Structured Review

TaKaRa agei
Agei, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/agei/product/TaKaRa
Average 99 stars, based on 4 article reviews
Price from $9.99 to $1999.99
agei - by Bioz Stars, 2020-02
99/100 stars

Images

Related Articles

Transduction:

Article Title: The Prrx1 homeodomain transcription factor plays a central role in pancreatic regeneration and carcinogenesis
Article Snippet: Paragraph title: RNAi transfection, lentiviral transduction, and vector constructs ... Following PCR amplification, coding sequences were digested using XhoI and EcoRI or AgeI and MluI, respectively, and subcloned into pIRES2-EGFP (Clonetech) and pTRIPZ (RHS4743; Open Biosystems).

Clone Assay:

Article Title: Determination of tumor necrosis factor receptor-associated factor trimerization in living cells by CFP- > YFP- > mRFP FRET detected by flow cytometry
Article Snippet: Plasmid construction CFP-TRAF2 and YFP-TRAF2 plasmids were described previously ( ). mRFP-TRAF2 was prepared by inserting the TRAF2 fragment directly into the BglII and HindIII sites of mRFP-C1 vector, which was prepared by a standard PCR technique using mRFP as a template and primers 5′-GCG CTA CCG GTC GCC ACC ATG GCC TCC TCC GAG GAC GTC-3′ and 5′-CGC TCC GGA GGC GCC GGT GGA GTG GCG-3′ into the AgeI and BspEI sites of pEYFP-C1 (Clontech, Palo Alto, CA). .. In order to make CFP-YFP-mRFP and CFP-TRAF2TD-YFP-mRFP constructs, the mRFP fragment that was amplified by PCR using mRFP-C1 as a template and a pair of primers (the forward primer mRFP-HindIII 5′-GCT CAA GCT TCG ATG GCC TCC TCC GAG GAC GTC-3′and the reverse primer mRFP-KpnI 5′-CGC GGT ACC TTA GGC GCC GGT GGA GTG GCG-3′) was digested with HindIII and KpnI first and then directly cloned into the same sites of the CFP-YFP and CFP-TRAF2TD-YFP fusion constructs, respectively.

Article Title: Multi-OMICS analyses unveil STAT1 as a potential modifier gene in mevalonate kinase deficiency
Article Snippet: .. It was then cloned into AgeI and PacI sites of pQCXIP (Clontech, Mountain View, California, USA). .. The mutated form (p.R241Q) was generated with the QuikChange Site-Directed Mutagenesis kit using the forward 5’-agtggagtggaagcagagacagagcg-3’ and reverse 5’-cgctctgctgtctctgcttccactccact-3’ primers, following manufacturer’s recommendations (Stratagene, San Diego, California, USA).

Article Title: Activation of the KEAP1-NRF2-ARE signaling pathway reduces oxidative stress in Hep2 cells
Article Snippet: .. Pairs of complementary oligonucleotides with these sequences were synthesized, annealed and cloned into the lentiviral plasmid vector [pLKD-CMV-G & PR-U6-short hairpin (sh)RNA] (Obio Technology, Ltd., Shanghai, China) using the AgeI and EcoRI enzymes (Takara Bio, Inc., Otsu, Japan). .. The recombinant plasmid vectors (32 µg) containing shRNA were co-transfected into 293T cells along with the helper plasmids psPAX2 and pHCMV-VSV-G (Takara Bio, Inc.) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.).

Article Title: Limited Transferrin Receptor Clustering Allows Rapid Diffusion of Canine Parvovirus into Clathrin Endocytic Structures
Article Snippet: The expression plasmids encoding fTfR-eGFP and fTfR-mCherry were generated as follows: (i) the wt feline TfR gene was PCR amplified from an existing pcDNA3.1(−) expression vector ( ) using primers that contained restriction enzyme recognition sites for EcoRI (forward primer, 5′-GTCAGAATTCATGATGGATCAAGCCAGATC-3′) or AgeI (reverse primer, 5′-GACTACCGGTGGATCCCCAAACTCATTGTCAATATCCCAAATGTC-3′); (ii) the PCR product and peGFP-N1 (Clonetech Laboratories, Inc., Mountain View, CA) or an otherwise identical plasmid encoding mCherry in place of eGFP was digested with EcoRI and AgeI, and the cleaved DNA fragments were ligated to generate pfTfR-eGFP. .. This cloning strategy introduced a 7-amino-acid linker (GDPPVAT) between the TfR and the fluorescent protein open reading frames.

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: To generate fusion vectors, the appropriate cloning vector and an EGFP fusion vector were digested, either sequentially or doubly, with the appropriate enzymes and ligated together after gel purification. .. Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech).

Article Title: RAD51 paralogs promote homology-directed repair at diversifying immunoglobulin V regions
Article Snippet: .. PCR products were cloned into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA), excised with BglII and AgeI, and subcloned into the pEGFP-N1 vector (Clontech, Mountain View, CA) to generate pRAD51D-GFP and pRAD51D, respectively. .. XRCC2 cDNA was similarly amplified with the forward primer 5'-CACCATGTGTAGTGCCTTCCATAGGGCTGAGTCT-3' and the reverse primer 5'-TCAACAAAATTCAACCCCACTTTCTCC-3' containing an in-frame stop codon and cloned into the pcDNA3.1/V5-His-D-TOPO vector (Invitrogen, Carlsbad, CA) to generate pXRCC2; or cDNA amplified with the primers 5'-AAAAAGGTACCGATGTGTAGTGCCTTCCATAGGGC-3' and 5'AAAAAACCGGTCCAC-AAAATTCAACCCCACTTTCTC-3', excised with KpnI and AgeI, and cloned into the pEGFP-N1 vector to generate pXRCC2-GFP.

Article Title: The Ecto-enzyme CD38 Is a Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP) Synthase That Couples Receptor Activation to Ca2+ Mobilization from Lysosomes in Pancreatic Acinar Cells *
Article Snippet: .. The PCR product is digested with AgeI and NotI at the appropriate digestion sites, purified, and ligated into the mammalian expression vector pEGFP-N1 (Clontech, Palo Alto, CA), which contains EGFP downstream of its multiple cloning sites. ..

Article Title: Thyroid peroxidase forms thionamide-sensitive homodimers: relevance for immunomodulation of thyroid autoimmunity
Article Snippet: .. Cloning eGFP/FLAG-TPO Oligonucleotide primers were designed to flank and overlap the 3′ and 5′ ends of TPO cDNA, previously cloned into pcDNA3.1 (gift of Dr. B Rapoport, LA [ ]), and introduced a G to C base change into the stop codon to allow read-through to C-terminally tagged fusion protein, as well as XbaI and EcoRI sites for subsequent in-frame cloning into pCMV14-3xFLAG vector (Sigma) or AgeI and EcoRI for pEGFP-N1 (Clontech). .. The full-length cDNA was polymerase chain reaction (PCR)-amplified using high-fidelity Phusion polymerase (NEB, Beverly, MA, USA).

Article Title: CADM1 is expressed as multiple alternatively spliced functional and dysfunctional isoforms in human mast cells
Article Snippet: .. The cDNAs of SP4, SP1 and SP6 were re-amplified using oligonucleotides 5′ttcgaattcgacATGGCGAGTGTAGTGCTG and 5′ctcaccggtgAGATGAAGTACTCTTTCTTTTCTTC, cleaved with the restriction enzymes EcoRI and AgeI and cloned in frame into EcoRI–AgeI-cleaved pEGFP-N1 plasmid (Clontech, Takara Bio Europe, Saint-Germain-en-Laye, France) to express CADM1-EGFP-fusion proteins. .. Plasmids were isolated and sequenced to verify correct PCR amplification and cloning.

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: Yes1 construct was made by PCR amplification from the cDNA clones using primers that introduced an NheI restriction site on the 5′ end and removed the stop codon followed by a KpnI site on the 3′ end of the amplified cDNA fragment. .. The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus.

