abi prism bigdye terminator cycle sequencing ready reaction kit v3 1  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher abi prism bigdye terminator cycle sequencing ready reaction kit v3 1
    Abi Prism Bigdye Terminator Cycle Sequencing Ready Reaction Kit V3 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism bigdye terminator cycle sequencing ready reaction kit v3 1/product/Thermo Fisher
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    abi prism bigdye terminator cycle sequencing ready reaction kit v3 1 - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Distribution of HIV-1 Infection in Different T Lymphocyte Subsets: Antiretroviral Therapy-Na?ve vs. Experienced Patients
    Article Snippet: Paragraph title: Cloning and sequencing of C2V3 amplicons ... The plasmid preparations were purified by the PCR purification EXO-SAP reaction, consisting of a mixture of E. coli exonuclease I (Epicentre®, Madison, WI) and shrimp alkaline phosphatase (Roche Molecular System, Indianapolis, IN) followed by treatment with a Big Dye® Terminator™ v3.1 Cycle sequencing Kit (Applied Biosystems, Foster City, CA).

    Amplification:

    Article Title: Fungal endophytes in above-ground tissues of desert plants: infrequent in culture, but highly diverse and distinctive symbionts
    Article Snippet: When amplification with these primers failed, we amplified only ITSrDNA using primers ITS1F or ITS5 and ITS4 [ ]. .. PCR products were verified by gel electrophoresis, cleaned using ExoSap-IT (Affymetrix; Santa Clara, CA, USA), and sequenced bidirectionally using the Applied Biosystems BigDye Terminator v 3.1 cycle sequencing kit and the original PCR primers on an Applied Biosystems 3730 xl DNA Analyzer (Foster City, CA, USA) at the University of Arizona Genetics Core.

    Article Title: Characterization of the Quasi-Enveloped Hepatitis E Virus Particles Released by the Cellular Exosomal Pathway
    Article Snippet: .. The amplification product was sequenced directly on both strands by use of a BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific) on an ABI Prism 3130xl genetic analyzer (Thermo Fisher Scientific). .. Total RNA was extracted from the exosome fraction or culture supernatant by use of TRIzol-LS reagent.

    Article Title: Carbonic Anhydrase-Related Protein VIII Deficiency Is Associated With a Distinctive Lifelong Gait Disorder in Waddles Mice
    Article Snippet: PCR products from both genomic and cDNA were purified using an AMPure PCR Purification Kit (Agencourt Beverly, MA) and the purified products were sequenced using a BigDye Terminator v3.1 Cycle Sequencing (Applied Biosystems, Foster City, CA). .. The same primers in the amplification of DNA fragments from either genomic DNA or mRNA were also used in the sequencing.

    Article Title: Pre-invasion history and demography shape the genetic variation in the insecticide resistance-related acetylcholinesterase 2 gene in the invasive Colorado potato beetle
    Article Snippet: Primers used in the amplification of gene sequences were obtained from previously described primers [ , ] as well as designed from the published AChE2 , DP1 and JHE Colorado potato beetle genes available from Genbank [Genbank: L41180.1, X86074.1]. .. Sequencing reactions were performed using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and were run on an ABI 3100 automated sequencer.

    Article Title: Fatal Fungemia due to Paracoccidioides lutzii
    Article Snippet: Amplified products were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI) following the manufacturer's instructions. .. The PCR fragments were completely sequenced in an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, CA) using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).

    Article Title: Promoter Methylation Analysis of IDH Genes in Human Gliomas
    Article Snippet: The fourth exons of IDH1 and IDH2 were PCR amplified in separate reactions using primer pairs CATTTGTCTGAAAAACTTTGCTT and TCACATTATTGCCAACATGAC for IDH1 , and GGTTCAAATTCTGGTTGAAAGATG and GCTAGGCGAGGAGCTCCAGT for IDH2 . .. Cycling conditions were, initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. PCR products were sequenced directionally using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), and sequencing reaction products were resolved on a 3730xl DNA Analyzer (Applied Biosystems), according to the manufacturer’s instructions.

