abi steponeplus system  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Thermo Fisher abi steponeplus system
    Abi Steponeplus System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi steponeplus system/product/Thermo Fisher
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    abi steponeplus system - by Bioz Stars, 2020-04
    94/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Induction of autophagy is essential for monocyte-macrophage differentiation
    Article Snippet: Paragraph title: Real-time PCR ... TaqMan real-time gene expression assays were run on an ABI StepOnePlus system according to manufacturer's protocol (Applied Biosystems).

    Article Title: Soluble uric acid increases PDZK1 and ABCG2 expression in human intestinal cell lines via the TLR4-NLRP3 inflammasome and PI3K/Akt signaling pathway
    Article Snippet: .. Each real-time PCR was performed in a total volume of 20 μl in duplicate using the SYBR® Premix Ex Taq™ Kit (TaKaRa) on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK). .. The following specific primers were used for amplification: GAPDH (forward 5′-AACTCCCACTCTTCCACCTTCG-3′ and reverse 5′-TCCACCACCCTGTTGCTGTAG-3′), PDZK1 (forward 5′-CAGCCTCACATTCTTCTT-3′ and reverse 5′-GGTCACAACTCATTCCTT-3′), and ABCG2 (forward 5′-AATACATCAGCGGATACTA-3′ and reverse 5′-AATAAGCCACCATCATAAG-3′).

    Article Title: Induction of a specific CD8+ T-cell response to cancer/testis antigens by demethylating pre-treatment against osteosarcoma
    Article Snippet: .. Real-time PCR was performed using a SYBR GREEN Master Mix (Takara) on ABI StepOnePlus System (Applied Biosystems, Warrington, UK). ..

    Article Title: Increased Stromal Infiltrating Lymphocytes are Associated with Circulating Tumor Cells and Metastatic Relapse in Breast Cancer Patients After Neoadjuvant Chemotherapy
    Article Snippet: Identification of Gene Transcripts in PBMCs Real-time qPCR for GAPDH and marker genes (CK19, SBEM, and hMAM) was performed with cDNA samples prepared using PBMCs from patients and HDs. .. Gene expression was quantified with SYBR green assay using the ABI StepOnePlus system (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions.

    Article Title: Antiepileptic Effects of Protein-Rich Extract from Bombyx batryticatus on Mice and Its Protective Effects against H2O2-Induced Oxidative Damage in PC12 Cells via Regulating PI3K/Akt Signaling Pathways
    Article Snippet: Paragraph title: 2.6.6. Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR) Assay ... RT-qPCR was performed using an ABI StepOnePlus System (Applied Biosystems, CA, USA).

    Article Title: Catalpol promotes the osteogenic differentiation of bone marrow mesenchymal stem cells via the Wnt/β-catenin pathway
    Article Snippet: .. Quantitative PCR was performed on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK) using SYBR Green I Master Mix (Takara Bio) following the manufacturer’s instructions. .. The primers were provided by BioTNT (BioTNT, Shanghai, China), the sequences of which were as follows: Col1 forward: 5′ CATCGGTGGTACTAAC 3′, reverse: 5′ CTGGATCATATTGCACA 3′; Alp forward: 5′ ACCATTCCCACGTCTTCACATTT 3′, reverse: 5′ AGACATTCTCTCGTTCACCGCC 3′; osteocalcin (Ocn ) forward: 5′ CCTCACACTCCTCGCCCTATT 3′, reverse: 5′ CCCTCCTGCTTGGACACAAA 3′; runt-related transcription factor 2 (Runx2 ) forward: 5′ ACTTCCTGTGCTCGGTGCT 3′, reverse: 5′ GACGGTTATGGTCAAGGTGAA 3′; β-catenin forward: 5′ CTTACGGCAATCAGGAAAGC 3′, reverse: 5′ TAGAGCAGACAGACAGCACCTT 3′; Gsk-3β forward: 5′ ATAGGTGACAGGCACAACGACA 3′, reverse: 5′ CGGGGTTAGGACAAAAGGTACTC 3′; and glyceraldehyde-3-phosphate dehydrogenase (Gapdh ) forward: 5′ GGCATGGACTGTGGTCATGAG 3′, reverse: 5′ TGCACCACCAACTGTTAGC 3′.