Amplification:

Article Title: Determination of tumor necrosis factor receptor-associated factor trimerization in living cells by CFP- > YFP- > mRFP FRET detected by flow cytometry
Article Snippet: Plasmid construction CFP-TRAF2 and YFP-TRAF2 plasmids were described previously ( ). mRFP-TRAF2 was prepared by inserting the TRAF2 fragment directly into the BglII and HindIII sites of mRFP-C1 vector, which was prepared by a standard PCR technique using mRFP as a template and primers 5′-GCG CTA CCG GTC GCC ACC ATG GCC TCC TCC GAG GAC GTC-3′ and 5′-CGC TCC GGA GGC GCC GGT GGA GTG GCG-3′ into the AgeI and BspEI sites of pEYFP-C1 (Clontech, Palo Alto, CA). .. In order to make CFP-YFP-mRFP and CFP-TRAF2TD-YFP-mRFP constructs, the mRFP fragment that was amplified by PCR using mRFP-C1 as a template and a pair of primers (the forward primer mRFP-HindIII 5′-GCT CAA GCT TCG ATG GCC TCC TCC GAG GAC GTC-3′and the reverse primer mRFP-KpnI 5′-CGC GGT ACC TTA GGC GCC GGT GGA GTG GCG-3′) was digested with HindIII and KpnI first and then directly cloned into the same sites of the CFP-YFP and CFP-TRAF2TD-YFP fusion constructs, respectively.

Article Title: Limited Transferrin Receptor Clustering Allows Rapid Diffusion of Canine Parvovirus into Clathrin Endocytic Structures
Article Snippet: .. The expression plasmids encoding fTfR-eGFP and fTfR-mCherry were generated as follows: (i) the wt feline TfR gene was PCR amplified from an existing pcDNA3.1(−) expression vector ( ) using primers that contained restriction enzyme recognition sites for EcoRI (forward primer, 5′-GTCAGAATTCATGATGGATCAAGCCAGATC-3′) or AgeI (reverse primer, 5′-GACTACCGGTGGATCCCCAAACTCATTGTCAATATCCCAAATGTC-3′); (ii) the PCR product and peGFP-N1 (Clonetech Laboratories, Inc., Mountain View, CA) or an otherwise identical plasmid encoding mCherry in place of eGFP was digested with EcoRI and AgeI, and the cleaved DNA fragments were ligated to generate pfTfR-eGFP. .. This cloning strategy introduced a 7-amino-acid linker (GDPPVAT) between the TfR and the fluorescent protein open reading frames.

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: The FPs were amplified with a 5' primer encoding an AgeI site and a 3' primer encoding either a BspEI (C1) or Not1 (N1) site. .. Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech).

Article Title: The Prrx1 homeodomain transcription factor plays a central role in pancreatic regeneration and carcinogenesis
Article Snippet: .. Following PCR amplification, coding sequences were digested using XhoI and EcoRI or AgeI and MluI, respectively, and subcloned into pIRES2-EGFP (Clonetech) and pTRIPZ (RHS4743; Open Biosystems). ..

Article Title: Genetically encoded calcium indicator illuminates calcium dynamics within primary cilia
Article Snippet: .. DNA encoding 5HT6 flanked by AgeI was amplified by PCR primers (5′-ctactgaccggtcgccaccatggttccagagcccggccctgtcaacag and 5′-gctgacaccggtcctcctgcgctaccaccagcactgttcatgggggaaccaagtgg) from 5HT6 -GFP19 (a gift from Akiko Seki and Tobias Meyer) in the Clontech pEGFP-N3 vector and then subcloned into a GFP-CTS2020 (a gift from Gregory Pazour) in the Clontech pEGFP-C2 vector at the AgeI site. ..

Article Title: BRCA2 Is Ubiquitinated In Vivo and Interacts with USP11, a Deubiquitinating Enzyme That Exhibits Prosurvival Function in the Cellular Response to DNA Damage
Article Snippet: A Flag-green fluorescent protein (GFP) plasmid was created by PCR amplification of the GFP sequence with the primers GCGCGGT ACCGGT CGCCACC ATGGACTACAAGGACGACGATGACAAG ATGGTGAGCAAGGGCGAGGAGCTG (the AgeI site is underlined; the Flag sequence is in italic type) and CCCGGG GGTACC G GCGGCCGC TCCGGACTTGTACAGCTCGTCCATGC (the underlined sequences are KpnI and NotI sites, respectively). .. The resulting PCR fragment was digested with AgeI and KpnI and ligated into the cognate sites of similarly digested pEGFP-C1 (Clontech).

Article Title: RAD51 paralogs promote homology-directed repair at diversifying immunoglobulin V regions
Article Snippet: Following reverse transcription with the ProtoScript first strand cDNA synthesis kit (New England BioLabs, Ipswich, MA), RAD51D cDNA was amplified with the forward primer 5'-TAAGATCTACCATGGGCGTGCTCAGGGTC-3' and the reverse primers 5'-ATACCGGTGGTCATGTCTGATCACCCTG-3' or 5'-ATACCGGTGGTGTCTGATCACCCTGTAA-3', which carries an in-frame stop codon. .. PCR products were cloned into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA), excised with BglII and AgeI, and subcloned into the pEGFP-N1 vector (Clontech, Mountain View, CA) to generate pRAD51D-GFP and pRAD51D, respectively.

Article Title: CADM1 is expressed as multiple alternatively spliced functional and dysfunctional isoforms in human mast cells
Article Snippet: The cDNAs of SP4, SP1 and SP6 were re-amplified using oligonucleotides 5′ttcgaattcgacATGGCGAGTGTAGTGCTG and 5′ctcaccggtgAGATGAAGTACTCTTTCTTTTCTTC, cleaved with the restriction enzymes EcoRI and AgeI and cloned in frame into EcoRI–AgeI-cleaved pEGFP-N1 plasmid (Clontech, Takara Bio Europe, Saint-Germain-en-Laye, France) to express CADM1-EGFP-fusion proteins. .. Plasmids were isolated and sequenced to verify correct PCR amplification and cloning.

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: Yes1 construct was made by PCR amplification from the cDNA clones using primers that introduced an NheI restriction site on the 5′ end and removed the stop codon followed by a KpnI site on the 3′ end of the amplified cDNA fragment. .. The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus.

Synthesized:

Article Title: Activation of the KEAP1-NRF2-ARE signaling pathway reduces oxidative stress in Hep2 cells
Article Snippet: .. Pairs of complementary oligonucleotides with these sequences were synthesized, annealed and cloned into the lentiviral plasmid vector [pLKD-CMV-G & PR-U6-short hairpin (sh)RNA] (Obio Technology, Ltd., Shanghai, China) using the AgeI and EcoRI enzymes (Takara Bio, Inc., Otsu, Japan). .. The recombinant plasmid vectors (32 µg) containing shRNA were co-transfected into 293T cells along with the helper plasmids psPAX2 and pHCMV-VSV-G (Takara Bio, Inc.) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.).

Construct:

Article Title: Determination of tumor necrosis factor receptor-associated factor trimerization in living cells by CFP- > YFP- > mRFP FRET detected by flow cytometry
Article Snippet: Plasmid construction CFP-TRAF2 and YFP-TRAF2 plasmids were described previously ( ). mRFP-TRAF2 was prepared by inserting the TRAF2 fragment directly into the BglII and HindIII sites of mRFP-C1 vector, which was prepared by a standard PCR technique using mRFP as a template and primers 5′-GCG CTA CCG GTC GCC ACC ATG GCC TCC TCC GAG GAC GTC-3′ and 5′-CGC TCC GGA GGC GCC GGT GGA GTG GCG-3′ into the AgeI and BspEI sites of pEYFP-C1 (Clontech, Palo Alto, CA). .. In order to make CFP-YFP-mRFP and CFP-TRAF2TD-YFP-mRFP constructs, the mRFP fragment that was amplified by PCR using mRFP-C1 as a template and a pair of primers (the forward primer mRFP-HindIII 5′-GCT CAA GCT TCG ATG GCC TCC TCC GAG GAC GTC-3′and the reverse primer mRFP-KpnI 5′-CGC GGT ACC TTA GGC GCC GGT GGA GTG GCG-3′) was digested with HindIII and KpnI first and then directly cloned into the same sites of the CFP-YFP and CFP-TRAF2TD-YFP fusion constructs, respectively.

Article Title: Activation of the KEAP1-NRF2-ARE signaling pathway reduces oxidative stress in Hep2 cells
Article Snippet: Lentiviral vectors expressing RNAi specific for the KEAP1 gene and a scrambled sequence encoding a green fluorescent protein (GFP) sequence were designed and constructed by Obio Technology Co., Ltd. (Shanghai, China). .. Pairs of complementary oligonucleotides with these sequences were synthesized, annealed and cloned into the lentiviral plasmid vector [pLKD-CMV-G & PR-U6-short hairpin (sh)RNA] (Obio Technology, Ltd., Shanghai, China) using the AgeI and EcoRI enzymes (Takara Bio, Inc., Otsu, Japan).

