abi prism bigdye terminator cycle sequencing ready reaction kit  (PerkinElmer)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87

    Structured Review

    PerkinElmer abi prism bigdye terminator cycle sequencing ready reaction kit
    Abi Prism Bigdye Terminator Cycle Sequencing Ready Reaction Kit, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 87/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism bigdye terminator cycle sequencing ready reaction kit/product/PerkinElmer
    Average 87 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    abi prism bigdye terminator cycle sequencing ready reaction kit - by Bioz Stars, 2019-12
    87/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Cloning, expression, purification and characterisation of Erwinia carotovora L-asparaginase in Escherichia coli
    Article Snippet: Paragraph title: Cloning of L-asparaginase gene from E. carotovora and expression in E. coli ... The resulting construct was sequenced using ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Corporation) along both strands to confirm the right construct.

    Article Title: Evidence for a novel protease governing regulated intramembrane proteolysisand resistance to antimicrobial peptides in Bacillus subtilis
    Article Snippet: The linked Tn10-spec were then cloned and sequenced as previously described ( ). .. The resulting PCR products were then sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer) and either primer CDEP165 or CDEP166, according to the manufacturer’s instructions.

    Article Title: A probable aculeacin A acylase from the Ralstonia solanacearum GMI1000 is N-acyl-homoserine lactone acylase with quorum-quenching activity
    Article Snippet: Then, the positive clones of E. coli DH10B (pS3aac) expressing AHL-degrading activity were identified through the in vitro whole cell bioassay. .. Next, the cloned aac gene was sequenced by an ABI PRISM 3730XL DNA Analyzer along with an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer). .. The aac gene was amplified by PCR with the primers 5'-CGCA GAATTC ATGACGCACGGATTC-3' (the Eco RI site is underlined) and 5'-CGGC AAGCTT CTGCGACAGCTTTG-3' (the Hin dIII site is underlined), and then ligated to vector pET21a (Novagen).

    Amplification:

    Article Title: CTP synthase 1 deficiency in humans reveals its central role in lymphocyte proliferation
    Article Snippet: Oligonucleotide primers flanking the 3′ region of intron 17-18 and exon 18 of CTPS1 were used to amplify genomic DNA: Forward 5′-AGAGTTGGTGGTAGGGTGTGTGAC-3′ and reverse 5′-CTTGCAATCGCAGTGTGTTATCAC-3′. .. PCR products were amplified using high fidelity Platinum Taq DNA Polymerase (Invitrogen) according to the manufacturer’s recommendations, purified with the QIAquick gel extraction kit (Qiagen) and sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer) according to the manufacturer’s recommendations. .. All collected sequences were analysed using 4peaks software (Version 1.7.2; A. Griekspoor and T. Groothuis, http://nucleobytes.com/index.php/4peaks ).

    Article Title: Phylogeographical structure and demographic expansion in the endemic alpine stream salamander (Hynobiidae: Batrachuperus) of the Qinling Mountains
    Article Snippet: The reaction mixture was amplified using an MBS Satellite thermal cycler (Thermo Electron Corp., USA). .. The amplified DNA products were purified, and automated DNA sequencing was performed on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Biosystems). .. Sequence data were carefully inspected by eye using BioEdit 7.1.3.0 , and sequences immediately next to the sequencing primer were excluded.

    Article Title: Vicariance and Its Impact on the Molecular Ecology of a Chinese Ranid Frog Species-Complex (Odorrana schmackeri, Ranidae)
    Article Snippet: Paragraph title: DNA extraction, PCR amplification and sequencing ... The DNA products were purified, and then sequenced in both directions on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Biosystems).

    Article Title: Structural and Content Diversity of Mitochondrial Genome in Beet: A Comparative Genomic Analysis
    Article Snippet: PCR amplification was performed in a 25-μl mix containing 25 ng of DNA template, 3 mM of MgCl2 , 2.5 μl of Buffer 10× (PerkinElmer, Norwalk, CT), 0.2 μM of each primer, 200 μM of each dNTP, and 1.25 U/μl of hot start Taq polymerase (AmpliTaq Gold, PerkinElmer). .. The PCR products were then purified using a Nucleospon 96 Extract kit (Macherey-Nagel) and directly sequenced with an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer).

    Article Title: Multiplex amplification refractory mutation system (MARMS) for the detection of β-globin gene mutations among the transfusion-dependent β-thalassemia Malay patients in Kelantan, Northeast of Peninsular Malaysia
    Article Snippet: The amplicon integrity was in the range of 1.8-2.0 of 260/280 wavelength. .. Based on the results, those which were not detected by MARMS were sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Applied Biosystems Division, USA).

    Article Title: Chloroplastic and nuclear diversity of wild beets at a large geographical scale: Insights into the evolutionary history of the Beta section, et al. Chloroplastic and nuclear diversity of wild beets at a large geographical scale: Insights into the evolutionary history of the Beta section
    Article Snippet: PCR amplification was performed in a 25 μl mix containing 25 ng of DNA template, 3 mmol/L of MgCl2 , 1.5 μmol/L of Buffer 10X (Perkin‐Elmer, Norwalk, CT, USA), 0.2 μmol/L of each primer, 200 μmol/L of each dNTP, and 0.625 U/μl of hot start Taq polymerase (AmpliTaq Gold, Perkin‐Elmer, Norwalk, CT, USA). .. The PCR products were then purified using a QIAquick PCR Purification Kit (QIAGEN, Inc., Valencia, CA, USA) and directly sequenced with an ABI Prism™ BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin‐Elmer, Norwalk, CT, USA).

    Article Title: OPA1-related dominant optic atrophy is not strongly influenced by mitochondrial DNA background
    Article Snippet: The results of the amplification were then purified using ExoSAP-IT® technology. .. Finally, starting from position 16050, at least 725 pb of the mitochondrial DNA control region were double-strand sequenced using an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer® ).

    Article Title: Screening for Mutations in the TBX1 Gene on Chromosome 22q11.2 in Schizophrenia
    Article Snippet: PCR cycling conditions consisted of an initial denaturation at 95 °C for 1 min, the optimal annealing temperature of each amplicon for 1 min, and 72 °C for 1 min. After PCR amplification, aliquots of PCR products were processed using an IllustraTM ExoProStarTM 1-Step Kit (GE Healthcare Bio-Sciences Corp., NJ, USA) to remove residual primers and dNTPs following the manufacturer’s protocol. .. The purified PCR products were sequencing using an ABI Prism™ BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (version 3.1) and an ABI autosequencer 3730 (Perkin Elmer Applied Biosystem, Foster City, CA, USA) according to the manufacturer’s protocol.

    Article Title: Vascular endothelial dysfunction resulting from l-arginine deficiency in a patient with lysinuric protein intolerance
    Article Snippet: Paragraph title: RT-PCR, genomic DNA amplification, sequencing, and mutation analysis. ... The PCR products were purified from a 1% agarose gel and sequenced in both directions using an automated DNA sequencer (model 310) using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (both, Perkin-Elmer, Courtaboeuf, France).

    Article Title: Absence of zoonotic Bartonella species in questing ticks: First detection of Bartonella clarridgeiae and Rickettsia felis in cat fleas in the Netherlands
    Article Snippet: Midichloria mitochondrii" was amplified from tick lysates of larvae collected in Vrouwenpolder as described [ ], using 5'-GCTACAGCTCTTGCCCGT (IrESF) and 5'-CAAAACCGACTCCCATGGC (IrESR) as primers. .. PCR amplicons were purified with the Qiaquick gel extraction kit (Qiagen Inc.) and sequenced using an ABI PRISM BigDye Terminator Cycle sequencing Ready Reaction kit (Perkin Elmer, Applied Biosystems).

    Article Title: Diversity Arrays Technology (DArT) for Pan-Genomic Evolutionary Studies of Non-Model Organisms
    Article Snippet: Exons 14 to 16 of the single-copy nuclear locus pgi C were amplified using primers 14F and16R according to Ishikawa et al. . .. Bidirectional cycle sequencing was carried out on an ABI 3730 capillary DNA sequencer using ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer) and the same primers used for amplification. .. Sequence contigs were assembled and automatically aligned with subsequent manual corrections using SeqMan and MegAlign respectively (v. 6.00 Lasergene, DNAstar, Madison, WI, USA).

    Polymerase Chain Reaction:

    Article Title: CTP synthase 1 deficiency in humans reveals its central role in lymphocyte proliferation
    Article Snippet: Oligonucleotide primers flanking the 3′ region of intron 17-18 and exon 18 of CTPS1 were used to amplify genomic DNA: Forward 5′-AGAGTTGGTGGTAGGGTGTGTGAC-3′ and reverse 5′-CTTGCAATCGCAGTGTGTTATCAC-3′. .. PCR products were amplified using high fidelity Platinum Taq DNA Polymerase (Invitrogen) according to the manufacturer’s recommendations, purified with the QIAquick gel extraction kit (Qiagen) and sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer) according to the manufacturer’s recommendations. .. All collected sequences were analysed using 4peaks software (Version 1.7.2; A. Griekspoor and T. Groothuis, http://nucleobytes.com/index.php/4peaks ).