    Article Title: Association of the long non-coding RNA MALAT1 with the polycomb repressive complex pathway in T and NK cell lymphoma
    Article Snippet: One step of reverse transcription and real-time PCR was performed using a Onestep SYBR PrimeScript RT-PCR kit (Takara, Japan). .. Amplification was performed using an ABI StepOnePlus™ system (Applied Biosystems, Foster City, CA, USA).

    Article Title: Knockdown of FOXA2 enhances the osteogenic differentiation of bone marrow-derived mesenchymal stem cells partly via activation of the ERK signalling pathway
    Article Snippet: .. All gene transcripts were quantified by qPCR using the Power SYBR® Green PCR Master Mix (Takara) on the ABI StepOnePlus System (Applied Biosystems, Warrington, UK). ..

    Article Title: Combined Effect of Three Types of Biophysical Stimuli for Bone Regeneration
    Article Snippet: .. Real-time polymerase chain reaction (PCR) was performed using a SYBR Green PCR Master Mix assay (Applied Biosystems, Warrington, United Kingdom) and ABI StepOnePlus system (Applied Biosystems, Foster City, CA). .. After the initial step at 95°C for 10 min, the amplification reaction was performed for 40 cycles with denaturation at 95°C for 15 s and annealing at 60°C for 1 min.

    Article Title: n-Butylidenephthalide Protects against Dopaminergic Neuron Degeneration and ?-Synuclein Accumulation in Caenorhabditis elegans Models of Parkinson's Disease
    Article Snippet: .. SYBR Green real-time qPCR assays were carried out with a 1∶20 dilution of cDNA using an ABI StepOnePlus system (Applied Biosystems). ..

    Article Title: New Role for Interleukin‐13 Receptor α1 in Myocardial Homeostasis and Heart Failure
    Article Snippet: .. Real‐time quantitative polymerase chain reaction was performed using an ABI StepOnePlus System (Applied Biosystems, Foster City, CA). ..

    RNA Extraction:

    Article Title: Catalpol promotes the osteogenic differentiation of bone marrow mesenchymal stem cells via the Wnt/β-catenin pathway
    Article Snippet: Paragraph title: RNA extraction and quantitative reverse transcription polymerase chain reaction (qRT-PCR) ... Quantitative PCR was performed on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK) using SYBR Green I Master Mix (Takara Bio) following the manufacturer’s instructions.

    Article Title: Association of the long non-coding RNA MALAT1 with the polycomb repressive complex pathway in T and NK cell lymphoma
    Article Snippet: In general, four slices of a tissue section per case were used for RNA extraction. .. Amplification was performed using an ABI StepOnePlus™ system (Applied Biosystems, Foster City, CA, USA).

    Amplification:

    Article Title: Soluble uric acid increases PDZK1 and ABCG2 expression in human intestinal cell lines via the TLR4-NLRP3 inflammasome and PI3K/Akt signaling pathway
    Article Snippet: Each real-time PCR was performed in a total volume of 20 μl in duplicate using the SYBR® Premix Ex Taq™ Kit (TaKaRa) on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK). .. The following specific primers were used for amplification: GAPDH (forward 5′-AACTCCCACTCTTCCACCTTCG-3′ and reverse 5′-TCCACCACCCTGTTGCTGTAG-3′), PDZK1 (forward 5′-CAGCCTCACATTCTTCTT-3′ and reverse 5′-GGTCACAACTCATTCCTT-3′), and ABCG2 (forward 5′-AATACATCAGCGGATACTA-3′ and reverse 5′-AATAAGCCACCATCATAAG-3′).

    Article Title: Association of the long non-coding RNA MALAT1 with the polycomb repressive complex pathway in T and NK cell lymphoma
    Article Snippet: .. Amplification was performed using an ABI StepOnePlus™ system (Applied Biosystems, Foster City, CA, USA). .. Relative lncRNA expression levels were normalized to the GAPDH expression level by the comparative cycle threshold (Ct) method (2−ΔΔCt ).