Article Title: Ubiquitination switches EphA2 vesicular traffic from a continuous safeguard to a finite signalling mode
Article Snippet: .. Molecular biology All C-terminally tagged EphA2 constructs were generated by inserting human, full-length EphA2 (gift from T. Pawson) between AgeI and KpnI restriction sites of: mCitrine-N1, mCherry-N1 (Clontech); Tagbfp-N1 (Evrogen) or paGFP-N1 (gift from J. Lippincott-Schwartz, NIH). .. All FP used in this study carried the A206K mutation that renders them monomeric.

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: All of the other mTFP1 and mWasabi vectors were constructed using C1 and N1 (Clontech-style) cloning vectors. .. Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech).

Article Title: The Prrx1 homeodomain transcription factor plays a central role in pancreatic regeneration and carcinogenesis
Article Snippet: Paragraph title: RNAi transfection, lentiviral transduction, and vector constructs ... Following PCR amplification, coding sequences were digested using XhoI and EcoRI or AgeI and MluI, respectively, and subcloned into pIRES2-EGFP (Clonetech) and pTRIPZ (RHS4743; Open Biosystems).

Article Title: BRCA2 Is Ubiquitinated In Vivo and Interacts with USP11, a Deubiquitinating Enzyme That Exhibits Prosurvival Function in the Cellular Response to DNA Damage
Article Snippet: The resulting PCR fragment was digested with AgeI and KpnI and ligated into the cognate sites of similarly digested pEGFP-C1 (Clontech). .. The Flag-GFP-BRCA2(2281-3418) construct was created by PCR amplification of the BRCA2 sequence (amino acids 2281 to 3418) with the primers GCGCGGTACC GCGGCCGC CATGGGAGAACCCTCAATCAAAAGAAAC (the NotI site is underlined) and CCCGGG CTCGAG TTAGATATATTTTTTAGTTGTAATTGTGTCC (the XhoI site is underlined).

Article Title: RAD51 paralogs promote homology-directed repair at diversifying immunoglobulin V regions
Article Snippet: Paragraph title: Plasmid constructs ... PCR products were cloned into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA), excised with BglII and AgeI, and subcloned into the pEGFP-N1 vector (Clontech, Mountain View, CA) to generate pRAD51D-GFP and pRAD51D, respectively.

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: Yes1 construct was made by PCR amplification from the cDNA clones using primers that introduced an NheI restriction site on the 5′ end and removed the stop codon followed by a KpnI site on the 3′ end of the amplified cDNA fragment. .. The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus.

SYBR Green Assay:

Article Title: PPM1D silencing by RNA interference inhibits the proliferation of lung cancer cells
Article Snippet: .. AgeI, EcoRI, and SYBR Green Master Mix Kits were purchased from TaKaRa (Dalian, China). .. Lipofectamine 2000 and TRIzol were purchased from Invitrogen (Carlsbad, CA, USA).

Incubation:

Article Title: CADM1 is expressed as multiple alternatively spliced functional and dysfunctional isoforms in human mast cells
Article Snippet: The cDNAs of SP4, SP1 and SP6 were re-amplified using oligonucleotides 5′ttcgaattcgacATGGCGAGTGTAGTGCTG and 5′ctcaccggtgAGATGAAGTACTCTTTCTTTTCTTC, cleaved with the restriction enzymes EcoRI and AgeI and cloned in frame into EcoRI–AgeI-cleaved pEGFP-N1 plasmid (Clontech, Takara Bio Europe, Saint-Germain-en-Laye, France) to express CADM1-EGFP-fusion proteins. .. Cells (106 cells) were transiently transfected with 2.5 μg of plasmid DNA using 7.5 μl of GeneJuice transfection reagent (Novagen, Merck Chemicals, UK) according to the manufacturer's recommendations, and incubated in 10% FBS in DMEM.

Expressing:

Article Title: Multi-OMICS analyses unveil STAT1 as a potential modifier gene in mevalonate kinase deficiency
Article Snippet: Paragraph title: Expression of recombinant STAT1 and IFN-ɣ stimulation ... It was then cloned into AgeI and PacI sites of pQCXIP (Clontech, Mountain View, California, USA).

Article Title: Activation of the KEAP1-NRF2-ARE signaling pathway reduces oxidative stress in Hep2 cells
Article Snippet: Lentiviral vectors expressing RNAi specific for the KEAP1 gene and a scrambled sequence encoding a green fluorescent protein (GFP) sequence were designed and constructed by Obio Technology Co., Ltd. (Shanghai, China). .. Pairs of complementary oligonucleotides with these sequences were synthesized, annealed and cloned into the lentiviral plasmid vector [pLKD-CMV-G & PR-U6-short hairpin (sh)RNA] (Obio Technology, Ltd., Shanghai, China) using the AgeI and EcoRI enzymes (Takara Bio, Inc., Otsu, Japan).

Article Title: Limited Transferrin Receptor Clustering Allows Rapid Diffusion of Canine Parvovirus into Clathrin Endocytic Structures
Article Snippet: .. The expression plasmids encoding fTfR-eGFP and fTfR-mCherry were generated as follows: (i) the wt feline TfR gene was PCR amplified from an existing pcDNA3.1(−) expression vector ( ) using primers that contained restriction enzyme recognition sites for EcoRI (forward primer, 5′-GTCAGAATTCATGATGGATCAAGCCAGATC-3′) or AgeI (reverse primer, 5′-GACTACCGGTGGATCCCCAAACTCATTGTCAATATCCCAAATGTC-3′); (ii) the PCR product and peGFP-N1 (Clonetech Laboratories, Inc., Mountain View, CA) or an otherwise identical plasmid encoding mCherry in place of eGFP was digested with EcoRI and AgeI, and the cleaved DNA fragments were ligated to generate pfTfR-eGFP. .. This cloning strategy introduced a 7-amino-acid linker (GDPPVAT) between the TfR and the fluorescent protein open reading frames.

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: Paragraph title: Mammalian expression vectors ... Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech).

Article Title: Genetically encoded calcium indicator illuminates calcium dynamics within primary cilia
Article Snippet: Paragraph title: Construction of the 5HT6 -GFP-CTS20 expression vector ... DNA encoding 5HT6 flanked by AgeI was amplified by PCR primers (5′-ctactgaccggtcgccaccatggttccagagcccggccctgtcaacag and 5′-gctgacaccggtcctcctgcgctaccaccagcactgttcatgggggaaccaagtgg) from 5HT6 -GFP19 (a gift from Akiko Seki and Tobias Meyer) in the Clontech pEGFP-N3 vector and then subcloned into a GFP-CTS2020 (a gift from Gregory Pazour) in the Clontech pEGFP-C2 vector at the AgeI site.

Article Title: BRCA2 Is Ubiquitinated In Vivo and Interacts with USP11, a Deubiquitinating Enzyme That Exhibits Prosurvival Function in the Cellular Response to DNA Damage
Article Snippet: The resulting PCR fragment was digested with AgeI and KpnI and ligated into the cognate sites of similarly digested pEGFP-C1 (Clontech). .. The Flag-GFP-BRCA2 expression vector was created as follows.

Article Title: RAD51 paralogs promote homology-directed repair at diversifying immunoglobulin V regions
Article Snippet: PCR products were cloned into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA), excised with BglII and AgeI, and subcloned into the pEGFP-N1 vector (Clontech, Mountain View, CA) to generate pRAD51D-GFP and pRAD51D, respectively. .. The Ugi expression vector [ ] was provided by Dr. Michael Neuberger (Medical Research Council Laboratory of Molecular Biology, Cambridge, UK).

Article Title: The Ecto-enzyme CD38 Is a Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP) Synthase That Couples Receptor Activation to Ca2+ Mobilization from Lysosomes in Pancreatic Acinar Cells *
Article Snippet: .. The PCR product is digested with AgeI and NotI at the appropriate digestion sites, purified, and ligated into the mammalian expression vector pEGFP-N1 (Clontech, Palo Alto, CA), which contains EGFP downstream of its multiple cloning sites. ..

Article Title: CADM1 is expressed as multiple alternatively spliced functional and dysfunctional isoforms in human mast cells
Article Snippet: 2.7 Cloning and transfections Kpn I–Not I-cleaved cDNA fragments of SP4, SP1 and SP6 isolated from clones in plasmid vector pSC-B, described previously , were recloned into Kpn I–Not I sites of a pcDNA3 plasmid (Invitrogen, Life Technologies, Paisley, UK) for cell expression. .. The cDNAs of SP4, SP1 and SP6 were re-amplified using oligonucleotides 5′ttcgaattcgacATGGCGAGTGTAGTGCTG and 5′ctcaccggtgAGATGAAGTACTCTTTCTTTTCTTC, cleaved with the restriction enzymes EcoRI and AgeI and cloned in frame into EcoRI–AgeI-cleaved pEGFP-N1 plasmid (Clontech, Takara Bio Europe, Saint-Germain-en-Laye, France) to express CADM1-EGFP-fusion proteins.