    Article Title: Phylogeographical structure and demographic expansion in the endemic alpine stream salamander (Hynobiidae: Batrachuperus) of the Qinling Mountains
    Article Snippet: PCR involved 5 minutes at 94 °C, then 35 cycles of 94 °C for 30 s, 50 °C for 30 s and 72 °C for 45 s, and finally an extension at 72 °C for 10 minutes. .. The amplified DNA products were purified, and automated DNA sequencing was performed on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Biosystems).

    Article Title: Vicariance and Its Impact on the Molecular Ecology of a Chinese Ranid Frog Species-Complex (Odorrana schmackeri, Ranidae)
    Article Snippet: Paragraph title: DNA extraction, PCR amplification and sequencing ... The DNA products were purified, and then sequenced in both directions on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Biosystems).

    Article Title: Structural and Content Diversity of Mitochondrial Genome in Beet: A Comparative Genomic Analysis
    Article Snippet: PCR mixture underwent the following conditions on a Mastercycler ep (Eppendorf): 5 min denaturing at 95 °C, 35 cycles of 40 s denaturing at 95 °C, 45 s annealing at Annealing temperature ( supplementary table S1 , Supplementary Material online), and from 1 to 2 min extension (depending on the fragment length) at 72 °C and a final extension step at 72 °C for 10 min, after 35 cycles. .. The PCR products were then purified using a Nucleospon 96 Extract kit (Macherey-Nagel) and directly sequenced with an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer). .. Sequence data were obtained on a 3130xl Genetic Analyzer (Applied Biosystems).

    Article Title: Chloroplastic and nuclear diversity of wild beets at a large geographical scale: Insights into the evolutionary history of the Beta section, et al. Chloroplastic and nuclear diversity of wild beets at a large geographical scale: Insights into the evolutionary history of the Beta section
    Article Snippet: PCR mixture underwent the following conditions on a 9700 thermal cycler (Perkin‐Elmer, Norwalk, CT, USA): 12‐min denaturing at 94°C, 40 cycles of 30″ denaturing at 94°C, 45″ annealing at T a (see above) and from 1 to 2 min extension (depending on the fragment length) at 72°C and a final extension step at 72°C for 10 min, after 40 cycles. .. The PCR products were then purified using a QIAquick PCR Purification Kit (QIAGEN, Inc., Valencia, CA, USA) and directly sequenced with an ABI Prism™ BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin‐Elmer, Norwalk, CT, USA). .. Sequence data were obtained on a 3100‐Avant Genetic Analyser (Applied Biosystems).

    Article Title: Cloning, expression, purification and characterisation of Erwinia carotovora L-asparaginase in Escherichia coli
    Article Snippet: The resulting PCR product was purified and subjected to restriction enzyme digestion by BamHI and NdeI which has been ligated into pET22b vector in order to produce 6His-tagged fusion protein using standard T4 DNA ligase protocol. .. The resulting construct was sequenced using ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Corporation) along both strands to confirm the right construct.

    Article Title: Intergenomic Arms Races: Detection of a Nuclear Rescue Gene of Male-Killing in a Ladybird
    Article Snippet: The PCR was carried out using Expand High Fidelity PCR System (Boehringer Mannheim). .. Inserts were sequenced using the ABI PRISM BigDye Terminator cycle-sequencing ready-reaction kit (Perkin Elmer) and visualised on an ABI 377 automated sequencer.

    Article Title: Screening for Mutations in the TBX1 Gene on Chromosome 22q11.2 in Schizophrenia
    Article Snippet: PCR cycling conditions consisted of an initial denaturation at 95 °C for 1 min, the optimal annealing temperature of each amplicon for 1 min, and 72 °C for 1 min. After PCR amplification, aliquots of PCR products were processed using an IllustraTM ExoProStarTM 1-Step Kit (GE Healthcare Bio-Sciences Corp., NJ, USA) to remove residual primers and dNTPs following the manufacturer’s protocol. .. The purified PCR products were sequencing using an ABI Prism™ BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (version 3.1) and an ABI autosequencer 3730 (Perkin Elmer Applied Biosystem, Foster City, CA, USA) according to the manufacturer’s protocol. .. Repeat PCR and sequencing verified all variants in both directions.

    Article Title: Three-stage biochemical selection: cloning of prototype class IIS/IIC/IIG restriction endonuclease-methyltransferase TsoI from the thermophile Thermus scotoductus
    Article Snippet: Difco media were from Becton- Dickinson (Franklin Lakes, NJ, USA), DNA ladders and protein size standard, DNA purification kits, restriction enzymes, λ DNA, T4 DNA polymerase, T4 DNA ligase, Taq DNA polymerase, alkaline phosphatase and PCR primers were from Thermo Fisher Scientific/Fermentas (Vilnius, Lithuania). .. Sequencing was carried out using the ABI Prism 310 automated sequencer with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Applied Biosystems, Foster City, CA, USA).

    Article Title: Vascular endothelial dysfunction resulting from l-arginine deficiency in a patient with lysinuric protein intolerance
    Article Snippet: PCR conditions were as follows: hot start for 3 minutes at 96°C; 35 cycles of denaturing (96°C, 30 seconds), annealing (58°C, 30 seconds), and extension (72°C, 2 minutes). .. The PCR products were purified from a 1% agarose gel and sequenced in both directions using an automated DNA sequencer (model 310) using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (both, Perkin-Elmer, Courtaboeuf, France). .. Studies were performed in an isolated and temperature-controlled (22–24°C) room while the study subjects were in the fasting state.

    Article Title: Evidence for a novel protease governing regulated intramembrane proteolysisand resistance to antimicrobial peptides in Bacillus subtilis
    Article Snippet: The prsW mutants were sequenced by PCR-amplifying the prsW mutant alleles using primers CDEP167 and CDEP170. .. The resulting PCR products were then sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer) and either primer CDEP165 or CDEP166, according to the manufacturer’s instructions. .. Solid DS medium was inoculated with ∼5 × 108 cells per milliliter of a 1:1 mixture of a wild-type strain marked with lacZ ( amyE ∷Pcons - lacZ ) and mutant strains.

    Article Title: Absence of zoonotic Bartonella species in questing ticks: First detection of Bartonella clarridgeiae and Rickettsia felis in cat fleas in the Netherlands
    Article Snippet: Midichloria mitochondrii" was amplified from tick lysates of larvae collected in Vrouwenpolder as described [ ], using 5'-GCTACAGCTCTTGCCCGT (IrESF) and 5'-CAAAACCGACTCCCATGGC (IrESR) as primers. .. PCR amplicons were purified with the Qiaquick gel extraction kit (Qiagen Inc.) and sequenced using an ABI PRISM BigDye Terminator Cycle sequencing Ready Reaction kit (Perkin Elmer, Applied Biosystems). .. Sequences were compared with sequences in Genbank using BLAST.

    Article Title: A probable aculeacin A acylase from the Ralstonia solanacearum GMI1000 is N-acyl-homoserine lactone acylase with quorum-quenching activity
    Article Snippet: Eighty ng of the purified PCR product was added into 15 μl of the ligation mixture (50 ng of Kpn I/Spe I-digested pBBR1MCS-3, 1× ligation buffer, and 5 U T4 DNA ligase) and incubated at 16°C for 16 h. The resulting construct, pS3aac, was transformed into E. coli DH10B by the heat shock method [ ] and screened on LB agar containing tetracycline (10 μg·ml-1 ), isopropyl-β-D-thiogalactopyranoside (IPTG, 50 μg·ml-1 ), and 5-bromo-4-chloro-3-indolyl-D-galactoside (X-Gal, 50 μg·ml-1 ). .. Next, the cloned aac gene was sequenced by an ABI PRISM 3730XL DNA Analyzer along with an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer).

    Article Title: Complete Genome Analysis of Three Acinetobacter baumannii Clinical Isolates in China for Insight into the Diversification of Drug Resistance Elements
    Article Snippet: PCR reactions were carried out in a Peltier PTC225 thermal cycler (MJ Research Inc., Watertown, MA). .. Sequencing reactions were performed with the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer Applied Biosystems).

    Article Title: Selection and Phylogenetics of Salmonid MHC Class I: Wild Brown Trout (Salmo trutta) Differ from a Non-Native Introduced Strain
    Article Snippet: Plasmid DNA was isolated from single colonies using the QIAGEN® QIAprep spin miniprep kit (QIAGEN, Valencia, CA, USA). .. Both strands of five clones from each of the subsequent PCR amplifications were sequenced using the ABI Prism Bigdye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer, Branchbury, USA) and the T7 and SP6 primers, and analysed on an ABI 377 automated sequencer (Applied Biosystems, Foster City, USA). .. The Sequencher® program was used for contig assembly from ABI® outputs.

