For Yes1, the PCR product was cut with NheI and KpnI and subcloned into the mCherry-N1 vector.

Polymerase Chain Reaction:

Article Title: The Prrx1 homeodomain transcription factor plays a central role in pancreatic regeneration and carcinogenesis
Article Snippet: .. Following PCR amplification, coding sequences were digested using XhoI and EcoRI or AgeI and MluI, respectively, and subcloned into pIRES2-EGFP (Clonetech) and pTRIPZ (RHS4743; Open Biosystems). ..

Article Title: BRCA2 Is Ubiquitinated In Vivo and Interacts with USP11, a Deubiquitinating Enzyme That Exhibits Prosurvival Function in the Cellular Response to DNA Damage
Article Snippet: .. The resulting PCR fragment was digested with AgeI and KpnI and ligated into the cognate sites of similarly digested pEGFP-C1 (Clontech). .. The Flag-GFP-BRCA2(2281-3418) construct was created by PCR amplification of the BRCA2 sequence (amino acids 2281 to 3418) with the primers GCGCGGTACC GCGGCCGC CATGGGAGAACCCTCAATCAAAAGAAAC (the NotI site is underlined) and CCCGGG CTCGAG TTAGATATATTTTTTAGTTGTAATTGTGTCC (the XhoI site is underlined).

Article Title: RAD51 paralogs promote homology-directed repair at diversifying immunoglobulin V regions
Article Snippet: .. PCR products were cloned into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA), excised with BglII and AgeI, and subcloned into the pEGFP-N1 vector (Clontech, Mountain View, CA) to generate pRAD51D-GFP and pRAD51D, respectively. .. XRCC2 cDNA was similarly amplified with the forward primer 5'-CACCATGTGTAGTGCCTTCCATAGGGCTGAGTCT-3' and the reverse primer 5'-TCAACAAAATTCAACCCCACTTTCTCC-3' containing an in-frame stop codon and cloned into the pcDNA3.1/V5-His-D-TOPO vector (Invitrogen, Carlsbad, CA) to generate pXRCC2; or cDNA amplified with the primers 5'-AAAAAGGTACCGATGTGTAGTGCCTTCCATAGGGC-3' and 5'AAAAAACCGGTCCAC-AAAATTCAACCCCACTTTCTC-3', excised with KpnI and AgeI, and cloned into the pEGFP-N1 vector to generate pXRCC2-GFP.

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: .. The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus. .. For Yes1, the PCR product was cut with NheI and KpnI and subcloned into the mCherry-N1 vector.

Plasmid Preparation:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: .. Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech). .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: RAD51 paralogs promote homology-directed repair at diversifying immunoglobulin V regions
Article Snippet: .. PCR products were cloned into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA), excised with BglII and AgeI, and subcloned into the pEGFP-N1 vector (Clontech, Mountain View, CA) to generate pRAD51D-GFP and pRAD51D, respectively. .. XRCC2 cDNA was similarly amplified with the forward primer 5'-CACCATGTGTAGTGCCTTCCATAGGGCTGAGTCT-3' and the reverse primer 5'-TCAACAAAATTCAACCCCACTTTCTCC-3' containing an in-frame stop codon and cloned into the pcDNA3.1/V5-His-D-TOPO vector (Invitrogen, Carlsbad, CA) to generate pXRCC2; or cDNA amplified with the primers 5'-AAAAAGGTACCGATGTGTAGTGCCTTCCATAGGGC-3' and 5'AAAAAACCGGTCCAC-AAAATTCAACCCCACTTTCTC-3', excised with KpnI and AgeI, and cloned into the pEGFP-N1 vector to generate pXRCC2-GFP.

Article Title: Thyroid peroxidase forms thionamide-sensitive homodimers: relevance for immunomodulation of thyroid autoimmunity
Article Snippet: .. Cloning eGFP/FLAG-TPO Oligonucleotide primers were designed to flank and overlap the 3′ and 5′ ends of TPO cDNA, previously cloned into pcDNA3.1 (gift of Dr. B Rapoport, LA [ ]), and introduced a G to C base change into the stop codon to allow read-through to C-terminally tagged fusion protein, as well as XbaI and EcoRI sites for subsequent in-frame cloning into pCMV14-3xFLAG vector (Sigma) or AgeI and EcoRI for pEGFP-N1 (Clontech). .. The full-length cDNA was polymerase chain reaction (PCR)-amplified using high-fidelity Phusion polymerase (NEB, Beverly, MA, USA).

Article Title: CADM1 is expressed as multiple alternatively spliced functional and dysfunctional isoforms in human mast cells
Article Snippet: .. The cDNAs of SP4, SP1 and SP6 were re-amplified using oligonucleotides 5′ttcgaattcgacATGGCGAGTGTAGTGCTG and 5′ctcaccggtgAGATGAAGTACTCTTTCTTTTCTTC, cleaved with the restriction enzymes EcoRI and AgeI and cloned in frame into EcoRI–AgeI-cleaved pEGFP-N1 plasmid (Clontech, Takara Bio Europe, Saint-Germain-en-Laye, France) to express CADM1-EGFP-fusion proteins. .. Plasmids were isolated and sequenced to verify correct PCR amplification and cloning.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • agei  (TaKaRa)
    93
    TaKaRa agei
    Agei, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agei/product/TaKaRa
    Average 93 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    agei - by Bioz Stars, 2020-10
    93/100 stars
      Buy from Supplier

    85
    TaKaRa agei stui fragment
    Agei Stui Fragment, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agei stui fragment/product/TaKaRa
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    agei stui fragment - by Bioz Stars, 2020-10
    85/100 stars
      Buy from Supplier

    Image Search Results