    Article Title: Combined Effect of Three Types of Biophysical Stimuli for Bone Regeneration
    Article Snippet: Real-time polymerase chain reaction (PCR) was performed using a SYBR Green PCR Master Mix assay (Applied Biosystems, Warrington, United Kingdom) and ABI StepOnePlus system (Applied Biosystems, Foster City, CA). .. After the initial step at 95°C for 10 min, the amplification reaction was performed for 40 cycles with denaturation at 95°C for 15 s and annealing at 60°C for 1 min.

    Synthesized:

    Article Title: Soluble uric acid increases PDZK1 and ABCG2 expression in human intestinal cell lines via the TLR4-NLRP3 inflammasome and PI3K/Akt signaling pathway
    Article Snippet: Complementary single-stranded DNA was synthesized from total RNA by reverse transcription (PrimerScript® RT Master Mix; TaKaRa, Kyoto, Japan). .. Each real-time PCR was performed in a total volume of 20 μl in duplicate using the SYBR® Premix Ex Taq™ Kit (TaKaRa) on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK).

    Article Title: Induction of a specific CD8+ T-cell response to cancer/testis antigens by demethylating pre-treatment against osteosarcoma
    Article Snippet: Quantitative real-time reverse transcriptase-polymerase chain reaction Total RNA was extracted using the Trizol reagent (Takara, Shiga, Japan) and qualified by absorbance at 260nm. cDNA was synthesized from 1 μg of RNA by Takara RNA PCR kit (Takara) following the manufacturer's instructions. .. Real-time PCR was performed using a SYBR GREEN Master Mix (Takara) on ABI StepOnePlus System (Applied Biosystems, Warrington, UK).

    Article Title: n-Butylidenephthalide Protects against Dopaminergic Neuron Degeneration and ?-Synuclein Accumulation in Caenorhabditis elegans Models of Parkinson's Disease
    Article Snippet: Quantitative real-time PCR Total RNA was isolated from synchronized control or experimental adult animals using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. cDNA was synthesized using the SuperScript One-Step RT-PCR system (Invitrogen, Carlsbad, CA). .. SYBR Green real-time qPCR assays were carried out with a 1∶20 dilution of cDNA using an ABI StepOnePlus system (Applied Biosystems).

    Isolation:

    Article Title: Soluble uric acid increases PDZK1 and ABCG2 expression in human intestinal cell lines via the TLR4-NLRP3 inflammasome and PI3K/Akt signaling pathway
    Article Snippet: Total RNA was isolated using TRIzol reagent (Invitrogen) and quantified by measuring the absorbance at 260 nm (NanoDrop 2000; Thermo Fisher Scientific, Waltham, MA, USA). .. Each real-time PCR was performed in a total volume of 20 μl in duplicate using the SYBR® Premix Ex Taq™ Kit (TaKaRa) on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK).

    Article Title: Association of the long non-coding RNA MALAT1 with the polycomb repressive complex pathway in T and NK cell lymphoma
    Article Snippet: Total RNA was isolated using an RNeasyFFPEKit (Qiagen, Hilden, Germany) according to the manufacturer instructions. .. Amplification was performed using an ABI StepOnePlus™ system (Applied Biosystems, Foster City, CA, USA).

    Article Title: Knockdown of FOXA2 enhances the osteogenic differentiation of bone marrow-derived mesenchymal stem cells partly via activation of the ERK signalling pathway
    Article Snippet: Paragraph title: RNA isolation and qPCR ... All gene transcripts were quantified by qPCR using the Power SYBR® Green PCR Master Mix (Takara) on the ABI StepOnePlus System (Applied Biosystems, Warrington, UK).

    Article Title: n-Butylidenephthalide Protects against Dopaminergic Neuron Degeneration and ?-Synuclein Accumulation in Caenorhabditis elegans Models of Parkinson's Disease
    Article Snippet: Quantitative real-time PCR Total RNA was isolated from synchronized control or experimental adult animals using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. cDNA was synthesized using the SuperScript One-Step RT-PCR system (Invitrogen, Carlsbad, CA). .. SYBR Green real-time qPCR assays were carried out with a 1∶20 dilution of cDNA using an ABI StepOnePlus system (Applied Biosystems).