    Article Title: Diversity Arrays Technology (DArT) for Pan-Genomic Evolutionary Studies of Non-Model Organisms
    Article Snippet: The following portions of the chloroplast genome were amplified by the polymerase chain reaction: the combined trn L(CAA ) gene and trn L-trn F(GAA ) intergenic spacer (IGS) region (trn L-F), using primers FERN1 and F as specified in Trewick et al. and the combined rps4 gene and rps4-trn S(GAA ) IGS region (rps4-trn S) following the primers and conditions specified in Schneider et al. . .. Bidirectional cycle sequencing was carried out on an ABI 3730 capillary DNA sequencer using ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer) and the same primers used for amplification.

    Construct:

    Article Title: Cloning, expression, purification and characterisation of Erwinia carotovora L-asparaginase in Escherichia coli
    Article Snippet: Several successful colonies were analyzed using miniprep and the purified plasmids were digested to linear the construct and analyzed on agarose gel using 1 kb marker (Bioline). .. The resulting construct was sequenced using ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Corporation) along both strands to confirm the right construct. .. E. coli cells, harboring plasmid, were grown at 37°C in LB medium containing 100 μg/ml ampicillin.

    Article Title: Absence of zoonotic Bartonella species in questing ticks: First detection of Bartonella clarridgeiae and Rickettsia felis in cat fleas in the Netherlands
    Article Snippet: PCR amplicons were purified with the Qiaquick gel extraction kit (Qiagen Inc.) and sequenced using an ABI PRISM BigDye Terminator Cycle sequencing Ready Reaction kit (Perkin Elmer, Applied Biosystems). .. PCR amplicons were purified with the Qiaquick gel extraction kit (Qiagen Inc.) and sequenced using an ABI PRISM BigDye Terminator Cycle sequencing Ready Reaction kit (Perkin Elmer, Applied Biosystems).

    Article Title: A probable aculeacin A acylase from the Ralstonia solanacearum GMI1000 is N-acyl-homoserine lactone acylase with quorum-quenching activity
    Article Snippet: Eighty ng of the purified PCR product was added into 15 μl of the ligation mixture (50 ng of Kpn I/Spe I-digested pBBR1MCS-3, 1× ligation buffer, and 5 U T4 DNA ligase) and incubated at 16°C for 16 h. The resulting construct, pS3aac, was transformed into E. coli DH10B by the heat shock method [ ] and screened on LB agar containing tetracycline (10 μg·ml-1 ), isopropyl-β-D-thiogalactopyranoside (IPTG, 50 μg·ml-1 ), and 5-bromo-4-chloro-3-indolyl-D-galactoside (X-Gal, 50 μg·ml-1 ). .. Next, the cloned aac gene was sequenced by an ABI PRISM 3730XL DNA Analyzer along with an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer).

    Electrophoresis:

    Article Title: Vicariance and Its Impact on the Molecular Ecology of a Chinese Ranid Frog Species-Complex (Odorrana schmackeri, Ranidae)
    Article Snippet: The PCR products were separated by electrophoresis in 1.5% agarose gels, then were purified by DNA Gel Extraction Kit (V-gene, Hangzhou, China) with ABI 3730 (Shanghai Sangon Biotechnology Co., Ltd., Shanghai, China). .. The DNA products were purified, and then sequenced in both directions on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Biosystems).

    Incubation:

    Article Title: Evidence for a novel protease governing regulated intramembrane proteolysisand resistance to antimicrobial peptides in Bacillus subtilis
    Article Snippet: The plates were incubated for 3 d at 37°C, after which one SdpC-resistant mutant was isolated and then subjected to mapping. .. The resulting PCR products were then sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer) and either primer CDEP165 or CDEP166, according to the manufacturer’s instructions.

    Article Title: A probable aculeacin A acylase from the Ralstonia solanacearum GMI1000 is N-acyl-homoserine lactone acylase with quorum-quenching activity
    Article Snippet: Eighty ng of the purified PCR product was added into 15 μl of the ligation mixture (50 ng of Kpn I/Spe I-digested pBBR1MCS-3, 1× ligation buffer, and 5 U T4 DNA ligase) and incubated at 16°C for 16 h. The resulting construct, pS3aac, was transformed into E. coli DH10B by the heat shock method [ ] and screened on LB agar containing tetracycline (10 μg·ml-1 ), isopropyl-β-D-thiogalactopyranoside (IPTG, 50 μg·ml-1 ), and 5-bromo-4-chloro-3-indolyl-D-galactoside (X-Gal, 50 μg·ml-1 ). .. Next, the cloned aac gene was sequenced by an ABI PRISM 3730XL DNA Analyzer along with an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer).

    Article Title: Selection and Phylogenetics of Salmonid MHC Class I: Wild Brown Trout (Salmo trutta) Differ from a Non-Native Introduced Strain
    Article Snippet: Some 40 µl of the suspension of bacterial cells was plated out onto LB/ampicillin/IPTG/X-Gal plates and incubated overnight at 37°C. .. Both strands of five clones from each of the subsequent PCR amplifications were sequenced using the ABI Prism Bigdye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer, Branchbury, USA) and the T7 and SP6 primers, and analysed on an ABI 377 automated sequencer (Applied Biosystems, Foster City, USA).

    Activity Assay:

    Article Title: A probable aculeacin A acylase from the Ralstonia solanacearum GMI1000 is N-acyl-homoserine lactone acylase with quorum-quenching activity
    Article Snippet: Then, the positive clones of E. coli DH10B (pS3aac) expressing AHL-degrading activity were identified through the in vitro whole cell bioassay. .. Next, the cloned aac gene was sequenced by an ABI PRISM 3730XL DNA Analyzer along with an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer).

    Expressing:

    Article Title: Cloning, expression, purification and characterisation of Erwinia carotovora L-asparaginase in Escherichia coli
    Article Snippet: Paragraph title: Cloning of L-asparaginase gene from E. carotovora and expression in E. coli ... The resulting construct was sequenced using ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Corporation) along both strands to confirm the right construct.

    Article Title: Three-stage biochemical selection: cloning of prototype class IIS/IIC/IIG restriction endonuclease-methyltransferase TsoI from the thermophile Thermus scotoductus
    Article Snippet: The expression vector pET21NS (Fermentas) was a modification of the pET21 vector (Novagen, WI, USA) (AmpR, MCS, col E1 ori , f1 ori , and T7-lac promoter), containing NotI and SmiI restriction sites introduced into MCS. .. Sequencing was carried out using the ABI Prism 310 automated sequencer with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Applied Biosystems, Foster City, CA, USA).

    Article Title: A probable aculeacin A acylase from the Ralstonia solanacearum GMI1000 is N-acyl-homoserine lactone acylase with quorum-quenching activity
    Article Snippet: Paragraph title: Cloning and expression of aac gene ... Next, the cloned aac gene was sequenced by an ABI PRISM 3730XL DNA Analyzer along with an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer).

    Modification:

    Article Title: Chloroplastic and nuclear diversity of wild beets at a large geographical scale: Insights into the evolutionary history of the Beta section, et al. Chloroplastic and nuclear diversity of wild beets at a large geographical scale: Insights into the evolutionary history of the Beta section
    Article Snippet: The set of primers (forward/reverse) used was 5′‐GTTGCCCGGGATTCGAA‐3′/5′‐ATTAGGGCATCCCATTAGTA‐3′ for the first part of K1K2 (annealing temperature [T a ] = 54°C for the Beta section/58°C for the Corollinae section) (modified from Grivet & Petit, ) and 5′‐CTAGCACAAGAAAGTCGAAG‐3′/5′‐GGATTTCTAACCATCTTGTT‐3′ for the second part of K1K2 (T a = 50°C/58°C); 5′‐ACCAATTGAACTACAATCCC‐3′/5′‐CTACCACTGAGTTAAAAGGG‐3′ for DT (T a = 56.5°C/58°C) (Grivet & Petit, ); 5′‐GGTTCAAGTCCCTCTATCCC‐3′/5′‐ATTTGAACTGGTGACACGAG‐3′ for LF (T a = 57.5°C) (Taberlet et al., ); 5′‐CGACCAAAATAACCATGAGC‐3′/5′‐GCTATGCATGGTTCCTTGGT‐3′ for HK (T a = 57°C). .. The PCR products were then purified using a QIAquick PCR Purification Kit (QIAGEN, Inc., Valencia, CA, USA) and directly sequenced with an ABI Prism™ BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin‐Elmer, Norwalk, CT, USA).

    Article Title: Three-stage biochemical selection: cloning of prototype class IIS/IIC/IIG restriction endonuclease-methyltransferase TsoI from the thermophile Thermus scotoductus
    Article Snippet: The expression vector pET21NS (Fermentas) was a modification of the pET21 vector (Novagen, WI, USA) (AmpR, MCS, col E1 ori , f1 ori , and T7-lac promoter), containing NotI and SmiI restriction sites introduced into MCS. .. Sequencing was carried out using the ABI Prism 310 automated sequencer with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Applied Biosystems, Foster City, CA, USA).