Article Title: PPM1D silencing by RNA interference inhibits the proliferation of lung cancer cells
Article Snippet: Short hairpin RNA (shRNA) expression vector pFH-L, lentiviral packaging aid vectors pVSVG-I and pCMVΔR8.92 were purchased from Shanghai Hollybio (Shanghai, China). .. AgeI, EcoRI, and SYBR Green Master Mix Kits were purchased from TaKaRa (Dalian, China).

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: .. The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus. .. For Yes1, the PCR product was cut with NheI and KpnI and subcloned into the mCherry-N1 vector.

Modification:

Article Title: PPM1D silencing by RNA interference inhibits the proliferation of lung cancer cells
Article Snippet: Reagents and plasmids Dulbecco’s modified Eagle’s medium (DMEM), RPMI1640 medium and fetal bovine serum (FBS) were obtained from Hyclone (Logan, UT, USA). .. AgeI, EcoRI, and SYBR Green Master Mix Kits were purchased from TaKaRa (Dalian, China).

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: Plasmid construction and mutagenesis Restriction and modification enzymes were purchased from New England Biolabs (NEB, Frankfurt am Main, Germany). .. The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus.

Gel Purification:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: To generate fusion vectors, the appropriate cloning vector and an EGFP fusion vector were digested, either sequentially or doubly, with the appropriate enzymes and ligated together after gel purification. .. Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech).

Countercurrent Chromatography:

Article Title: Determination of tumor necrosis factor receptor-associated factor trimerization in living cells by CFP- > YFP- > mRFP FRET detected by flow cytometry
Article Snippet: Plasmid construction CFP-TRAF2 and YFP-TRAF2 plasmids were described previously ( ). mRFP-TRAF2 was prepared by inserting the TRAF2 fragment directly into the BglII and HindIII sites of mRFP-C1 vector, which was prepared by a standard PCR technique using mRFP as a template and primers 5′-GCG CTA CCG GTC GCC ACC ATG GCC TCC TCC GAG GAC GTC-3′ and 5′-CGC TCC GGA GGC GCC GGT GGA GTG GCG-3′ into the AgeI and BspEI sites of pEYFP-C1 (Clontech, Palo Alto, CA). .. The CFP-YFP-TRAF2TD-mRFP was cloned by inserting the HindIII-digested TRAF2 TRAF domain PCR fragment, which was obtained using the forward primer 5′-GCT CAA GCT TCG GAG AGC CTG GAG AAG AAG ACG GCC-3′ and the reverse primer 5′-ATT CAA AGC TTG GAA CCC TGT CAG GTC CAC AAT GGC-3′, directly into the same site of the CFP-YFP-mRFP construct.

Transfection:

Article Title: Multi-OMICS analyses unveil STAT1 as a potential modifier gene in mevalonate kinase deficiency
Article Snippet: It was then cloned into AgeI and PacI sites of pQCXIP (Clontech, Mountain View, California, USA). .. The pQCXIP plasmids harbouring the wt or the mutated STAT1 were transiently transfected into the STAT1 deficient-U3A cell line with Lipofectamine 3000 according to manufacturer’s instructions (Invitrogen, Carlsbad, California, USA).

Article Title: Activation of the KEAP1-NRF2-ARE signaling pathway reduces oxidative stress in Hep2 cells
Article Snippet: Pairs of complementary oligonucleotides with these sequences were synthesized, annealed and cloned into the lentiviral plasmid vector [pLKD-CMV-G & PR-U6-short hairpin (sh)RNA] (Obio Technology, Ltd., Shanghai, China) using the AgeI and EcoRI enzymes (Takara Bio, Inc., Otsu, Japan). .. Following the screening of a series of preliminary experiments using 2 µg/ml puromycin, the optimal transfection efficiency was determined.

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech). .. DNA for mammalian transfection was prepared by either the Plasmid Midi or Maxi kit (QIAGEN).

Article Title: The Prrx1 homeodomain transcription factor plays a central role in pancreatic regeneration and carcinogenesis
Article Snippet: Paragraph title: RNAi transfection, lentiviral transduction, and vector constructs ... Following PCR amplification, coding sequences were digested using XhoI and EcoRI or AgeI and MluI, respectively, and subcloned into pIRES2-EGFP (Clonetech) and pTRIPZ (RHS4743; Open Biosystems).

Article Title: CADM1 is expressed as multiple alternatively spliced functional and dysfunctional isoforms in human mast cells
Article Snippet: Paragraph title: Cloning and transfections ... The cDNAs of SP4, SP1 and SP6 were re-amplified using oligonucleotides 5′ttcgaattcgacATGGCGAGTGTAGTGCTG and 5′ctcaccggtgAGATGAAGTACTCTTTCTTTTCTTC, cleaved with the restriction enzymes EcoRI and AgeI and cloned in frame into EcoRI–AgeI-cleaved pEGFP-N1 plasmid (Clontech, Takara Bio Europe, Saint-Germain-en-Laye, France) to express CADM1-EGFP-fusion proteins.

esiRNA:

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus. .. MISSION esiRNA targeting human UNC119A and human UNC119B were from Sigma-Aldrich Chemie GmbH.

Introduce:

Article Title: Limited Transferrin Receptor Clustering Allows Rapid Diffusion of Canine Parvovirus into Clathrin Endocytic Structures
Article Snippet: The expression plasmids encoding fTfR-eGFP and fTfR-mCherry were generated as follows: (i) the wt feline TfR gene was PCR amplified from an existing pcDNA3.1(−) expression vector ( ) using primers that contained restriction enzyme recognition sites for EcoRI (forward primer, 5′-GTCAGAATTCATGATGGATCAAGCCAGATC-3′) or AgeI (reverse primer, 5′-GACTACCGGTGGATCCCCAAACTCATTGTCAATATCCCAAATGTC-3′); (ii) the PCR product and peGFP-N1 (Clonetech Laboratories, Inc., Mountain View, CA) or an otherwise identical plasmid encoding mCherry in place of eGFP was digested with EcoRI and AgeI, and the cleaved DNA fragments were ligated to generate pfTfR-eGFP. .. Site-directed mutagenesis was used to introduce a single cysteine residue between the secretion signal and histidine tag, and the presence of the introduced cysteine was confirmed by sequence analysis.

Generated:

Article Title: Multi-OMICS analyses unveil STAT1 as a potential modifier gene in mevalonate kinase deficiency
Article Snippet: It was then cloned into AgeI and PacI sites of pQCXIP (Clontech, Mountain View, California, USA). .. The mutated form (p.R241Q) was generated with the QuikChange Site-Directed Mutagenesis kit using the forward 5’-agtggagtggaagcagagacagagcg-3’ and reverse 5’-cgctctgctgtctctgcttccactccact-3’ primers, following manufacturer’s recommendations (Stratagene, San Diego, California, USA).

Article Title: Limited Transferrin Receptor Clustering Allows Rapid Diffusion of Canine Parvovirus into Clathrin Endocytic Structures
Article Snippet: .. The expression plasmids encoding fTfR-eGFP and fTfR-mCherry were generated as follows: (i) the wt feline TfR gene was PCR amplified from an existing pcDNA3.1(−) expression vector ( ) using primers that contained restriction enzyme recognition sites for EcoRI (forward primer, 5′-GTCAGAATTCATGATGGATCAAGCCAGATC-3′) or AgeI (reverse primer, 5′-GACTACCGGTGGATCCCCAAACTCATTGTCAATATCCCAAATGTC-3′); (ii) the PCR product and peGFP-N1 (Clonetech Laboratories, Inc., Mountain View, CA) or an otherwise identical plasmid encoding mCherry in place of eGFP was digested with EcoRI and AgeI, and the cleaved DNA fragments were ligated to generate pfTfR-eGFP. .. This cloning strategy introduced a 7-amino-acid linker (GDPPVAT) between the TfR and the fluorescent protein open reading frames.