    Quantitative RT-PCR:

    Article Title: Antiepileptic Effects of Protein-Rich Extract from Bombyx batryticatus on Mice and Its Protective Effects against H2O2-Induced Oxidative Damage in PC12 Cells via Regulating PI3K/Akt Signaling Pathways
    Article Snippet: .. RT-qPCR was performed using an ABI StepOnePlus System (Applied Biosystems, CA, USA). .. The reaction process for the RT-qPCR was as follows: 95°C for 30 s, followed by cycles of 95°C for 5 s and 55°C for 30 s and then 72°C for 30 s. The gene expressions of caspase-3, caspase-9, Bax, Bcl-2, PI3K, Akt, and p-Akt were normalized to β -actin and analyzed by using 2−△△CT method.

    Article Title: Catalpol promotes the osteogenic differentiation of bone marrow mesenchymal stem cells via the Wnt/β-catenin pathway
    Article Snippet: Paragraph title: RNA extraction and quantitative reverse transcription polymerase chain reaction (qRT-PCR) ... Quantitative PCR was performed on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK) using SYBR Green I Master Mix (Takara Bio) following the manufacturer’s instructions.

    Mouse Assay:

    Article Title: New Role for Interleukin‐13 Receptor α1 in Myocardial Homeostasis and Heart Failure
    Article Snippet: Quantitative Real‐Time PCR in Mouse Heart Mice were euthanized, and their hearts were harvested, washed in phosphate‐buffered saline, and snap frozen in liquid nitrogen. .. Real‐time quantitative polymerase chain reaction was performed using an ABI StepOnePlus System (Applied Biosystems, Foster City, CA).

    SYBR Green Assay:

    Article Title: Induction of a specific CD8+ T-cell response to cancer/testis antigens by demethylating pre-treatment against osteosarcoma
    Article Snippet: .. Real-time PCR was performed using a SYBR GREEN Master Mix (Takara) on ABI StepOnePlus System (Applied Biosystems, Warrington, UK). ..

    Article Title: Increased Stromal Infiltrating Lymphocytes are Associated with Circulating Tumor Cells and Metastatic Relapse in Breast Cancer Patients After Neoadjuvant Chemotherapy
    Article Snippet: .. Gene expression was quantified with SYBR green assay using the ABI StepOnePlus system (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. .. The relative expression of each gene was calculated using the equation 2−∆Ct (∆Ct = Ctgene – CtGAPDH ).

    Article Title: Catalpol promotes the osteogenic differentiation of bone marrow mesenchymal stem cells via the Wnt/β-catenin pathway
    Article Snippet: .. Quantitative PCR was performed on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK) using SYBR Green I Master Mix (Takara Bio) following the manufacturer’s instructions. .. The primers were provided by BioTNT (BioTNT, Shanghai, China), the sequences of which were as follows: Col1 forward: 5′ CATCGGTGGTACTAAC 3′, reverse: 5′ CTGGATCATATTGCACA 3′; Alp forward: 5′ ACCATTCCCACGTCTTCACATTT 3′, reverse: 5′ AGACATTCTCTCGTTCACCGCC 3′; osteocalcin (Ocn ) forward: 5′ CCTCACACTCCTCGCCCTATT 3′, reverse: 5′ CCCTCCTGCTTGGACACAAA 3′; runt-related transcription factor 2 (Runx2 ) forward: 5′ ACTTCCTGTGCTCGGTGCT 3′, reverse: 5′ GACGGTTATGGTCAAGGTGAA 3′; β-catenin forward: 5′ CTTACGGCAATCAGGAAAGC 3′, reverse: 5′ TAGAGCAGACAGACAGCACCTT 3′; Gsk-3β forward: 5′ ATAGGTGACAGGCACAACGACA 3′, reverse: 5′ CGGGGTTAGGACAAAAGGTACTC 3′; and glyceraldehyde-3-phosphate dehydrogenase (Gapdh ) forward: 5′ GGCATGGACTGTGGTCATGAG 3′, reverse: 5′ TGCACCACCAACTGTTAGC 3′.

    Article Title: Knockdown of FOXA2 enhances the osteogenic differentiation of bone marrow-derived mesenchymal stem cells partly via activation of the ERK signalling pathway
    Article Snippet: .. All gene transcripts were quantified by qPCR using the Power SYBR® Green PCR Master Mix (Takara) on the ABI StepOnePlus System (Applied Biosystems, Warrington, UK). ..