    Article Title: Distribution of HIV-1 Infection in Different T Lymphocyte Subsets: Antiretroviral Therapy-Na?ve vs. Experienced Patients
    Article Snippet: Approximately 15 colonies were randomly picked from the plates of the lowest template concentrations that successfully yielded the amplicon; another 15 came from the plates that used x100 higher template concentration. .. The plasmid preparations were purified by the PCR purification EXO-SAP reaction, consisting of a mixture of E. coli exonuclease I (Epicentre®, Madison, WI) and shrimp alkaline phosphatase (Roche Molecular System, Indianapolis, IN) followed by treatment with a Big Dye® Terminator™ v3.1 Cycle sequencing Kit (Applied Biosystems, Foster City, CA).

    Article Title: Divergent selection for opsin gene variation in guppy (Poecilia reticulata) populations of Trinidad and Tobago
    Article Snippet: The amplification conditions were as follows: 3 min at 95 °C; 35 cycles of 30 s at 94 °C; 30 s at 60 °C; and 4 min ( LWS-1 and LWS-3 ), 6 min ( LWS-2 ), 3 min ( LWS-4 ) or 2 min ( SWS1 and SWS2-B ) at 72 °C, followed by 7 min at 72 °C. .. The sequencing reactions were performed using a BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Tokyo, Japan) with the PCR primers and additional internal primers.

    Positive Control:

    Article Title: Fatal Fungemia due to Paracoccidioides lutzii
    Article Snippet: The clinical isolate (no. 9840) presented positive amplification similar to the amplicon found in isolate Pb01 (ATCC MYA-826, positive control) ( ). .. The PCR fragments were completely sequenced in an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, CA) using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: Familial STAG2 germline mutation defines a new human cohesinopathy
    Article Snippet: Paragraph title: Allele-specific PCR and Sanger sequencing ... Sanger sequencing was achieved by standard methods using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems® ) and the Applied Biosystems (ABI) 3130 Genetic Analyzer.

    Article Title: Fungal endophytes in above-ground tissues of desert plants: infrequent in culture, but highly diverse and distinctive symbionts
    Article Snippet: .. PCR products were verified by gel electrophoresis, cleaned using ExoSap-IT (Affymetrix; Santa Clara, CA, USA), and sequenced bidirectionally using the Applied Biosystems BigDye Terminator v 3.1 cycle sequencing kit and the original PCR primers on an Applied Biosystems 3730 xl DNA Analyzer (Foster City, CA, USA) at the University of Arizona Genetics Core. .. DNA sequences were assembled in phred [ ] and phrap [ ] with orchestration by Mesquite v. 1.06 [ ] and then manually verified and edited in Sequencher v. 5.1 (Gene Codes Corporation, Ann Arbor, MI, USA).

    Article Title: Investigation of Chlamydophila spp. in dairy cows with reproductive disorders
    Article Snippet: .. The PCR products were then sequenced with primers 204 pecor and chomp 336 [ ] and with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) in combination with ethanol/EDTA/sodium acetate precipitation according to the protocol of the manufacturer. .. Thermocycling was performed in a GeneAmp 2700 Thermocycler (Applied Biosystems).

    Article Title: Carbonic Anhydrase-Related Protein VIII Deficiency Is Associated With a Distinctive Lifelong Gait Disorder in Waddles Mice
    Article Snippet: .. PCR products from both genomic and cDNA were purified using an AMPure PCR Purification Kit (Agencourt Beverly, MA) and the purified products were sequenced using a BigDye Terminator v3.1 Cycle Sequencing (Applied Biosystems, Foster City, CA). .. A total of 5-μl sequencing reactions, including 2-μl of Big Dye (plus Half-BD), 10–23 ng of purified DNA template, and 1–3 pmol of either forward or reverse universal sequencing primers, were incubated for 37 cycles at 96° for 180 sec, 50° for 30 sec, and 60° for 180 sec. Unreacted primers were removed by ethanol-acetate precipitation (3.75% 3 m NaOAc, 87.5% nondenatured 100% EtOH, and 8.75% dH2O, pH 4.6).