    Article Title: Selection and Phylogenetics of Salmonid MHC Class I: Wild Brown Trout (Salmo trutta) Differ from a Non-Native Introduced Strain
    Article Snippet: Ligation of the purified cDNA into pGEM®-T Easy Vector and cloning was done as per the manufacturers' instructions with a minor modification (samples were spun down and 850 µl of the supernatant removed to facilitate concentration of the bacterial cells). .. Both strands of five clones from each of the subsequent PCR amplifications were sequenced using the ABI Prism Bigdye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer, Branchbury, USA) and the T7 and SP6 primers, and analysed on an ABI 377 automated sequencer (Applied Biosystems, Foster City, USA).

    Western Blot:

    Article Title: Cloning, expression, purification and characterisation of Erwinia carotovora L-asparaginase in Escherichia coli
    Article Snippet: The resulting construct was sequenced using ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Corporation) along both strands to confirm the right construct. .. The resulting construct was sequenced using ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Corporation) along both strands to confirm the right construct.

    Transformation Assay:

    Article Title: Intergenomic Arms Races: Detection of a Nuclear Rescue Gene of Male-Killing in a Ladybird
    Article Snippet: The resulting plasmids were transformed into E. coli DH5α as described by Hurst et al. . .. Inserts were sequenced using the ABI PRISM BigDye Terminator cycle-sequencing ready-reaction kit (Perkin Elmer) and visualised on an ABI 377 automated sequencer.

    Article Title: Evidence for a novel protease governing regulated intramembrane proteolysisand resistance to antimicrobial peptides in Bacillus subtilis
    Article Snippet: DNA from the transposon library was pooled and transformed into an sdpI mutant, and selecting for the transposon was followed by screening for resistance to SdpC. .. The resulting PCR products were then sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer) and either primer CDEP165 or CDEP166, according to the manufacturer’s instructions.

    Article Title: A probable aculeacin A acylase from the Ralstonia solanacearum GMI1000 is N-acyl-homoserine lactone acylase with quorum-quenching activity
    Article Snippet: Eighty ng of the purified PCR product was added into 15 μl of the ligation mixture (50 ng of Kpn I/Spe I-digested pBBR1MCS-3, 1× ligation buffer, and 5 U T4 DNA ligase) and incubated at 16°C for 16 h. The resulting construct, pS3aac, was transformed into E. coli DH10B by the heat shock method [ ] and screened on LB agar containing tetracycline (10 μg·ml-1 ), isopropyl-β-D-thiogalactopyranoside (IPTG, 50 μg·ml-1 ), and 5-bromo-4-chloro-3-indolyl-D-galactoside (X-Gal, 50 μg·ml-1 ). .. Next, the cloned aac gene was sequenced by an ABI PRISM 3730XL DNA Analyzer along with an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer).

    Chromatography:

    Article Title: Selection and Phylogenetics of Salmonid MHC Class I: Wild Brown Trout (Salmo trutta) Differ from a Non-Native Introduced Strain
    Article Snippet: The ∼600 bp cDNA products were purified on micro bio-spin chromatography columns with 600 µl of Sephacryl S-400 HR matrix. .. Both strands of five clones from each of the subsequent PCR amplifications were sequenced using the ABI Prism Bigdye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer, Branchbury, USA) and the T7 and SP6 primers, and analysed on an ABI 377 automated sequencer (Applied Biosystems, Foster City, USA).

    Ligation:

    Article Title: A probable aculeacin A acylase from the Ralstonia solanacearum GMI1000 is N-acyl-homoserine lactone acylase with quorum-quenching activity
    Article Snippet: Eighty ng of the purified PCR product was added into 15 μl of the ligation mixture (50 ng of Kpn I/Spe I-digested pBBR1MCS-3, 1× ligation buffer, and 5 U T4 DNA ligase) and incubated at 16°C for 16 h. The resulting construct, pS3aac, was transformed into E. coli DH10B by the heat shock method [ ] and screened on LB agar containing tetracycline (10 μg·ml-1 ), isopropyl-β-D-thiogalactopyranoside (IPTG, 50 μg·ml-1 ), and 5-bromo-4-chloro-3-indolyl-D-galactoside (X-Gal, 50 μg·ml-1 ). .. Next, the cloned aac gene was sequenced by an ABI PRISM 3730XL DNA Analyzer along with an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer).

    Article Title: Selection and Phylogenetics of Salmonid MHC Class I: Wild Brown Trout (Salmo trutta) Differ from a Non-Native Introduced Strain
    Article Snippet: Ligation of the purified cDNA into pGEM®-T Easy Vector and cloning was done as per the manufacturers' instructions with a minor modification (samples were spun down and 850 µl of the supernatant removed to facilitate concentration of the bacterial cells). .. Both strands of five clones from each of the subsequent PCR amplifications were sequenced using the ABI Prism Bigdye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer, Branchbury, USA) and the T7 and SP6 primers, and analysed on an ABI 377 automated sequencer (Applied Biosystems, Foster City, USA).

    Genomic Sequencing:

    Article Title: Multiplex amplification refractory mutation system (MARMS) for the detection of β-globin gene mutations among the transfusion-dependent β-thalassemia Malay patients in Kelantan, Northeast of Peninsular Malaysia
    Article Snippet: Paragraph title: Genomic sequencing ... Based on the results, those which were not detected by MARMS were sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Applied Biosystems Division, USA).

    Generated:

    Article Title: Screening for Mutations in the TBX1 Gene on Chromosome 22q11.2 in Schizophrenia
    Article Snippet: Optimal PCR primer sequences were generated to each exon of the TBX1 gene using Primer3 website ( http://bioinfo.ut.ee/primer3-0.4.0/primer3/ ). .. The purified PCR products were sequencing using an ABI Prism™ BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (version 3.1) and an ABI autosequencer 3730 (Perkin Elmer Applied Biosystem, Foster City, CA, USA) according to the manufacturer’s protocol.

    Article Title: Vascular endothelial dysfunction resulting from l-arginine deficiency in a patient with lysinuric protein intolerance
    Article Snippet: The PCR products were purified from a 1% agarose gel and sequenced in both directions using an automated DNA sequencer (model 310) using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (both, Perkin-Elmer, Courtaboeuf, France). .. The PCR products were purified from a 1% agarose gel and sequenced in both directions using an automated DNA sequencer (model 310) using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (both, Perkin-Elmer, Courtaboeuf, France).

    DNA Sequencing:

    Article Title: CTP synthase 1 deficiency in humans reveals its central role in lymphocyte proliferation
    Article Snippet: Paragraph title: Genomic DNA sequencing ... PCR products were amplified using high fidelity Platinum Taq DNA Polymerase (Invitrogen) according to the manufacturer’s recommendations, purified with the QIAquick gel extraction kit (Qiagen) and sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer) according to the manufacturer’s recommendations.

    Article Title: Phylogeographical structure and demographic expansion in the endemic alpine stream salamander (Hynobiidae: Batrachuperus) of the Qinling Mountains
    Article Snippet: The reaction mixture was amplified using an MBS Satellite thermal cycler (Thermo Electron Corp., USA). .. The amplified DNA products were purified, and automated DNA sequencing was performed on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Biosystems). .. Sequence data were carefully inspected by eye using BioEdit 7.1.3.0 , and sequences immediately next to the sequencing primer were excluded.

    Article Title: Protein Engineering of the Transcriptional Activator FhlA To Enhance Hydrogen Production in Escherichia coli
    Article Snippet: Paragraph title: Plasmid isolation, SDS-PAGE, and DNA sequencing. ... A dideoxy chain termination method ( ) with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Wellesley, MA) was used to determine the nucleotide changes in the fhlA alleles; the primers used for sequencing are given in Table S2 in the supplemental material.

    Sequencing:

    Article Title: CTP synthase 1 deficiency in humans reveals its central role in lymphocyte proliferation
    Article Snippet: Oligonucleotide primers flanking the 3′ region of intron 17-18 and exon 18 of CTPS1 were used to amplify genomic DNA: Forward 5′-AGAGTTGGTGGTAGGGTGTGTGAC-3′ and reverse 5′-CTTGCAATCGCAGTGTGTTATCAC-3′. .. PCR products were amplified using high fidelity Platinum Taq DNA Polymerase (Invitrogen) according to the manufacturer’s recommendations, purified with the QIAquick gel extraction kit (Qiagen) and sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer) according to the manufacturer’s recommendations. .. All collected sequences were analysed using 4peaks software (Version 1.7.2; A. Griekspoor and T. Groothuis, http://nucleobytes.com/index.php/4peaks ).