    Article Title: Combined Effect of Three Types of Biophysical Stimuli for Bone Regeneration
    Article Snippet: .. Real-time polymerase chain reaction (PCR) was performed using a SYBR Green PCR Master Mix assay (Applied Biosystems, Warrington, United Kingdom) and ABI StepOnePlus system (Applied Biosystems, Foster City, CA). .. After the initial step at 95°C for 10 min, the amplification reaction was performed for 40 cycles with denaturation at 95°C for 15 s and annealing at 60°C for 1 min.

    Article Title: n-Butylidenephthalide Protects against Dopaminergic Neuron Degeneration and ?-Synuclein Accumulation in Caenorhabditis elegans Models of Parkinson's Disease
    Article Snippet: .. SYBR Green real-time qPCR assays were carried out with a 1∶20 dilution of cDNA using an ABI StepOnePlus system (Applied Biosystems). ..

    Sequencing:

    Article Title: Association of polymorphisms in WWOX gene with risk and outcome of osteosarcoma in a sample of the young Chinese population
    Article Snippet: .. Briefly, the Sequence Detection Software of the ABI StepOnePlus System (Thermo Fisher Scientific, Waltham, MA, USA) was used to collect data. ..

    Software:

    Article Title: Induction of a specific CD8+ T-cell response to cancer/testis antigens by demethylating pre-treatment against osteosarcoma
    Article Snippet: Real-time PCR was performed using a SYBR GREEN Master Mix (Takara) on ABI StepOnePlus System (Applied Biosystems, Warrington, UK). .. The relative expression level of genes was normalized to the value of GAPDH by delta-delta cycle threshold (ΔΔCT) method, allowing the calculation of differences in gene expression using the ABI software.

    Article Title: Association of polymorphisms in WWOX gene with risk and outcome of osteosarcoma in a sample of the young Chinese population
    Article Snippet: .. Briefly, the Sequence Detection Software of the ABI StepOnePlus System (Thermo Fisher Scientific, Waltham, MA, USA) was used to collect data. ..

    Polymerase Chain Reaction:

    Article Title: Induction of a specific CD8+ T-cell response to cancer/testis antigens by demethylating pre-treatment against osteosarcoma
    Article Snippet: Quantitative real-time reverse transcriptase-polymerase chain reaction Total RNA was extracted using the Trizol reagent (Takara, Shiga, Japan) and qualified by absorbance at 260nm. cDNA was synthesized from 1 μg of RNA by Takara RNA PCR kit (Takara) following the manufacturer's instructions. .. Real-time PCR was performed using a SYBR GREEN Master Mix (Takara) on ABI StepOnePlus System (Applied Biosystems, Warrington, UK).

    Article Title: Catalpol promotes the osteogenic differentiation of bone marrow mesenchymal stem cells via the Wnt/β-catenin pathway
    Article Snippet: Quantitative PCR was performed on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK) using SYBR Green I Master Mix (Takara Bio) following the manufacturer’s instructions. .. PCR was performed for 40 cycles, and the mRNA expression levels of target genes were analysed relative to the mRNA expression levels of Gapdh using the 2−ΔΔCt method.

    Article Title: Knockdown of FOXA2 enhances the osteogenic differentiation of bone marrow-derived mesenchymal stem cells partly via activation of the ERK signalling pathway
    Article Snippet: .. All gene transcripts were quantified by qPCR using the Power SYBR® Green PCR Master Mix (Takara) on the ABI StepOnePlus System (Applied Biosystems, Warrington, UK). ..

    Article Title: Combined Effect of Three Types of Biophysical Stimuli for Bone Regeneration
    Article Snippet: .. Real-time polymerase chain reaction (PCR) was performed using a SYBR Green PCR Master Mix assay (Applied Biosystems, Warrington, United Kingdom) and ABI StepOnePlus system (Applied Biosystems, Foster City, CA). .. After the initial step at 95°C for 10 min, the amplification reaction was performed for 40 cycles with denaturation at 95°C for 15 s and annealing at 60°C for 1 min.