Article Title: Ubiquitination switches EphA2 vesicular traffic from a continuous safeguard to a finite signalling mode
Article Snippet: .. Molecular biology All C-terminally tagged EphA2 constructs were generated by inserting human, full-length EphA2 (gift from T. Pawson) between AgeI and KpnI restriction sites of: mCitrine-N1, mCherry-N1 (Clontech); Tagbfp-N1 (Evrogen) or paGFP-N1 (gift from J. Lippincott-Schwartz, NIH). .. All FP used in this study carried the A206K mutation that renders them monomeric.

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: All PCR-derived sequences in the final constructs were verified by DNA sequencing. mCitrine-N1/C1, mCherry-N1/C1, mTFP-N1, TagBFP-N1 and PAGFP-N1 were generated by insertion of AgeI/BsrGI PCR fragments of mCitrine, mCherry, mTFP (gifts from R Tsien), TagBFP (Evrogen) and PAGFP (gift from J Lippincott-Schwartz) complementary DNA (cDNA) into pEGFP-N1 or pEGFP-C1 (Clontech, Saint-Germain-en-Laye, France). cDNA clones encoding full-length UNC119A (accession No: NM_005148), UNC119B (accession No: NM_001080533), C-SRC (accession No: NM_005417), FYN (accession No: NM_002037) and YES1 (accession No: NM_005433) in the pCMV6 vector were obtained by BioCat (BioCat GmbH, Heidelberg, Germany). .. The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus.

DNA Sequencing:

Article Title: Thyroid peroxidase forms thionamide-sensitive homodimers: relevance for immunomodulation of thyroid autoimmunity
Article Snippet: Cloning eGFP/FLAG-TPO Oligonucleotide primers were designed to flank and overlap the 3′ and 5′ ends of TPO cDNA, previously cloned into pcDNA3.1 (gift of Dr. B Rapoport, LA [ ]), and introduced a G to C base change into the stop codon to allow read-through to C-terminally tagged fusion protein, as well as XbaI and EcoRI sites for subsequent in-frame cloning into pCMV14-3xFLAG vector (Sigma) or AgeI and EcoRI for pEGFP-N1 (Clontech). .. Single clones positive for full-length TPO were identified by restriction digest and in-frame integration of the cDNA confirmed by DNA sequencing.

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: All PCR-derived sequences in the final constructs were verified by DNA sequencing. mCitrine-N1/C1, mCherry-N1/C1, mTFP-N1, TagBFP-N1 and PAGFP-N1 were generated by insertion of AgeI/BsrGI PCR fragments of mCitrine, mCherry, mTFP (gifts from R Tsien), TagBFP (Evrogen) and PAGFP (gift from J Lippincott-Schwartz) complementary DNA (cDNA) into pEGFP-N1 or pEGFP-C1 (Clontech, Saint-Germain-en-Laye, France). cDNA clones encoding full-length UNC119A (accession No: NM_005148), UNC119B (accession No: NM_001080533), C-SRC (accession No: NM_005417), FYN (accession No: NM_002037) and YES1 (accession No: NM_005433) in the pCMV6 vector were obtained by BioCat (BioCat GmbH, Heidelberg, Germany). .. The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus.

Sequencing:

Article Title: Activation of the KEAP1-NRF2-ARE signaling pathway reduces oxidative stress in Hep2 cells
Article Snippet: Lentiviral vectors expressing RNAi specific for the KEAP1 gene and a scrambled sequence encoding a green fluorescent protein (GFP) sequence were designed and constructed by Obio Technology Co., Ltd. (Shanghai, China). .. Pairs of complementary oligonucleotides with these sequences were synthesized, annealed and cloned into the lentiviral plasmid vector [pLKD-CMV-G & PR-U6-short hairpin (sh)RNA] (Obio Technology, Ltd., Shanghai, China) using the AgeI and EcoRI enzymes (Takara Bio, Inc., Otsu, Japan).

Article Title: Limited Transferrin Receptor Clustering Allows Rapid Diffusion of Canine Parvovirus into Clathrin Endocytic Structures
Article Snippet: The expression plasmids encoding fTfR-eGFP and fTfR-mCherry were generated as follows: (i) the wt feline TfR gene was PCR amplified from an existing pcDNA3.1(−) expression vector ( ) using primers that contained restriction enzyme recognition sites for EcoRI (forward primer, 5′-GTCAGAATTCATGATGGATCAAGCCAGATC-3′) or AgeI (reverse primer, 5′-GACTACCGGTGGATCCCCAAACTCATTGTCAATATCCCAAATGTC-3′); (ii) the PCR product and peGFP-N1 (Clonetech Laboratories, Inc., Mountain View, CA) or an otherwise identical plasmid encoding mCherry in place of eGFP was digested with EcoRI and AgeI, and the cleaved DNA fragments were ligated to generate pfTfR-eGFP. .. Site-directed mutagenesis was used to introduce a single cysteine residue between the secretion signal and histidine tag, and the presence of the introduced cysteine was confirmed by sequence analysis.

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: .. Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech). .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: BRCA2 Is Ubiquitinated In Vivo and Interacts with USP11, a Deubiquitinating Enzyme That Exhibits Prosurvival Function in the Cellular Response to DNA Damage
Article Snippet: A Flag-green fluorescent protein (GFP) plasmid was created by PCR amplification of the GFP sequence with the primers GCGCGGT ACCGGT CGCCACC ATGGACTACAAGGACGACGATGACAAG ATGGTGAGCAAGGGCGAGGAGCTG (the AgeI site is underlined; the Flag sequence is in italic type) and CCCGGG GGTACC G GCGGCCGC TCCGGACTTGTACAGCTCGTCCATGC (the underlined sequences are KpnI and NotI sites, respectively). .. The resulting PCR fragment was digested with AgeI and KpnI and ligated into the cognate sites of similarly digested pEGFP-C1 (Clontech).

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus. .. All mutants were produced by Q5 site-directed mutagenesis (NEB) and were subsequently verified by sequencing.

Recombinant:

Article Title: Multi-OMICS analyses unveil STAT1 as a potential modifier gene in mevalonate kinase deficiency
Article Snippet: Paragraph title: Expression of recombinant STAT1 and IFN-ɣ stimulation ... It was then cloned into AgeI and PacI sites of pQCXIP (Clontech, Mountain View, California, USA).

Article Title: Activation of the KEAP1-NRF2-ARE signaling pathway reduces oxidative stress in Hep2 cells
Article Snippet: Pairs of complementary oligonucleotides with these sequences were synthesized, annealed and cloned into the lentiviral plasmid vector [pLKD-CMV-G & PR-U6-short hairpin (sh)RNA] (Obio Technology, Ltd., Shanghai, China) using the AgeI and EcoRI enzymes (Takara Bio, Inc., Otsu, Japan). .. The recombinant plasmid vectors (32 µg) containing shRNA were co-transfected into 293T cells along with the helper plasmids psPAX2 and pHCMV-VSV-G (Takara Bio, Inc.) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.).

Cellular Antioxidant Activity Assay:

Article Title: Determination of tumor necrosis factor receptor-associated factor trimerization in living cells by CFP- > YFP- > mRFP FRET detected by flow cytometry
Article Snippet: Plasmid construction CFP-TRAF2 and YFP-TRAF2 plasmids were described previously ( ). mRFP-TRAF2 was prepared by inserting the TRAF2 fragment directly into the BglII and HindIII sites of mRFP-C1 vector, which was prepared by a standard PCR technique using mRFP as a template and primers 5′-GCG CTA CCG GTC GCC ACC ATG GCC TCC TCC GAG GAC GTC-3′ and 5′-CGC TCC GGA GGC GCC GGT GGA GTG GCG-3′ into the AgeI and BspEI sites of pEYFP-C1 (Clontech, Palo Alto, CA). .. In order to make CFP-YFP-mRFP and CFP-TRAF2TD-YFP-mRFP constructs, the mRFP fragment that was amplified by PCR using mRFP-C1 as a template and a pair of primers (the forward primer mRFP-HindIII 5′-GCT CAA GCT TCG ATG GCC TCC TCC GAG GAC GTC-3′and the reverse primer mRFP-KpnI 5′-CGC GGT ACC TTA GGC GCC GGT GGA GTG GCG-3′) was digested with HindIII and KpnI first and then directly cloned into the same sites of the CFP-YFP and CFP-TRAF2TD-YFP fusion constructs, respectively.

Fluorescence:

Article Title: Activation of the KEAP1-NRF2-ARE signaling pathway reduces oxidative stress in Hep2 cells
Article Snippet: Pairs of complementary oligonucleotides with these sequences were synthesized, annealed and cloned into the lentiviral plasmid vector [pLKD-CMV-G & PR-U6-short hairpin (sh)RNA] (Obio Technology, Ltd., Shanghai, China) using the AgeI and EcoRI enzymes (Takara Bio, Inc., Otsu, Japan). .. The constructed lentiviral vectors contained a green fluorescence gene that emits green fluorescence in response to excitation with blue light.