    Article Title: Targeted genomic capture and massively parallel sequencing to identify genes for hereditary hearing loss in middle eastern families
    Article Snippet: Although thousands of variants were detected in each proband (both SNPs and indels), this analysis yielded a small number of variants that may affect protein function. .. Sequencing was performed using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Applied Biosystems, Foster City, CA, USA) and an ABI 377 DNA sequencer. .. For screening unrelated deaf individuals and population controls, restriction enzyme assays were designed for detection of CDH23 c.7903G > T (p.V2635F); TMC1 c.1810C > T (p.R604X), c.1939T > C (p.S647P) and c.1210T > C, W404R; MYO15A c.8183G > A (p.R2728H) and c.373delCG (p.R125VfsX101); and TECTA c.5597C > T (p.T1866M) (Additional file ).

    Article Title: Phylogeographical structure and demographic expansion in the endemic alpine stream salamander (Hynobiidae: Batrachuperus) of the Qinling Mountains
    Article Snippet: The reaction mixture was amplified using an MBS Satellite thermal cycler (Thermo Electron Corp., USA). .. The amplified DNA products were purified, and automated DNA sequencing was performed on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Biosystems). .. Sequence data were carefully inspected by eye using BioEdit 7.1.3.0 , and sequences immediately next to the sequencing primer were excluded.

    Article Title: Vicariance and Its Impact on the Molecular Ecology of a Chinese Ranid Frog Species-Complex (Odorrana schmackeri, Ranidae)
    Article Snippet: The PCR products were separated by electrophoresis in 1.5% agarose gels, then were purified by DNA Gel Extraction Kit (V-gene, Hangzhou, China) with ABI 3730 (Shanghai Sangon Biotechnology Co., Ltd., Shanghai, China). .. The DNA products were purified, and then sequenced in both directions on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Biosystems). .. Sequences were edited and aligned manually using BIOEDIT version 7.0.9.0 [ ], and the protein coding region ND2 was translated into amino acids for confirmation of alignment.

    Article Title: Structural and Content Diversity of Mitochondrial Genome in Beet: A Comparative Genomic Analysis
    Article Snippet: PCR mixture underwent the following conditions on a Mastercycler ep (Eppendorf): 5 min denaturing at 95 °C, 35 cycles of 40 s denaturing at 95 °C, 45 s annealing at Annealing temperature ( supplementary table S1 , Supplementary Material online), and from 1 to 2 min extension (depending on the fragment length) at 72 °C and a final extension step at 72 °C for 10 min, after 35 cycles. .. The PCR products were then purified using a Nucleospon 96 Extract kit (Macherey-Nagel) and directly sequenced with an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer). .. Sequence data were obtained on a 3130xl Genetic Analyzer (Applied Biosystems).

    Article Title: Multiplex amplification refractory mutation system (MARMS) for the detection of β-globin gene mutations among the transfusion-dependent β-thalassemia Malay patients in Kelantan, Northeast of Peninsular Malaysia
    Article Snippet: The amplicon integrity was in the range of 1.8-2.0 of 260/280 wavelength. .. Based on the results, those which were not detected by MARMS were sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Applied Biosystems Division, USA). .. The sequencing was performed by First BASE Laboratory Sdn Bhd (Selangor, Malaysia).

    Article Title: Protein Engineering of the Transcriptional Activator FhlA To Enhance Hydrogen Production in Escherichia coli
    Article Snippet: The formation of recombinant proteins under the conditions used for the hydrogen assay was analyzed with standard Laemmli discontinuous sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (12%) ( ). .. A dideoxy chain termination method ( ) with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Wellesley, MA) was used to determine the nucleotide changes in the fhlA alleles; the primers used for sequencing are given in Table S2 in the supplemental material. .. The expression data for the whole-transcriptome analysis of JW2701-1(pVSC133) and JW2701-1(pASKA2701) have been deposited in the NCBI Gene Expression Omnibus (GEO) ( ) and are accessible as .

    Article Title: Chloroplastic and nuclear diversity of wild beets at a large geographical scale: Insights into the evolutionary history of the Beta section, et al. Chloroplastic and nuclear diversity of wild beets at a large geographical scale: Insights into the evolutionary history of the Beta section
    Article Snippet: PCR mixture underwent the following conditions on a 9700 thermal cycler (Perkin‐Elmer, Norwalk, CT, USA): 12‐min denaturing at 94°C, 40 cycles of 30″ denaturing at 94°C, 45″ annealing at T a (see above) and from 1 to 2 min extension (depending on the fragment length) at 72°C and a final extension step at 72°C for 10 min, after 40 cycles. .. The PCR products were then purified using a QIAquick PCR Purification Kit (QIAGEN, Inc., Valencia, CA, USA) and directly sequenced with an ABI Prism™ BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin‐Elmer, Norwalk, CT, USA). .. Sequence data were obtained on a 3100‐Avant Genetic Analyser (Applied Biosystems).

    Article Title: OPA1-related dominant optic atrophy is not strongly influenced by mitochondrial DNA background
    Article Snippet: The results of the amplification were then purified using ExoSAP-IT® technology. .. Finally, starting from position 16050, at least 725 pb of the mitochondrial DNA control region were double-strand sequenced using an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer® ). .. The same primers were used for amplification and sequencing, L15832 and H408, together with 2 additional primers: L16200 (light chain, nps 16194–16217) and H263 (heavy chain nps 263–285).

    Article Title: Cloning, expression, purification and characterisation of Erwinia carotovora L-asparaginase in Escherichia coli
    Article Snippet: Several successful colonies were analyzed using miniprep and the purified plasmids were digested to linear the construct and analyzed on agarose gel using 1 kb marker (Bioline). .. The resulting construct was sequenced using ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Corporation) along both strands to confirm the right construct. .. E. coli cells, harboring plasmid, were grown at 37°C in LB medium containing 100 μg/ml ampicillin.

    Article Title: Screening for Mutations in the TBX1 Gene on Chromosome 22q11.2 in Schizophrenia
    Article Snippet: PCR cycling conditions consisted of an initial denaturation at 95 °C for 1 min, the optimal annealing temperature of each amplicon for 1 min, and 72 °C for 1 min. After PCR amplification, aliquots of PCR products were processed using an IllustraTM ExoProStarTM 1-Step Kit (GE Healthcare Bio-Sciences Corp., NJ, USA) to remove residual primers and dNTPs following the manufacturer’s protocol. .. The purified PCR products were sequencing using an ABI Prism™ BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (version 3.1) and an ABI autosequencer 3730 (Perkin Elmer Applied Biosystem, Foster City, CA, USA) according to the manufacturer’s protocol. .. Repeat PCR and sequencing verified all variants in both directions.

    Article Title: Three-stage biochemical selection: cloning of prototype class IIS/IIC/IIG restriction endonuclease-methyltransferase TsoI from the thermophile Thermus scotoductus
    Article Snippet: All other reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA). .. Sequencing was carried out using the ABI Prism 310 automated sequencer with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Applied Biosystems, Foster City, CA, USA). .. The sequence data were analysed using ABI Chromas 1.45 software (Perkin Elmer Applied Biosystems) and either Vector NTI (Invitrogen, CA, USA) or DNAIS MAX /DNASIS 2.5 software (Hitachi Software, San Bruno, CA, USA).

    Article Title: Vascular endothelial dysfunction resulting from l-arginine deficiency in a patient with lysinuric protein intolerance
    Article Snippet: PCR conditions were as follows: hot start for 3 minutes at 96°C; 35 cycles of denaturing (96°C, 30 seconds), annealing (58°C, 30 seconds), and extension (72°C, 2 minutes). .. The PCR products were purified from a 1% agarose gel and sequenced in both directions using an automated DNA sequencer (model 310) using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (both, Perkin-Elmer, Courtaboeuf, France). .. Studies were performed in an isolated and temperature-controlled (22–24°C) room while the study subjects were in the fasting state.

    Article Title: Evidence for a novel protease governing regulated intramembrane proteolysisand resistance to antimicrobial peptides in Bacillus subtilis
    Article Snippet: The prsW mutants were sequenced by PCR-amplifying the prsW mutant alleles using primers CDEP167 and CDEP170. .. The resulting PCR products were then sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer) and either primer CDEP165 or CDEP166, according to the manufacturer’s instructions. .. Solid DS medium was inoculated with ∼5 × 108 cells per milliliter of a 1:1 mixture of a wild-type strain marked with lacZ ( amyE ∷Pcons - lacZ ) and mutant strains.

    Article Title: Absence of zoonotic Bartonella species in questing ticks: First detection of Bartonella clarridgeiae and Rickettsia felis in cat fleas in the Netherlands
    Article Snippet: Midichloria mitochondrii" was amplified from tick lysates of larvae collected in Vrouwenpolder as described [ ], using 5'-GCTACAGCTCTTGCCCGT (IrESF) and 5'-CAAAACCGACTCCCATGGC (IrESR) as primers. .. PCR amplicons were purified with the Qiaquick gel extraction kit (Qiagen Inc.) and sequenced using an ABI PRISM BigDye Terminator Cycle sequencing Ready Reaction kit (Perkin Elmer, Applied Biosystems). .. Sequences were compared with sequences in Genbank using BLAST.