    Cell Culture:

    Article Title: Catalpol promotes the osteogenic differentiation of bone marrow mesenchymal stem cells via the Wnt/β-catenin pathway
    Article Snippet: RNA extraction and quantitative reverse transcription polymerase chain reaction (qRT-PCR) Total RNA was extracted from the cultured BMSCs 7 days after osteogenic induction using TRIzol reagent (Ambion, New York, USA). .. Quantitative PCR was performed on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK) using SYBR Green I Master Mix (Takara Bio) following the manufacturer’s instructions.

    Article Title: Combined Effect of Three Types of Biophysical Stimuli for Bone Regeneration
    Article Snippet: Total RNA (1 μg) was extracted from cultured cells using the TRIzol reagent (Invitrogen, Groningen, Netherlands) and was used as a template for cDNA synthesis (Invitrogen, Eugene, OR). .. Real-time polymerase chain reaction (PCR) was performed using a SYBR Green PCR Master Mix assay (Applied Biosystems, Warrington, United Kingdom) and ABI StepOnePlus system (Applied Biosystems, Foster City, CA).

    Expressing:

    Article Title: Induction of autophagy is essential for monocyte-macrophage differentiation
    Article Snippet: .. TaqMan real-time gene expression assays were run on an ABI StepOnePlus system according to manufacturer's protocol (Applied Biosystems). .. Gene expression was normalized to that of GAPDH.

    Article Title: Soluble uric acid increases PDZK1 and ABCG2 expression in human intestinal cell lines via the TLR4-NLRP3 inflammasome and PI3K/Akt signaling pathway
    Article Snippet: Each real-time PCR was performed in a total volume of 20 μl in duplicate using the SYBR® Premix Ex Taq™ Kit (TaKaRa) on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK). .. The cycle conditions were as follows: 95 °C for 30 s followed by 40 cycles at 95 °C for 5 s and 60 °C for 30 s. Relative gene expression was analyzed using the 2−ΔΔCt method.

    Article Title: Induction of a specific CD8+ T-cell response to cancer/testis antigens by demethylating pre-treatment against osteosarcoma
    Article Snippet: Real-time PCR was performed using a SYBR GREEN Master Mix (Takara) on ABI StepOnePlus System (Applied Biosystems, Warrington, UK). .. The relative expression level of genes was normalized to the value of GAPDH by delta-delta cycle threshold (ΔΔCT) method, allowing the calculation of differences in gene expression using the ABI software.

    Article Title: Increased Stromal Infiltrating Lymphocytes are Associated with Circulating Tumor Cells and Metastatic Relapse in Breast Cancer Patients After Neoadjuvant Chemotherapy
    Article Snippet: .. Gene expression was quantified with SYBR green assay using the ABI StepOnePlus system (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. .. The relative expression of each gene was calculated using the equation 2−∆Ct (∆Ct = Ctgene – CtGAPDH ).

    Article Title: Catalpol promotes the osteogenic differentiation of bone marrow mesenchymal stem cells via the Wnt/β-catenin pathway
    Article Snippet: Quantitative PCR was performed on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK) using SYBR Green I Master Mix (Takara Bio) following the manufacturer’s instructions. .. PCR was performed for 40 cycles, and the mRNA expression levels of target genes were analysed relative to the mRNA expression levels of Gapdh using the 2−ΔΔCt method.

    Article Title: Association of the long non-coding RNA MALAT1 with the polycomb repressive complex pathway in T and NK cell lymphoma
    Article Snippet: Paragraph title: Analysis for lncRNA expression in clinical samples ... Amplification was performed using an ABI StepOnePlus™ system (Applied Biosystems, Foster City, CA, USA).

    Article Title: Knockdown of FOXA2 enhances the osteogenic differentiation of bone marrow-derived mesenchymal stem cells partly via activation of the ERK signalling pathway
    Article Snippet: All gene transcripts were quantified by qPCR using the Power SYBR® Green PCR Master Mix (Takara) on the ABI StepOnePlus System (Applied Biosystems, Warrington, UK). .. The cycle conditions of qPCR were set as follows: 95 °C for 30 s and then 42 cycles of 95 °C for 5 s and 60 °C for 30 s. The 2−△△Ct method was used to calculate the relative expression levels of target genes.