    Article Title: Pre-invasion history and demography shape the genetic variation in the insecticide resistance-related acetylcholinesterase 2 gene in the invasive Colorado potato beetle
    Article Snippet: ExoI-SAP (Amersham Biosciences) was used to purify the PCR products. .. Sequencing reactions were performed using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and were run on an ABI 3100 automated sequencer.

    Article Title: Fatal Fungemia due to Paracoccidioides lutzii
    Article Snippet: .. The PCR fragments were completely sequenced in an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, CA) using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). ..

    Article Title: Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis
    Article Snippet: Two microgram of the PCR product were mixed with 0.3 μM SprA in 100 μl of the reaction solution containing 10 mM Tris–HCl (pH 8.0), 20 mM NaCl and 0.1 mM DTT. .. DNA pellets were dissolved in TE buffer, gel purified, and directly sequenced using the P107 (for the left half- site of attP ) or P109 (for the right half- site) primers, a BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, WI, USA) and an ABI 3500 DNA analyzer (Thermo Fisher Scientific).

    Article Title: Promoter Methylation Analysis of IDH Genes in Human Gliomas
    Article Snippet: .. Cycling conditions were, initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. PCR products were sequenced directionally using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), and sequencing reaction products were resolved on a 3730xl DNA Analyzer (Applied Biosystems), according to the manufacturer’s instructions. .. Statistics Two-tailed Student t -test was used to compare mean IDH1 and IDH2 promoter methylation levels between IDH-mutant and wildtype tumors.

    Article Title: Distribution of HIV-1 Infection in Different T Lymphocyte Subsets: Antiretroviral Therapy-Na?ve vs. Experienced Patients
    Article Snippet: .. The plasmid preparations were purified by the PCR purification EXO-SAP reaction, consisting of a mixture of E. coli exonuclease I (Epicentre®, Madison, WI) and shrimp alkaline phosphatase (Roche Molecular System, Indianapolis, IN) followed by treatment with a Big Dye® Terminator™ v3.1 Cycle sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequencing reaction was carried out using 3.2 pmol M13 primers (Integrated DNA Technologies, Coralville, IA) M13F 5’-GTAAAACGACGGCCAG-3’ and M13R 5’-CAGGAAACAGCTATGAC-3’.

    Article Title: Divergent selection for opsin gene variation in guppy (Poecilia reticulata) populations of Trinidad and Tobago
    Article Snippet: .. The sequencing reactions were performed using a BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Tokyo, Japan) with the PCR primers and additional internal primers. .. The sequences were determined in both strands using ABI3130 and ABI3170 Genetic Analyzer systems (Applied Biosystems).

    TA Cloning:

    Article Title: Distribution of HIV-1 Infection in Different T Lymphocyte Subsets: Antiretroviral Therapy-Na?ve vs. Experienced Patients
    Article Snippet: Each confirmed amplicon was cloned using TOPO TA Cloning Kit PCR 2.1/4.0 Topo Vectors with One Shot Top 10 chemically competent E. coli (Invitrogen, Carlsbad, CA). .. The plasmid preparations were purified by the PCR purification EXO-SAP reaction, consisting of a mixture of E. coli exonuclease I (Epicentre®, Madison, WI) and shrimp alkaline phosphatase (Roche Molecular System, Indianapolis, IN) followed by treatment with a Big Dye® Terminator™ v3.1 Cycle sequencing Kit (Applied Biosystems, Foster City, CA).

    Immunostaining:

    Article Title: Promoter Methylation Analysis of IDH Genes in Human Gliomas
    Article Snippet: IDH1 and IDH2 mutation assessment In tumors that were negative for IDH R132H immunostaining, IDH1 and IDH2 mutation status was determined by direct DNA sequencing. .. Cycling conditions were, initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. PCR products were sequenced directionally using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), and sequencing reaction products were resolved on a 3730xl DNA Analyzer (Applied Biosystems), according to the manufacturer’s instructions.