    Article Title: A probable aculeacin A acylase from the Ralstonia solanacearum GMI1000 is N-acyl-homoserine lactone acylase with quorum-quenching activity
    Article Snippet: Then, the positive clones of E. coli DH10B (pS3aac) expressing AHL-degrading activity were identified through the in vitro whole cell bioassay. .. Next, the cloned aac gene was sequenced by an ABI PRISM 3730XL DNA Analyzer along with an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer). .. The aac gene was amplified by PCR with the primers 5'-CGCA GAATTC ATGACGCACGGATTC-3' (the Eco RI site is underlined) and 5'-CGGC AAGCTT CTGCGACAGCTTTG-3' (the Hin dIII site is underlined), and then ligated to vector pET21a (Novagen).

    Article Title: Complete Genome Analysis of Three Acinetobacter baumannii Clinical Isolates in China for Insight into the Diversification of Drug Resistance Elements
    Article Snippet: PCR reactions were carried out in a Peltier PTC225 thermal cycler (MJ Research Inc., Watertown, MA). .. Sequencing reactions were performed with the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer Applied Biosystems). .. Data analysis and sequence alignments were carried out with the MegAlign software (DNASTAR).

    Article Title: Diversity Arrays Technology (DArT) for Pan-Genomic Evolutionary Studies of Non-Model Organisms
    Article Snippet: Exons 14 to 16 of the single-copy nuclear locus pgi C were amplified using primers 14F and16R according to Ishikawa et al. . .. Bidirectional cycle sequencing was carried out on an ABI 3730 capillary DNA sequencer using ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer) and the same primers used for amplification. .. Sequence contigs were assembled and automatically aligned with subsequent manual corrections using SeqMan and MegAlign respectively (v. 6.00 Lasergene, DNAstar, Madison, WI, USA).

    Recombinant:

    Article Title: Protein Engineering of the Transcriptional Activator FhlA To Enhance Hydrogen Production in Escherichia coli
    Article Snippet: The formation of recombinant proteins under the conditions used for the hydrogen assay was analyzed with standard Laemmli discontinuous sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (12%) ( ). .. A dideoxy chain termination method ( ) with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Wellesley, MA) was used to determine the nucleotide changes in the fhlA alleles; the primers used for sequencing are given in Table S2 in the supplemental material.

    DNA Extraction:

    Article Title: Phylogeographical structure and demographic expansion in the endemic alpine stream salamander (Hynobiidae: Batrachuperus) of the Qinling Mountains
    Article Snippet: Paragraph title: Sample collection, DNA extraction and sequence amplification ... The amplified DNA products were purified, and automated DNA sequencing was performed on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Biosystems).

    Article Title: Vicariance and Its Impact on the Molecular Ecology of a Chinese Ranid Frog Species-Complex (Odorrana schmackeri, Ranidae)
    Article Snippet: Paragraph title: DNA extraction, PCR amplification and sequencing ... The DNA products were purified, and then sequenced in both directions on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Biosystems).

    Article Title: Structural and Content Diversity of Mitochondrial Genome in Beet: A Comparative Genomic Analysis
    Article Snippet: Paragraph title: Chloroplastic DNA Isolation and Sequencing ... The PCR products were then purified using a Nucleospon 96 Extract kit (Macherey-Nagel) and directly sequenced with an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer).

    Nucleic Acid Electrophoresis:

    Article Title: Protein Engineering of the Transcriptional Activator FhlA To Enhance Hydrogen Production in Escherichia coli
    Article Snippet: The formation of recombinant proteins under the conditions used for the hydrogen assay was analyzed with standard Laemmli discontinuous sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (12%) ( ). .. A dideoxy chain termination method ( ) with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Wellesley, MA) was used to determine the nucleotide changes in the fhlA alleles; the primers used for sequencing are given in Table S2 in the supplemental material.

    Mutagenesis:

    Article Title: CTP synthase 1 deficiency in humans reveals its central role in lymphocyte proliferation
    Article Snippet: The estimated frequency of the CTPS1 mutation in the populations was calculated according to the Hardy-Weinberg law. .. PCR products were amplified using high fidelity Platinum Taq DNA Polymerase (Invitrogen) according to the manufacturer’s recommendations, purified with the QIAquick gel extraction kit (Qiagen) and sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer) according to the manufacturer’s recommendations.

    Article Title: Vascular endothelial dysfunction resulting from l-arginine deficiency in a patient with lysinuric protein intolerance
    Article Snippet: Paragraph title: RT-PCR, genomic DNA amplification, sequencing, and mutation analysis. ... The PCR products were purified from a 1% agarose gel and sequenced in both directions using an automated DNA sequencer (model 310) using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (both, Perkin-Elmer, Courtaboeuf, France).

    Article Title: Evidence for a novel protease governing regulated intramembrane proteolysisand resistance to antimicrobial peptides in Bacillus subtilis
    Article Snippet: The prsW mutants were sequenced by PCR-amplifying the prsW mutant alleles using primers CDEP167 and CDEP170. .. The resulting PCR products were then sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer) and either primer CDEP165 or CDEP166, according to the manufacturer’s instructions.

    Isolation:

    Article Title: CTP synthase 1 deficiency in humans reveals its central role in lymphocyte proliferation
    Article Snippet: Genomic DNA from peripheral blood cells, EBV-B cell lines and/or fibroblasts of patients, their parents, and other family members was isolated according to standard methods. .. PCR products were amplified using high fidelity Platinum Taq DNA Polymerase (Invitrogen) according to the manufacturer’s recommendations, purified with the QIAquick gel extraction kit (Qiagen) and sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer) according to the manufacturer’s recommendations.

    Article Title: Phylogeographical structure and demographic expansion in the endemic alpine stream salamander (Hynobiidae: Batrachuperus) of the Qinling Mountains
    Article Snippet: Genomic DNA was isolated from muscle tissues of the tail using standard phenol-chloroform procedures . .. The amplified DNA products were purified, and automated DNA sequencing was performed on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Biosystems).

    Article Title: Structural and Content Diversity of Mitochondrial Genome in Beet: A Comparative Genomic Analysis
    Article Snippet: Total genomic DNA was isolated from 10–15 mg of dried leaf tissue using Nucleospin Plan Kit (Macherey-Nagel) for genomes A, B, CMS-E, CMS-G, and macrocarpa. .. The PCR products were then purified using a Nucleospon 96 Extract kit (Macherey-Nagel) and directly sequenced with an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer).

    Article Title: Protein Engineering of the Transcriptional Activator FhlA To Enhance Hydrogen Production in Escherichia coli
    Article Snippet: Paragraph title: Plasmid isolation, SDS-PAGE, and DNA sequencing. ... A dideoxy chain termination method ( ) with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Wellesley, MA) was used to determine the nucleotide changes in the fhlA alleles; the primers used for sequencing are given in Table S2 in the supplemental material.

    Article Title: Evidence for a novel protease governing regulated intramembrane proteolysisand resistance to antimicrobial peptides in Bacillus subtilis
    Article Snippet: Paragraph title: Isolation of sdpI suppressor mutations resistant to SdpC ... The resulting PCR products were then sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer) and either primer CDEP165 or CDEP166, according to the manufacturer’s instructions.

    Article Title: Selection and Phylogenetics of Salmonid MHC Class I: Wild Brown Trout (Salmo trutta) Differ from a Non-Native Introduced Strain
    Article Snippet: Plasmid DNA was isolated from single colonies using the QIAGEN® QIAprep spin miniprep kit (QIAGEN, Valencia, CA, USA). .. Both strands of five clones from each of the subsequent PCR amplifications were sequenced using the ABI Prism Bigdye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer, Branchbury, USA) and the T7 and SP6 primers, and analysed on an ABI 377 automated sequencer (Applied Biosystems, Foster City, USA).

    Purification:

    Article Title: CTP synthase 1 deficiency in humans reveals its central role in lymphocyte proliferation
    Article Snippet: Oligonucleotide primers flanking the 3′ region of intron 17-18 and exon 18 of CTPS1 were used to amplify genomic DNA: Forward 5′-AGAGTTGGTGGTAGGGTGTGTGAC-3′ and reverse 5′-CTTGCAATCGCAGTGTGTTATCAC-3′. .. PCR products were amplified using high fidelity Platinum Taq DNA Polymerase (Invitrogen) according to the manufacturer’s recommendations, purified with the QIAquick gel extraction kit (Qiagen) and sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer) according to the manufacturer’s recommendations. .. All collected sequences were analysed using 4peaks software (Version 1.7.2; A. Griekspoor and T. Groothuis, http://nucleobytes.com/index.php/4peaks ).

    Article Title: Phylogeographical structure and demographic expansion in the endemic alpine stream salamander (Hynobiidae: Batrachuperus) of the Qinling Mountains
    Article Snippet: The reaction mixture was amplified using an MBS Satellite thermal cycler (Thermo Electron Corp., USA). .. The amplified DNA products were purified, and automated DNA sequencing was performed on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Biosystems). .. Sequence data were carefully inspected by eye using BioEdit 7.1.3.0 , and sequences immediately next to the sequencing primer were excluded.

