Review



adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta  (System Biosciences Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    System Biosciences Inc adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta
    Key Resource Table
    Adeno Associated Virus Serotype 8 (Aav8) Encoding Shrna Against Ir: Ccctgaaggatggagtcttta, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta/product/System Biosciences Inc
    Average 90 stars, based on 1 article reviews
    adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta - by Bioz Stars, 2026-03
    90/100 stars

    Images

    1) Product Images from "Insulin receptor associates with promoters genome-wide and regulates gene expression"

    Article Title: Insulin receptor associates with promoters genome-wide and regulates gene expression

    Journal: Cell

    doi: 10.1016/j.cell.2019.02.030

    Key Resource Table
    Figure Legend Snippet: Key Resource Table

    Techniques Used: Magnetic Beads, Virus, shRNA, Control, Recombinant, Protease Inhibitor, Fractionation, Cell Culture, Purification, SYBR Green Assay, Mutagenesis, Luciferase, CCK-8 Assay, Colorimetric Assay, Quantitation Assay, Sequencing, Molecular Cloning, Plasmid Preparation, Software



    Similar Products

    adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta  (System Biosciences Inc)
    90
    System Biosciences Inc adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta
    Key Resource Table
    Adeno Associated Virus Serotype 8 (Aav8) Encoding Shrna Against Ir: Ccctgaaggatggagtcttta, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta/product/System Biosciences Inc
    Average 90 stars, based on 1 article reviews
    adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Key Resource Table

    Journal: Cell

    Article Title: Insulin receptor associates with promoters genome-wide and regulates gene expression

    doi: 10.1016/j.cell.2019.02.030

    Figure Lengend Snippet: Key Resource Table

    Article Snippet: Adeno-Associated Virus serotype 8 (AAV8) encoding shRNA against IR: CCCTGAAGGATGGAGTCTTTA , This paper , System Biosciences Inc..

    Techniques: Magnetic Beads, Virus, shRNA, Control, Recombinant, Protease Inhibitor, Fractionation, Cell Culture, Purification, SYBR Green Assay, Mutagenesis, Luciferase, CCK-8 Assay, Colorimetric Assay, Quantitation Assay, Sequencing, Molecular Cloning, Plasmid Preparation, Software