    Article Title: New Role for Interleukin‐13 Receptor α1 in Myocardial Homeostasis and Heart Failure
    Article Snippet: Real‐time quantitative polymerase chain reaction was performed using the glyceraldehyde 3‐phosphate dehydrogenase (Gapdh ) as a reference gene, which showed stable levels of expression in WT and Il13ra1 −/− heart samples. .. Real‐time quantitative polymerase chain reaction was performed using an ABI StepOnePlus System (Applied Biosystems, Foster City, CA).

    ALP Assay:

    Article Title: Catalpol promotes the osteogenic differentiation of bone marrow mesenchymal stem cells via the Wnt/β-catenin pathway
    Article Snippet: Quantitative PCR was performed on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK) using SYBR Green I Master Mix (Takara Bio) following the manufacturer’s instructions. .. The primers were provided by BioTNT (BioTNT, Shanghai, China), the sequences of which were as follows: Col1 forward: 5′ CATCGGTGGTACTAAC 3′, reverse: 5′ CTGGATCATATTGCACA 3′; Alp forward: 5′ ACCATTCCCACGTCTTCACATTT 3′, reverse: 5′ AGACATTCTCTCGTTCACCGCC 3′; osteocalcin (Ocn ) forward: 5′ CCTCACACTCCTCGCCCTATT 3′, reverse: 5′ CCCTCCTGCTTGGACACAAA 3′; runt-related transcription factor 2 (Runx2 ) forward: 5′ ACTTCCTGTGCTCGGTGCT 3′, reverse: 5′ GACGGTTATGGTCAAGGTGAA 3′; β-catenin forward: 5′ CTTACGGCAATCAGGAAAGC 3′, reverse: 5′ TAGAGCAGACAGACAGCACCTT 3′; Gsk-3β forward: 5′ ATAGGTGACAGGCACAACGACA 3′, reverse: 5′ CGGGGTTAGGACAAAAGGTACTC 3′; and glyceraldehyde-3-phosphate dehydrogenase (Gapdh ) forward: 5′ GGCATGGACTGTGGTCATGAG 3′, reverse: 5′ TGCACCACCAACTGTTAGC 3′.

    Article Title: Combined Effect of Three Types of Biophysical Stimuli for Bone Regeneration
    Article Snippet: Real-time polymerase chain reaction (PCR) was performed using a SYBR Green PCR Master Mix assay (Applied Biosystems, Warrington, United Kingdom) and ABI StepOnePlus system (Applied Biosystems, Foster City, CA). .. The following primers were used: GAPDH sense, 5′-CCAGGTGGTCTCCTCTGACTTC-3′; GAPDH antisense, 5′-GTGGTCGTTGAGGGCAATG-3′; alkaline phosphatase (ALP) sense, 5′-ATGTCATCATGTTCCTGGGAGAT-3′; ALP antisense, 5′-TGGAGCTGACCCTTGAGGAT-3′; heat-shock protein 27 (HSP27) sense, 5′-CCCTGGATGTCAACCACTTC-3′; HSP27 antisense, 5′-TCTCCACCA CGCCATCCT-3′; osterix (OSX) sense, 5′-GGCAGCG TGCAGCAAATT-3′; and OSX antisense, 5′-CCTGCTT TGCCCAGAGTTGT-3′.

    Marker:

    Article Title: Increased Stromal Infiltrating Lymphocytes are Associated with Circulating Tumor Cells and Metastatic Relapse in Breast Cancer Patients After Neoadjuvant Chemotherapy
    Article Snippet: Identification of Gene Transcripts in PBMCs Real-time qPCR for GAPDH and marker genes (CK19, SBEM, and hMAM) was performed with cDNA samples prepared using PBMCs from patients and HDs. .. Gene expression was quantified with SYBR green assay using the ABI StepOnePlus system (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions.

    Purification:

    Article Title: New Role for Interleukin‐13 Receptor α1 in Myocardial Homeostasis and Heart Failure
    Article Snippet: RNA was purified from snap‐frozen hearts with an RNeasy Mini Kit (Qiagen, Valencia, CA) following the manufacturer's instructions. .. Real‐time quantitative polymerase chain reaction was performed using an ABI StepOnePlus System (Applied Biosystems, Foster City, CA).