    Article Title: Vicariance and Its Impact on the Molecular Ecology of a Chinese Ranid Frog Species-Complex (Odorrana schmackeri, Ranidae)
    Article Snippet: The PCR products were separated by electrophoresis in 1.5% agarose gels, then were purified by DNA Gel Extraction Kit (V-gene, Hangzhou, China) with ABI 3730 (Shanghai Sangon Biotechnology Co., Ltd., Shanghai, China). .. The DNA products were purified, and then sequenced in both directions on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Biosystems). .. Sequences were edited and aligned manually using BIOEDIT version 7.0.9.0 [ ], and the protein coding region ND2 was translated into amino acids for confirmation of alignment.

    Article Title: Structural and Content Diversity of Mitochondrial Genome in Beet: A Comparative Genomic Analysis
    Article Snippet: PCR mixture underwent the following conditions on a Mastercycler ep (Eppendorf): 5 min denaturing at 95 °C, 35 cycles of 40 s denaturing at 95 °C, 45 s annealing at Annealing temperature ( supplementary table S1 , Supplementary Material online), and from 1 to 2 min extension (depending on the fragment length) at 72 °C and a final extension step at 72 °C for 10 min, after 35 cycles. .. The PCR products were then purified using a Nucleospon 96 Extract kit (Macherey-Nagel) and directly sequenced with an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer). .. Sequence data were obtained on a 3130xl Genetic Analyzer (Applied Biosystems).

    Article Title: Multiplex amplification refractory mutation system (MARMS) for the detection of β-globin gene mutations among the transfusion-dependent β-thalassemia Malay patients in Kelantan, Northeast of Peninsular Malaysia
    Article Snippet: 2.2 kb fragment of the whole β-globin gene was amplified by a set of forward and reverse primers namely 833/1338 and PAA respectively, followed by purification. .. Based on the results, those which were not detected by MARMS were sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Applied Biosystems Division, USA).

    Article Title: Chloroplastic and nuclear diversity of wild beets at a large geographical scale: Insights into the evolutionary history of the Beta section, et al. Chloroplastic and nuclear diversity of wild beets at a large geographical scale: Insights into the evolutionary history of the Beta section
    Article Snippet: PCR mixture underwent the following conditions on a 9700 thermal cycler (Perkin‐Elmer, Norwalk, CT, USA): 12‐min denaturing at 94°C, 40 cycles of 30″ denaturing at 94°C, 45″ annealing at T a (see above) and from 1 to 2 min extension (depending on the fragment length) at 72°C and a final extension step at 72°C for 10 min, after 40 cycles. .. The PCR products were then purified using a QIAquick PCR Purification Kit (QIAGEN, Inc., Valencia, CA, USA) and directly sequenced with an ABI Prism™ BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin‐Elmer, Norwalk, CT, USA). .. Sequence data were obtained on a 3100‐Avant Genetic Analyser (Applied Biosystems).

    Article Title: OPA1-related dominant optic atrophy is not strongly influenced by mitochondrial DNA background
    Article Snippet: The results of the amplification were then purified using ExoSAP-IT® technology. .. Finally, starting from position 16050, at least 725 pb of the mitochondrial DNA control region were double-strand sequenced using an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer® ).

    Article Title: Cloning, expression, purification and characterisation of Erwinia carotovora L-asparaginase in Escherichia coli
    Article Snippet: Several successful colonies were analyzed using miniprep and the purified plasmids were digested to linear the construct and analyzed on agarose gel using 1 kb marker (Bioline). .. The resulting construct was sequenced using ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Corporation) along both strands to confirm the right construct.

    Article Title: Intergenomic Arms Races: Detection of a Nuclear Rescue Gene of Male-Killing in a Ladybird
    Article Snippet: Plasmids containing insert DNA were purified using Wizard Minipreps DNA purification system (Promega). .. Inserts were sequenced using the ABI PRISM BigDye Terminator cycle-sequencing ready-reaction kit (Perkin Elmer) and visualised on an ABI 377 automated sequencer.

    Article Title: Screening for Mutations in the TBX1 Gene on Chromosome 22q11.2 in Schizophrenia
    Article Snippet: PCR cycling conditions consisted of an initial denaturation at 95 °C for 1 min, the optimal annealing temperature of each amplicon for 1 min, and 72 °C for 1 min. After PCR amplification, aliquots of PCR products were processed using an IllustraTM ExoProStarTM 1-Step Kit (GE Healthcare Bio-Sciences Corp., NJ, USA) to remove residual primers and dNTPs following the manufacturer’s protocol. .. The purified PCR products were sequencing using an ABI Prism™ BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (version 3.1) and an ABI autosequencer 3730 (Perkin Elmer Applied Biosystem, Foster City, CA, USA) according to the manufacturer’s protocol. .. Repeat PCR and sequencing verified all variants in both directions.

    Article Title: Vascular endothelial dysfunction resulting from l-arginine deficiency in a patient with lysinuric protein intolerance
    Article Snippet: PCR conditions were as follows: hot start for 3 minutes at 96°C; 35 cycles of denaturing (96°C, 30 seconds), annealing (58°C, 30 seconds), and extension (72°C, 2 minutes). .. The PCR products were purified from a 1% agarose gel and sequenced in both directions using an automated DNA sequencer (model 310) using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (both, Perkin-Elmer, Courtaboeuf, France). .. Studies were performed in an isolated and temperature-controlled (22–24°C) room while the study subjects were in the fasting state.

    Article Title: Absence of zoonotic Bartonella species in questing ticks: First detection of Bartonella clarridgeiae and Rickettsia felis in cat fleas in the Netherlands
    Article Snippet: Midichloria mitochondrii" was amplified from tick lysates of larvae collected in Vrouwenpolder as described [ ], using 5'-GCTACAGCTCTTGCCCGT (IrESF) and 5'-CAAAACCGACTCCCATGGC (IrESR) as primers. .. PCR amplicons were purified with the Qiaquick gel extraction kit (Qiagen Inc.) and sequenced using an ABI PRISM BigDye Terminator Cycle sequencing Ready Reaction kit (Perkin Elmer, Applied Biosystems). .. Sequences were compared with sequences in Genbank using BLAST.

    Article Title: A probable aculeacin A acylase from the Ralstonia solanacearum GMI1000 is N-acyl-homoserine lactone acylase with quorum-quenching activity
    Article Snippet: Eighty ng of the purified PCR product was added into 15 μl of the ligation mixture (50 ng of Kpn I/Spe I-digested pBBR1MCS-3, 1× ligation buffer, and 5 U T4 DNA ligase) and incubated at 16°C for 16 h. The resulting construct, pS3aac, was transformed into E. coli DH10B by the heat shock method [ ] and screened on LB agar containing tetracycline (10 μg·ml-1 ), isopropyl-β-D-thiogalactopyranoside (IPTG, 50 μg·ml-1 ), and 5-bromo-4-chloro-3-indolyl-D-galactoside (X-Gal, 50 μg·ml-1 ). .. Next, the cloned aac gene was sequenced by an ABI PRISM 3730XL DNA Analyzer along with an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer).

    Article Title: Selection and Phylogenetics of Salmonid MHC Class I: Wild Brown Trout (Salmo trutta) Differ from a Non-Native Introduced Strain
    Article Snippet: Ligation of the purified cDNA into pGEM®-T Easy Vector and cloning was done as per the manufacturers' instructions with a minor modification (samples were spun down and 850 µl of the supernatant removed to facilitate concentration of the bacterial cells). .. Both strands of five clones from each of the subsequent PCR amplifications were sequenced using the ABI Prism Bigdye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer, Branchbury, USA) and the T7 and SP6 primers, and analysed on an ABI 377 automated sequencer (Applied Biosystems, Foster City, USA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Vascular endothelial dysfunction resulting from l-arginine deficiency in a patient with lysinuric protein intolerance
    Article Snippet: Paragraph title: RT-PCR, genomic DNA amplification, sequencing, and mutation analysis. ... The PCR products were purified from a 1% agarose gel and sequenced in both directions using an automated DNA sequencer (model 310) using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (both, Perkin-Elmer, Courtaboeuf, France).

    SDS Page:

    Article Title: Protein Engineering of the Transcriptional Activator FhlA To Enhance Hydrogen Production in Escherichia coli
    Article Snippet: Paragraph title: Plasmid isolation, SDS-PAGE, and DNA sequencing. ... A dideoxy chain termination method ( ) with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Wellesley, MA) was used to determine the nucleotide changes in the fhlA alleles; the primers used for sequencing are given in Table S2 in the supplemental material.

    Plasmid Preparation:

    Article Title: Protein Engineering of the Transcriptional Activator FhlA To Enhance Hydrogen Production in Escherichia coli
    Article Snippet: Paragraph title: Plasmid isolation, SDS-PAGE, and DNA sequencing. ... A dideoxy chain termination method ( ) with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Wellesley, MA) was used to determine the nucleotide changes in the fhlA alleles; the primers used for sequencing are given in Table S2 in the supplemental material.