Mutagenesis:

Article Title: Multi-OMICS analyses unveil STAT1 as a potential modifier gene in mevalonate kinase deficiency
Article Snippet: It was then cloned into AgeI and PacI sites of pQCXIP (Clontech, Mountain View, California, USA). .. The mutated form (p.R241Q) was generated with the QuikChange Site-Directed Mutagenesis kit using the forward 5’-agtggagtggaagcagagacagagcg-3’ and reverse 5’-cgctctgctgtctctgcttccactccact-3’ primers, following manufacturer’s recommendations (Stratagene, San Diego, California, USA).

Article Title: Limited Transferrin Receptor Clustering Allows Rapid Diffusion of Canine Parvovirus into Clathrin Endocytic Structures
Article Snippet: The expression plasmids encoding fTfR-eGFP and fTfR-mCherry were generated as follows: (i) the wt feline TfR gene was PCR amplified from an existing pcDNA3.1(−) expression vector ( ) using primers that contained restriction enzyme recognition sites for EcoRI (forward primer, 5′-GTCAGAATTCATGATGGATCAAGCCAGATC-3′) or AgeI (reverse primer, 5′-GACTACCGGTGGATCCCCAAACTCATTGTCAATATCCCAAATGTC-3′); (ii) the PCR product and peGFP-N1 (Clonetech Laboratories, Inc., Mountain View, CA) or an otherwise identical plasmid encoding mCherry in place of eGFP was digested with EcoRI and AgeI, and the cleaved DNA fragments were ligated to generate pfTfR-eGFP. .. Site-directed mutagenesis was used to introduce a single cysteine residue between the secretion signal and histidine tag, and the presence of the introduced cysteine was confirmed by sequence analysis.

Article Title: Ubiquitination switches EphA2 vesicular traffic from a continuous safeguard to a finite signalling mode
Article Snippet: Molecular biology All C-terminally tagged EphA2 constructs were generated by inserting human, full-length EphA2 (gift from T. Pawson) between AgeI and KpnI restriction sites of: mCitrine-N1, mCherry-N1 (Clontech); Tagbfp-N1 (Evrogen) or paGFP-N1 (gift from J. Lippincott-Schwartz, NIH). .. All FP used in this study carried the A206K mutation that renders them monomeric.

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: Paragraph title: Plasmid construction and mutagenesis ... The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus.

Isolation:

Article Title: RAD51 paralogs promote homology-directed repair at diversifying immunoglobulin V regions
Article Snippet: Plasmid constructs RAD51D and XRCC2 cDNAs were isolated from the human B cell line, Raji, as mammalian RAD51 paralogs are known to function in chicken cells [ ]. .. PCR products were cloned into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA), excised with BglII and AgeI, and subcloned into the pEGFP-N1 vector (Clontech, Mountain View, CA) to generate pRAD51D-GFP and pRAD51D, respectively.

Article Title: CADM1 is expressed as multiple alternatively spliced functional and dysfunctional isoforms in human mast cells
Article Snippet: 2.7 Cloning and transfections Kpn I–Not I-cleaved cDNA fragments of SP4, SP1 and SP6 isolated from clones in plasmid vector pSC-B, described previously , were recloned into Kpn I–Not I sites of a pcDNA3 plasmid (Invitrogen, Life Technologies, Paisley, UK) for cell expression. .. The cDNAs of SP4, SP1 and SP6 were re-amplified using oligonucleotides 5′ttcgaattcgacATGGCGAGTGTAGTGCTG and 5′ctcaccggtgAGATGAAGTACTCTTTCTTTTCTTC, cleaved with the restriction enzymes EcoRI and AgeI and cloned in frame into EcoRI–AgeI-cleaved pEGFP-N1 plasmid (Clontech, Takara Bio Europe, Saint-Germain-en-Laye, France) to express CADM1-EGFP-fusion proteins.

Purification:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: The purified and digested PCR products were ligated into similarly digested EGFP-C1 and EGFP-N1 cloning vector backbones. .. Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech).

Article Title: The Ecto-enzyme CD38 Is a Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP) Synthase That Couples Receptor Activation to Ca2+ Mobilization from Lysosomes in Pancreatic Acinar Cells *
Article Snippet: .. The PCR product is digested with AgeI and NotI at the appropriate digestion sites, purified, and ligated into the mammalian expression vector pEGFP-N1 (Clontech, Palo Alto, CA), which contains EGFP downstream of its multiple cloning sites. ..

Polymerase Chain Reaction:

Article Title: Determination of tumor necrosis factor receptor-associated factor trimerization in living cells by CFP- > YFP- > mRFP FRET detected by flow cytometry
Article Snippet: .. Plasmid construction CFP-TRAF2 and YFP-TRAF2 plasmids were described previously ( ). mRFP-TRAF2 was prepared by inserting the TRAF2 fragment directly into the BglII and HindIII sites of mRFP-C1 vector, which was prepared by a standard PCR technique using mRFP as a template and primers 5′-GCG CTA CCG GTC GCC ACC ATG GCC TCC TCC GAG GAC GTC-3′ and 5′-CGC TCC GGA GGC GCC GGT GGA GTG GCG-3′ into the AgeI and BspEI sites of pEYFP-C1 (Clontech, Palo Alto, CA). ..

Article Title: Multi-OMICS analyses unveil STAT1 as a potential modifier gene in mevalonate kinase deficiency
Article Snippet: Expression of recombinant STAT1 and IFN-ɣ stimulation The human STAT1 cDNA was PCR-amplified from HEK293 cells (ATCC CRL-1573) with the following forward and reverse primers respectively 5’-cgcaccggtatgtctcagtggtacgaacttcagca-3’ and 5’-cgcttaattaacta tactgtgttcatcatactgtcgaattc-3’. .. It was then cloned into AgeI and PacI sites of pQCXIP (Clontech, Mountain View, California, USA).

Article Title: Limited Transferrin Receptor Clustering Allows Rapid Diffusion of Canine Parvovirus into Clathrin Endocytic Structures
Article Snippet: .. The expression plasmids encoding fTfR-eGFP and fTfR-mCherry were generated as follows: (i) the wt feline TfR gene was PCR amplified from an existing pcDNA3.1(−) expression vector ( ) using primers that contained restriction enzyme recognition sites for EcoRI (forward primer, 5′-GTCAGAATTCATGATGGATCAAGCCAGATC-3′) or AgeI (reverse primer, 5′-GACTACCGGTGGATCCCCAAACTCATTGTCAATATCCCAAATGTC-3′); (ii) the PCR product and peGFP-N1 (Clonetech Laboratories, Inc., Mountain View, CA) or an otherwise identical plasmid encoding mCherry in place of eGFP was digested with EcoRI and AgeI, and the cleaved DNA fragments were ligated to generate pfTfR-eGFP. .. This cloning strategy introduced a 7-amino-acid linker (GDPPVAT) between the TfR and the fluorescent protein open reading frames.

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: The purified and digested PCR products were ligated into similarly digested EGFP-C1 and EGFP-N1 cloning vector backbones. .. Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech).

Article Title: The Prrx1 homeodomain transcription factor plays a central role in pancreatic regeneration and carcinogenesis
Article Snippet: .. Following PCR amplification, coding sequences were digested using XhoI and EcoRI or AgeI and MluI, respectively, and subcloned into pIRES2-EGFP (Clonetech) and pTRIPZ (RHS4743; Open Biosystems). ..

Article Title: Genetically encoded calcium indicator illuminates calcium dynamics within primary cilia
Article Snippet: .. DNA encoding 5HT6 flanked by AgeI was amplified by PCR primers (5′-ctactgaccggtcgccaccatggttccagagcccggccctgtcaacag and 5′-gctgacaccggtcctcctgcgctaccaccagcactgttcatgggggaaccaagtgg) from 5HT6 -GFP19 (a gift from Akiko Seki and Tobias Meyer) in the Clontech pEGFP-N3 vector and then subcloned into a GFP-CTS2020 (a gift from Gregory Pazour) in the Clontech pEGFP-C2 vector at the AgeI site. ..