    Nested PCR:

    Article Title: Investigation of Chlamydophila spp. in dairy cows with reproductive disorders
    Article Snippet: DNA sequence analysis of the PCR products Amplicons from the nested PCR were purified prior to sequencing by the GFX PCR DNA and Gel Band Purification Kit (Amersham Bioscience Europe). .. The PCR products were then sequenced with primers 204 pecor and chomp 336 [ ] and with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) in combination with ethanol/EDTA/sodium acetate precipitation according to the protocol of the manufacturer.

    Article Title: Comparison of Ahlstrom Grade 226, Munktell TFN, and Whatman 903 Filter Papers for Dried Blood Spot Specimen Collection and Subsequent HIV-1 Load and Drug Resistance Genotyping Analysis
    Article Snippet: Briefly, a 1,084-bp segment of the 5′ region of the pol gene was generated by RT-PCR followed by nested PCR. .. This fragment was purified, sequenced by using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA), and analyzed on an ABI Prism 3730 genetic analyzer (Applied Biosystems).

    Article Title: Characterization of the Quasi-Enveloped Hepatitis E Virus Particles Released by the Cellular Exosomal Pathway
    Article Snippet: The cDNA was then amplified by a nested PCR with KOD FX Neo (Toyobo), using primers HE017 (5′-GTGGTCGATGCCATGGAGGCCCA-3′ [plus-strand sequence from nt 14 to 36 of the HEV genome]) and 166 (5′-AAGGATCCGTCGACATCGAT-3′ [outer sequence of SSP-T]) in the first round (94°C for 2 min followed by 40 cycles of 98°C for 10 s, 53°C for 20 s, and 68°C for 4 min) and primers HE019 (5′-CGATGCCATGGAGGCCCAYCAGTT-3′ [plus-strand sequence from nt 19 to 42 of the HEV genome]) and HE041 (5′-GCCAATGGCGAGCYGACWGTKAA-3′ [Y = T/C, W = A/T, and K = G/T; minus-strand sequence from nt 6381 to 6403 of the HEV genome]) in the second round (94°C for 2 min followed by 30 cycles of 98°C for 10 s, 55°C for 20 s, and 68°C for 4 min). .. The amplification product was sequenced directly on both strands by use of a BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific) on an ABI Prism 3130xl genetic analyzer (Thermo Fisher Scientific).

    Incubation:

    Article Title: Carbonic Anhydrase-Related Protein VIII Deficiency Is Associated With a Distinctive Lifelong Gait Disorder in Waddles Mice
    Article Snippet: PCR products from both genomic and cDNA were purified using an AMPure PCR Purification Kit (Agencourt Beverly, MA) and the purified products were sequenced using a BigDye Terminator v3.1 Cycle Sequencing (Applied Biosystems, Foster City, CA). .. A total of 5-μl sequencing reactions, including 2-μl of Big Dye (plus Half-BD), 10–23 ng of purified DNA template, and 1–3 pmol of either forward or reverse universal sequencing primers, were incubated for 37 cycles at 96° for 180 sec, 50° for 30 sec, and 60° for 180 sec. Unreacted primers were removed by ethanol-acetate precipitation (3.75% 3 m NaOAc, 87.5% nondenatured 100% EtOH, and 8.75% dH2O, pH 4.6).

    Article Title: Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis
    Article Snippet: The reaction mixture was incubated at 37°C for 12 h in the presence of 30% ethylene glycol and 5% glycerol to accumulate the cleavage products ( ). .. DNA pellets were dissolved in TE buffer, gel purified, and directly sequenced using the P107 (for the left half- site of attP ) or P109 (for the right half- site) primers, a BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, WI, USA) and an ABI 3500 DNA analyzer (Thermo Fisher Scientific).

    Modification:

    Article Title: Pre-invasion history and demography shape the genetic variation in the insecticide resistance-related acetylcholinesterase 2 gene in the invasive Colorado potato beetle
    Article Snippet: The purification of the lysate was performed with a slight modification from the protocol in which magnetic particles (MagAttract® Suspension G, QIAGEN) were used to shift DNA through purification phases using a Kingfisher (ThermoScientific) automated purification system. .. Sequencing reactions were performed using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and were run on an ABI 3100 automated sequencer.