    Article Title: Cloning, expression, purification and characterisation of Erwinia carotovora L-asparaginase in Escherichia coli
    Article Snippet: The resulting construct was sequenced using ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Corporation) along both strands to confirm the right construct. .. The resulting construct was sequenced using ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Corporation) along both strands to confirm the right construct.

    Article Title: Three-stage biochemical selection: cloning of prototype class IIS/IIC/IIG restriction endonuclease-methyltransferase TsoI from the thermophile Thermus scotoductus
    Article Snippet: The expression vector pET21NS (Fermentas) was a modification of the pET21 vector (Novagen, WI, USA) (AmpR, MCS, col E1 ori , f1 ori , and T7-lac promoter), containing NotI and SmiI restriction sites introduced into MCS. .. Sequencing was carried out using the ABI Prism 310 automated sequencer with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Applied Biosystems, Foster City, CA, USA).

    Article Title: Selection and Phylogenetics of Salmonid MHC Class I: Wild Brown Trout (Salmo trutta) Differ from a Non-Native Introduced Strain
    Article Snippet: Plasmid DNA was isolated from single colonies using the QIAGEN® QIAprep spin miniprep kit (QIAGEN, Valencia, CA, USA). .. Both strands of five clones from each of the subsequent PCR amplifications were sequenced using the ABI Prism Bigdye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer, Branchbury, USA) and the T7 and SP6 primers, and analysed on an ABI 377 automated sequencer (Applied Biosystems, Foster City, USA).

    Agarose Gel Electrophoresis:

    Article Title: Cloning, expression, purification and characterisation of Erwinia carotovora L-asparaginase in Escherichia coli
    Article Snippet: Several successful colonies were analyzed using miniprep and the purified plasmids were digested to linear the construct and analyzed on agarose gel using 1 kb marker (Bioline). .. The resulting construct was sequenced using ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Corporation) along both strands to confirm the right construct.

    Article Title: Vascular endothelial dysfunction resulting from l-arginine deficiency in a patient with lysinuric protein intolerance
    Article Snippet: PCR conditions were as follows: hot start for 3 minutes at 96°C; 35 cycles of denaturing (96°C, 30 seconds), annealing (58°C, 30 seconds), and extension (72°C, 2 minutes). .. The PCR products were purified from a 1% agarose gel and sequenced in both directions using an automated DNA sequencer (model 310) using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (both, Perkin-Elmer, Courtaboeuf, France). .. Studies were performed in an isolated and temperature-controlled (22–24°C) room while the study subjects were in the fasting state.

    In Vitro:

    Article Title: A probable aculeacin A acylase from the Ralstonia solanacearum GMI1000 is N-acyl-homoserine lactone acylase with quorum-quenching activity
    Article Snippet: Then, the positive clones of E. coli DH10B (pS3aac) expressing AHL-degrading activity were identified through the in vitro whole cell bioassay. .. Next, the cloned aac gene was sequenced by an ABI PRISM 3730XL DNA Analyzer along with an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer).

    Sampling:

    Article Title: Selection and Phylogenetics of Salmonid MHC Class I: Wild Brown Trout (Salmo trutta) Differ from a Non-Native Introduced Strain
    Article Snippet: Paragraph title: Sampling &UBA sequencing ... Both strands of five clones from each of the subsequent PCR amplifications were sequenced using the ABI Prism Bigdye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer, Branchbury, USA) and the T7 and SP6 primers, and analysed on an ABI 377 automated sequencer (Applied Biosystems, Foster City, USA).

    Concentration Assay:

    Article Title: Selection and Phylogenetics of Salmonid MHC Class I: Wild Brown Trout (Salmo trutta) Differ from a Non-Native Introduced Strain
    Article Snippet: Ligation of the purified cDNA into pGEM®-T Easy Vector and cloning was done as per the manufacturers' instructions with a minor modification (samples were spun down and 850 µl of the supernatant removed to facilitate concentration of the bacterial cells). .. Both strands of five clones from each of the subsequent PCR amplifications were sequenced using the ABI Prism Bigdye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer, Branchbury, USA) and the T7 and SP6 primers, and analysed on an ABI 377 automated sequencer (Applied Biosystems, Foster City, USA).

    DNA Purification:

    Article Title: Intergenomic Arms Races: Detection of a Nuclear Rescue Gene of Male-Killing in a Ladybird
    Article Snippet: Plasmids containing insert DNA were purified using Wizard Minipreps DNA purification system (Promega). .. Inserts were sequenced using the ABI PRISM BigDye Terminator cycle-sequencing ready-reaction kit (Perkin Elmer) and visualised on an ABI 377 automated sequencer.

    Article Title: Three-stage biochemical selection: cloning of prototype class IIS/IIC/IIG restriction endonuclease-methyltransferase TsoI from the thermophile Thermus scotoductus
    Article Snippet: Difco media were from Becton- Dickinson (Franklin Lakes, NJ, USA), DNA ladders and protein size standard, DNA purification kits, restriction enzymes, λ DNA, T4 DNA polymerase, T4 DNA ligase, Taq DNA polymerase, alkaline phosphatase and PCR primers were from Thermo Fisher Scientific/Fermentas (Vilnius, Lithuania). .. Sequencing was carried out using the ABI Prism 310 automated sequencer with the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Applied Biosystems, Foster City, CA, USA).

    Marker:

    Article Title: Cloning, expression, purification and characterisation of Erwinia carotovora L-asparaginase in Escherichia coli
    Article Snippet: Several successful colonies were analyzed using miniprep and the purified plasmids were digested to linear the construct and analyzed on agarose gel using 1 kb marker (Bioline). .. The resulting construct was sequenced using ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Corporation) along both strands to confirm the right construct.

    Gel Extraction:

    Article Title: CTP synthase 1 deficiency in humans reveals its central role in lymphocyte proliferation
    Article Snippet: Oligonucleotide primers flanking the 3′ region of intron 17-18 and exon 18 of CTPS1 were used to amplify genomic DNA: Forward 5′-AGAGTTGGTGGTAGGGTGTGTGAC-3′ and reverse 5′-CTTGCAATCGCAGTGTGTTATCAC-3′. .. PCR products were amplified using high fidelity Platinum Taq DNA Polymerase (Invitrogen) according to the manufacturer’s recommendations, purified with the QIAquick gel extraction kit (Qiagen) and sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PerkinElmer) according to the manufacturer’s recommendations. .. All collected sequences were analysed using 4peaks software (Version 1.7.2; A. Griekspoor and T. Groothuis, http://nucleobytes.com/index.php/4peaks ).

    Article Title: Vicariance and Its Impact on the Molecular Ecology of a Chinese Ranid Frog Species-Complex (Odorrana schmackeri, Ranidae)
    Article Snippet: The PCR products were separated by electrophoresis in 1.5% agarose gels, then were purified by DNA Gel Extraction Kit (V-gene, Hangzhou, China) with ABI 3730 (Shanghai Sangon Biotechnology Co., Ltd., Shanghai, China). .. The DNA products were purified, and then sequenced in both directions on an ABI3730 with an ABI PRISM BigDye terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Biosystems).

    Article Title: Absence of zoonotic Bartonella species in questing ticks: First detection of Bartonella clarridgeiae and Rickettsia felis in cat fleas in the Netherlands
    Article Snippet: Midichloria mitochondrii" was amplified from tick lysates of larvae collected in Vrouwenpolder as described [ ], using 5'-GCTACAGCTCTTGCCCGT (IrESF) and 5'-CAAAACCGACTCCCATGGC (IrESR) as primers. .. PCR amplicons were purified with the Qiaquick gel extraction kit (Qiagen Inc.) and sequenced using an ABI PRISM BigDye Terminator Cycle sequencing Ready Reaction kit (Perkin Elmer, Applied Biosystems). .. Sequences were compared with sequences in Genbank using BLAST.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87
    PerkinElmer abi prism bigdye terminator cycle sequencing ready reaction kit
    Abi Prism Bigdye Terminator Cycle Sequencing Ready Reaction Kit, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 87/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism bigdye terminator cycle sequencing ready reaction kit/product/PerkinElmer
    Average 87 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    abi prism bigdye terminator cycle sequencing ready reaction kit - by Bioz Stars, 2019-12
    87/100 stars
      Buy from Supplier

    85
    PerkinElmer abi prism bigdye terminator ready reaction cycle sequencing kit fs
    Abi Prism Bigdye Terminator Ready Reaction Cycle Sequencing Kit Fs, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism bigdye terminator ready reaction cycle sequencing kit fs/product/PerkinElmer
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    abi prism bigdye terminator ready reaction cycle sequencing kit fs - by Bioz Stars, 2019-12
    85/100 stars
      Buy from Supplier

    Image Search Results