Article Title: BRCA2 Is Ubiquitinated In Vivo and Interacts with USP11, a Deubiquitinating Enzyme That Exhibits Prosurvival Function in the Cellular Response to DNA Damage
Article Snippet: .. The resulting PCR fragment was digested with AgeI and KpnI and ligated into the cognate sites of similarly digested pEGFP-C1 (Clontech). .. The Flag-GFP-BRCA2(2281-3418) construct was created by PCR amplification of the BRCA2 sequence (amino acids 2281 to 3418) with the primers GCGCGGTACC GCGGCCGC CATGGGAGAACCCTCAATCAAAAGAAAC (the NotI site is underlined) and CCCGGG CTCGAG TTAGATATATTTTTTAGTTGTAATTGTGTCC (the XhoI site is underlined).

Article Title: RAD51 paralogs promote homology-directed repair at diversifying immunoglobulin V regions
Article Snippet: .. PCR products were cloned into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA), excised with BglII and AgeI, and subcloned into the pEGFP-N1 vector (Clontech, Mountain View, CA) to generate pRAD51D-GFP and pRAD51D, respectively. .. XRCC2 cDNA was similarly amplified with the forward primer 5'-CACCATGTGTAGTGCCTTCCATAGGGCTGAGTCT-3' and the reverse primer 5'-TCAACAAAATTCAACCCCACTTTCTCC-3' containing an in-frame stop codon and cloned into the pcDNA3.1/V5-His-D-TOPO vector (Invitrogen, Carlsbad, CA) to generate pXRCC2; or cDNA amplified with the primers 5'-AAAAAGGTACCGATGTGTAGTGCCTTCCATAGGGC-3' and 5'AAAAAACCGGTCCAC-AAAATTCAACCCCACTTTCTC-3', excised with KpnI and AgeI, and cloned into the pEGFP-N1 vector to generate pXRCC2-GFP.

Article Title: The Ecto-enzyme CD38 Is a Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP) Synthase That Couples Receptor Activation to Ca2+ Mobilization from Lysosomes in Pancreatic Acinar Cells *
Article Snippet: .. The PCR product is digested with AgeI and NotI at the appropriate digestion sites, purified, and ligated into the mammalian expression vector pEGFP-N1 (Clontech, Palo Alto, CA), which contains EGFP downstream of its multiple cloning sites. ..

Article Title: Thyroid peroxidase forms thionamide-sensitive homodimers: relevance for immunomodulation of thyroid autoimmunity
Article Snippet: Cloning eGFP/FLAG-TPO Oligonucleotide primers were designed to flank and overlap the 3′ and 5′ ends of TPO cDNA, previously cloned into pcDNA3.1 (gift of Dr. B Rapoport, LA [ ]), and introduced a G to C base change into the stop codon to allow read-through to C-terminally tagged fusion protein, as well as XbaI and EcoRI sites for subsequent in-frame cloning into pCMV14-3xFLAG vector (Sigma) or AgeI and EcoRI for pEGFP-N1 (Clontech). .. The full-length cDNA was polymerase chain reaction (PCR)-amplified using high-fidelity Phusion polymerase (NEB, Beverly, MA, USA).

Article Title: CADM1 is expressed as multiple alternatively spliced functional and dysfunctional isoforms in human mast cells
Article Snippet: The cDNAs of SP4, SP1 and SP6 were re-amplified using oligonucleotides 5′ttcgaattcgacATGGCGAGTGTAGTGCTG and 5′ctcaccggtgAGATGAAGTACTCTTTCTTTTCTTC, cleaved with the restriction enzymes EcoRI and AgeI and cloned in frame into EcoRI–AgeI-cleaved pEGFP-N1 plasmid (Clontech, Takara Bio Europe, Saint-Germain-en-Laye, France) to express CADM1-EGFP-fusion proteins. .. Plasmids were isolated and sequenced to verify correct PCR amplification and cloning.

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: .. The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus. .. For Yes1, the PCR product was cut with NheI and KpnI and subcloned into the mCherry-N1 vector.

Plasmid Preparation:

Article Title: Determination of tumor necrosis factor receptor-associated factor trimerization in living cells by CFP- > YFP- > mRFP FRET detected by flow cytometry
Article Snippet: .. Plasmid construction CFP-TRAF2 and YFP-TRAF2 plasmids were described previously ( ). mRFP-TRAF2 was prepared by inserting the TRAF2 fragment directly into the BglII and HindIII sites of mRFP-C1 vector, which was prepared by a standard PCR technique using mRFP as a template and primers 5′-GCG CTA CCG GTC GCC ACC ATG GCC TCC TCC GAG GAC GTC-3′ and 5′-CGC TCC GGA GGC GCC GGT GGA GTG GCG-3′ into the AgeI and BspEI sites of pEYFP-C1 (Clontech, Palo Alto, CA). ..

Article Title: Activation of the KEAP1-NRF2-ARE signaling pathway reduces oxidative stress in Hep2 cells
Article Snippet: .. Pairs of complementary oligonucleotides with these sequences were synthesized, annealed and cloned into the lentiviral plasmid vector [pLKD-CMV-G & PR-U6-short hairpin (sh)RNA] (Obio Technology, Ltd., Shanghai, China) using the AgeI and EcoRI enzymes (Takara Bio, Inc., Otsu, Japan). .. The recombinant plasmid vectors (32 µg) containing shRNA were co-transfected into 293T cells along with the helper plasmids psPAX2 and pHCMV-VSV-G (Takara Bio, Inc.) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.).

Article Title: Limited Transferrin Receptor Clustering Allows Rapid Diffusion of Canine Parvovirus into Clathrin Endocytic Structures
Article Snippet: .. The expression plasmids encoding fTfR-eGFP and fTfR-mCherry were generated as follows: (i) the wt feline TfR gene was PCR amplified from an existing pcDNA3.1(−) expression vector ( ) using primers that contained restriction enzyme recognition sites for EcoRI (forward primer, 5′-GTCAGAATTCATGATGGATCAAGCCAGATC-3′) or AgeI (reverse primer, 5′-GACTACCGGTGGATCCCCAAACTCATTGTCAATATCCCAAATGTC-3′); (ii) the PCR product and peGFP-N1 (Clonetech Laboratories, Inc., Mountain View, CA) or an otherwise identical plasmid encoding mCherry in place of eGFP was digested with EcoRI and AgeI, and the cleaved DNA fragments were ligated to generate pfTfR-eGFP. .. This cloning strategy introduced a 7-amino-acid linker (GDPPVAT) between the TfR and the fluorescent protein open reading frames.

Article Title: Ubiquitination switches EphA2 vesicular traffic from a continuous safeguard to a finite signalling mode
Article Snippet: Molecular biology All C-terminally tagged EphA2 constructs were generated by inserting human, full-length EphA2 (gift from T. Pawson) between AgeI and KpnI restriction sites of: mCitrine-N1, mCherry-N1 (Clontech); Tagbfp-N1 (Evrogen) or paGFP-N1 (gift from J. Lippincott-Schwartz, NIH). .. EphA2-mCherry-N1 served as starting plasmid for insertion of mCitrine in the EphA2-JMS.

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: .. Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech). .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: The Prrx1 homeodomain transcription factor plays a central role in pancreatic regeneration and carcinogenesis
Article Snippet: Paragraph title: RNAi transfection, lentiviral transduction, and vector constructs ... Following PCR amplification, coding sequences were digested using XhoI and EcoRI or AgeI and MluI, respectively, and subcloned into pIRES2-EGFP (Clonetech) and pTRIPZ (RHS4743; Open Biosystems).

Article Title: Genetically encoded calcium indicator illuminates calcium dynamics within primary cilia
Article Snippet: .. DNA encoding 5HT6 flanked by AgeI was amplified by PCR primers (5′-ctactgaccggtcgccaccatggttccagagcccggccctgtcaacag and 5′-gctgacaccggtcctcctgcgctaccaccagcactgttcatgggggaaccaagtgg) from 5HT6 -GFP19 (a gift from Akiko Seki and Tobias Meyer) in the Clontech pEGFP-N3 vector and then subcloned into a GFP-CTS2020 (a gift from Gregory Pazour) in the Clontech pEGFP-C2 vector at the AgeI site. ..

Article Title: BRCA2 Is Ubiquitinated In Vivo and Interacts with USP11, a Deubiquitinating Enzyme That Exhibits Prosurvival Function in the Cellular Response to DNA Damage
Article Snippet: A Flag-green fluorescent protein (GFP) plasmid was created by PCR amplification of the GFP sequence with the primers GCGCGGT ACCGGT CGCCACC ATGGACTACAAGGACGACGATGACAAG ATGGTGAGCAAGGGCGAGGAGCTG (the AgeI site is underlined; the Flag sequence is in italic type) and CCCGGG GGTACC G GCGGCCGC TCCGGACTTGTACAGCTCGTCCATGC (the underlined sequences are KpnI and NotI sites, respectively). .. The resulting PCR fragment was digested with AgeI and KpnI and ligated into the cognate sites of similarly digested pEGFP-C1 (Clontech).