    Microarray:

    Article Title: Induction of a specific CD8+ T-cell response to cancer/testis antigens by demethylating pre-treatment against osteosarcoma
    Article Snippet: Real-time PCR was performed using a SYBR GREEN Master Mix (Takara) on ABI StepOnePlus System (Applied Biosystems, Warrington, UK). .. REFERENCES 1 Pattyn F Speleman F De Paepe A Vandesompele J RTPrimerDB: the real-time PCR primer and probe database Nucleic Acids Res 2003 31 122 123 12519963 2 Zou C Shen J Tang Q Yang Z Yin J Li Z Xie X Huang G Lev D Wang J Cancer-testis antigens expressed in osteosarcoma identified by gene microarray correlate with a poor patient prognosis Cancer 2012 118 1845 1855 22009167 3 De Plaen E Arden K Traversari C Gaforio JJ Szikora JP De Smet C Brasseur F van der Bruggen P Lethe B Lurquin C Et A Structure, chromosomal localization, and expression of 12 genes of the MAGE family Immunogenetics 1994 40 360 369 7927540 4 Muller-Richter UD Dowejko A Reuther T Kleinheinz J Reichert TE Driemel O Analysis of expression profiles of MAGE-A antigens in oral squamous cell carcinoma cell lines Head Face Med 2009 5 10 19358718 5 Wang RF Johnston SL Zeng G Topalian SL Schwartzentruber DJ Rosenberg SA A breast and melanoma-shared tumor antigen: T cell responses to antigenic peptides translated from different open reading frames J Immunol 1998 161 3598 3606 9759882

    Concentration Assay:

    Article Title: Antiepileptic Effects of Protein-Rich Extract from Bombyx batryticatus on Mice and Its Protective Effects against H2O2-Induced Oxidative Damage in PC12 Cells via Regulating PI3K/Akt Signaling Pathways
    Article Snippet: Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR) Assay Total RNA of the PC12 cells was extracted according to the manufacturer's instruction, and their purity and concentration were determined by their absorbance at 260 and 280 nm. .. RT-qPCR was performed using an ABI StepOnePlus System (Applied Biosystems, CA, USA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Catalpol promotes the osteogenic differentiation of bone marrow mesenchymal stem cells via the Wnt/β-catenin pathway
    Article Snippet: Paragraph title: RNA extraction and quantitative reverse transcription polymerase chain reaction (qRT-PCR) ... Quantitative PCR was performed on an ABI StepOnePlus System (Applied Biosystems, Warrington, UK) using SYBR Green I Master Mix (Takara Bio) following the manufacturer’s instructions.

    Article Title: Association of the long non-coding RNA MALAT1 with the polycomb repressive complex pathway in T and NK cell lymphoma
    Article Snippet: One step of reverse transcription and real-time PCR was performed using a Onestep SYBR PrimeScript RT-PCR kit (Takara, Japan). .. Amplification was performed using an ABI StepOnePlus™ system (Applied Biosystems, Foster City, CA, USA).

    Article Title: n-Butylidenephthalide Protects against Dopaminergic Neuron Degeneration and ?-Synuclein Accumulation in Caenorhabditis elegans Models of Parkinson's Disease
    Article Snippet: Quantitative real-time PCR Total RNA was isolated from synchronized control or experimental adult animals using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. cDNA was synthesized using the SuperScript One-Step RT-PCR system (Invitrogen, Carlsbad, CA). .. SYBR Green real-time qPCR assays were carried out with a 1∶20 dilution of cDNA using an ABI StepOnePlus system (Applied Biosystems).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher abi steponeplus real time pcr machine
    Abi Steponeplus Real Time Pcr Machine, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi steponeplus real time pcr machine/product/Thermo Fisher
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    abi steponeplus real time pcr machine - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    95
    Thermo Fisher abi steponeplus thermocycler
    Abi Steponeplus Thermocycler, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi steponeplus thermocycler/product/Thermo Fisher
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    abi steponeplus thermocycler - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    97
    Thermo Fisher abi steponeplus
    Abi Steponeplus, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 35 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi steponeplus/product/Thermo Fisher
    Average 97 stars, based on 35 article reviews
    Price from $9.99 to $1999.99
    abi steponeplus - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    94
    Thermo Fisher abi steponeplus system
    Abi Steponeplus System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi steponeplus system/product/Thermo Fisher
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    abi steponeplus system - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results