Article Title: RAD51 paralogs promote homology-directed repair at diversifying immunoglobulin V regions
Article Snippet: .. PCR products were cloned into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA), excised with BglII and AgeI, and subcloned into the pEGFP-N1 vector (Clontech, Mountain View, CA) to generate pRAD51D-GFP and pRAD51D, respectively. .. XRCC2 cDNA was similarly amplified with the forward primer 5'-CACCATGTGTAGTGCCTTCCATAGGGCTGAGTCT-3' and the reverse primer 5'-TCAACAAAATTCAACCCCACTTTCTCC-3' containing an in-frame stop codon and cloned into the pcDNA3.1/V5-His-D-TOPO vector (Invitrogen, Carlsbad, CA) to generate pXRCC2; or cDNA amplified with the primers 5'-AAAAAGGTACCGATGTGTAGTGCCTTCCATAGGGC-3' and 5'AAAAAACCGGTCCAC-AAAATTCAACCCCACTTTCTC-3', excised with KpnI and AgeI, and cloned into the pEGFP-N1 vector to generate pXRCC2-GFP.

Article Title: The Ecto-enzyme CD38 Is a Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP) Synthase That Couples Receptor Activation to Ca2+ Mobilization from Lysosomes in Pancreatic Acinar Cells *
Article Snippet: .. The PCR product is digested with AgeI and NotI at the appropriate digestion sites, purified, and ligated into the mammalian expression vector pEGFP-N1 (Clontech, Palo Alto, CA), which contains EGFP downstream of its multiple cloning sites. ..

Article Title: Thyroid peroxidase forms thionamide-sensitive homodimers: relevance for immunomodulation of thyroid autoimmunity
Article Snippet: .. Cloning eGFP/FLAG-TPO Oligonucleotide primers were designed to flank and overlap the 3′ and 5′ ends of TPO cDNA, previously cloned into pcDNA3.1 (gift of Dr. B Rapoport, LA [ ]), and introduced a G to C base change into the stop codon to allow read-through to C-terminally tagged fusion protein, as well as XbaI and EcoRI sites for subsequent in-frame cloning into pCMV14-3xFLAG vector (Sigma) or AgeI and EcoRI for pEGFP-N1 (Clontech). .. The full-length cDNA was polymerase chain reaction (PCR)-amplified using high-fidelity Phusion polymerase (NEB, Beverly, MA, USA).

Article Title: CADM1 is expressed as multiple alternatively spliced functional and dysfunctional isoforms in human mast cells
Article Snippet: .. The cDNAs of SP4, SP1 and SP6 were re-amplified using oligonucleotides 5′ttcgaattcgacATGGCGAGTGTAGTGCTG and 5′ctcaccggtgAGATGAAGTACTCTTTCTTTTCTTC, cleaved with the restriction enzymes EcoRI and AgeI and cloned in frame into EcoRI–AgeI-cleaved pEGFP-N1 plasmid (Clontech, Takara Bio Europe, Saint-Germain-en-Laye, France) to express CADM1-EGFP-fusion proteins. .. Plasmids were isolated and sequenced to verify correct PCR amplification and cloning.

Article Title: PPM1D silencing by RNA interference inhibits the proliferation of lung cancer cells
Article Snippet: Short hairpin RNA (shRNA) expression vector pFH-L, lentiviral packaging aid vectors pVSVG-I and pCMVΔR8.92 were purchased from Shanghai Hollybio (Shanghai, China). .. AgeI, EcoRI, and SYBR Green Master Mix Kits were purchased from TaKaRa (Dalian, China).

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: Paragraph title: Plasmid construction and mutagenesis ... The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus.

shRNA:

Article Title: Activation of the KEAP1-NRF2-ARE signaling pathway reduces oxidative stress in Hep2 cells
Article Snippet: Pairs of complementary oligonucleotides with these sequences were synthesized, annealed and cloned into the lentiviral plasmid vector [pLKD-CMV-G & PR-U6-short hairpin (sh)RNA] (Obio Technology, Ltd., Shanghai, China) using the AgeI and EcoRI enzymes (Takara Bio, Inc., Otsu, Japan). .. The recombinant plasmid vectors (32 µg) containing shRNA were co-transfected into 293T cells along with the helper plasmids psPAX2 and pHCMV-VSV-G (Takara Bio, Inc.) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.).

Article Title: PPM1D silencing by RNA interference inhibits the proliferation of lung cancer cells
Article Snippet: Short hairpin RNA (shRNA) expression vector pFH-L, lentiviral packaging aid vectors pVSVG-I and pCMVΔR8.92 were purchased from Shanghai Hollybio (Shanghai, China). .. AgeI, EcoRI, and SYBR Green Master Mix Kits were purchased from TaKaRa (Dalian, China).

Produced:

Article Title: Spatial cycles mediated by UNC119 solubilisation maintain Src family kinases plasma membrane localisation
Article Snippet: The PCR products were cut with EcoRI and AgeI or BamHI and subcloned into the mammalian expression vectors mCitrine-N1, mCherry-N1, mTFP-N1 and TagBFP-N1 (Clontech), which code for fusion proteins containing the different fluorophores mentioned at the C terminus. .. All mutants were produced by Q5 site-directed mutagenesis (NEB) and were subsequently verified by sequencing.

Concentration Assay:

Article Title: The Prrx1 homeodomain transcription factor plays a central role in pancreatic regeneration and carcinogenesis
Article Snippet: Cells were transfected using Lipofectamine RNAiMAX (Life Technologies) and a final concentration of 2 nM siRNA in Opti-MEM I reduced serum medium (GIBCO, Life Technologies). siRNAs were custom-designed and purchased from Invitrogen (Supplemental Table 4). .. Following PCR amplification, coding sequences were digested using XhoI and EcoRI or AgeI and MluI, respectively, and subcloned into pIRES2-EGFP (Clonetech) and pTRIPZ (RHS4743; Open Biosystems).

CTG Assay:

Article Title: Determination of tumor necrosis factor receptor-associated factor trimerization in living cells by CFP- > YFP- > mRFP FRET detected by flow cytometry
Article Snippet: Plasmid construction CFP-TRAF2 and YFP-TRAF2 plasmids were described previously ( ). mRFP-TRAF2 was prepared by inserting the TRAF2 fragment directly into the BglII and HindIII sites of mRFP-C1 vector, which was prepared by a standard PCR technique using mRFP as a template and primers 5′-GCG CTA CCG GTC GCC ACC ATG GCC TCC TCC GAG GAC GTC-3′ and 5′-CGC TCC GGA GGC GCC GGT GGA GTG GCG-3′ into the AgeI and BspEI sites of pEYFP-C1 (Clontech, Palo Alto, CA). .. The CFP-YFP-TRAF2TD-mRFP was cloned by inserting the HindIII-digested TRAF2 TRAF domain PCR fragment, which was obtained using the forward primer 5′-GCT CAA GCT TCG GAG AGC CTG GAG AAG AAG ACG GCC-3′ and the reverse primer 5′-ATT CAA AGC TTG GAA CCC TGT CAG GTC CAC AAT GGC-3′, directly into the same site of the CFP-YFP-mRFP construct.

Lysis:

Article Title: Multi-OMICS analyses unveil STAT1 as a potential modifier gene in mevalonate kinase deficiency
Article Snippet: It was then cloned into AgeI and PacI sites of pQCXIP (Clontech, Mountain View, California, USA). .. Two days after transfection, cells were stimulated with 2000 IU/mL of interferon-ɣ (IFN-ɣ) (RD Systems, Minneapolis, Minnesota, USA) during 30 min. After stimulation, proteins were extracted with NP-40 lysis buffer (150 mM sodium chloride, 50 mM Tris pH8, 1% NP-40) complemented with the cOmplete and phosSTOP protease and phosphatase inhibitor cocktail (Roche, Basel, Switzerland).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • agei  (TaKaRa)
    99
    TaKaRa agei
    Agei, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agei/product/TaKaRa
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    agei - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    79
    TaKaRa agei stui fragment
    Agei Stui Fragment, supplied by TaKaRa, used in various techniques. Bioz Stars score: 79/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agei stui fragment/product/TaKaRa
    Average 79 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    agei stui fragment - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    Image Search Results