    Genotyping Assay:

    Article Title: Comparison of Ahlstrom Grade 226, Munktell TFN, and Whatman 903 Filter Papers for Dried Blood Spot Specimen Collection and Subsequent HIV-1 Load and Drug Resistance Genotyping Analysis
    Article Snippet: Genotyping of the protease and reverse transcriptase (RT) regions of the HIV-1 pol gene was performed by using a broadly sensitive in-house genotyping assay described in detail previously ( , ). .. This fragment was purified, sequenced by using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA), and analyzed on an ABI Prism 3730 genetic analyzer (Applied Biosystems).

    Generated:

    Article Title: Comparison of Ahlstrom Grade 226, Munktell TFN, and Whatman 903 Filter Papers for Dried Blood Spot Specimen Collection and Subsequent HIV-1 Load and Drug Resistance Genotyping Analysis
    Article Snippet: Briefly, a 1,084-bp segment of the 5′ region of the pol gene was generated by RT-PCR followed by nested PCR. .. This fragment was purified, sequenced by using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA), and analyzed on an ABI Prism 3730 genetic analyzer (Applied Biosystems).

    DNA Sequencing:

    Article Title: Carbonic Anhydrase-Related Protein VIII Deficiency Is Associated With a Distinctive Lifelong Gait Disorder in Waddles Mice
    Article Snippet: Paragraph title: DNA sequencing: ... PCR products from both genomic and cDNA were purified using an AMPure PCR Purification Kit (Agencourt Beverly, MA) and the purified products were sequenced using a BigDye Terminator v3.1 Cycle Sequencing (Applied Biosystems, Foster City, CA).

    Article Title: Promoter Methylation Analysis of IDH Genes in Human Gliomas
    Article Snippet: IDH1 and IDH2 mutation assessment In tumors that were negative for IDH R132H immunostaining, IDH1 and IDH2 mutation status was determined by direct DNA sequencing. .. Cycling conditions were, initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. PCR products were sequenced directionally using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), and sequencing reaction products were resolved on a 3730xl DNA Analyzer (Applied Biosystems), according to the manufacturer’s instructions.

    Article Title: Distribution of HIV-1 Infection in Different T Lymphocyte Subsets: Antiretroviral Therapy-Na?ve vs. Experienced Patients
    Article Snippet: The plasmid preparations were purified by the PCR purification EXO-SAP reaction, consisting of a mixture of E. coli exonuclease I (Epicentre®, Madison, WI) and shrimp alkaline phosphatase (Roche Molecular System, Indianapolis, IN) followed by treatment with a Big Dye® Terminator™ v3.1 Cycle sequencing Kit (Applied Biosystems, Foster City, CA). .. DNA sequencing was performed using an ABI 3730 automated DNA sequencer with 48 capillaries.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Comparison of Ahlstrom Grade 226, Munktell TFN, and Whatman 903 Filter Papers for Dried Blood Spot Specimen Collection and Subsequent HIV-1 Load and Drug Resistance Genotyping Analysis
    Article Snippet: Briefly, a 1,084-bp segment of the 5′ region of the pol gene was generated by RT-PCR followed by nested PCR. .. This fragment was purified, sequenced by using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA), and analyzed on an ABI Prism 3730 genetic analyzer (Applied Biosystems).

    Article Title: Characterization of the Quasi-Enveloped Hepatitis E Virus Particles Released by the Cellular Exosomal Pathway
    Article Snippet: To examine whether the full-length HEV genome was incorporated into the particles in exosome fractions, a long-distance RT-PCR method capable of amplifying nearly full-length HEV RNA was performed. .. The amplification product was sequenced directly on both strands by use of a BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific) on an ABI Prism 3130xl genetic analyzer (Thermo Fisher Scientific).

    DNA Extraction:

    Article Title: Pre-invasion history and demography shape the genetic variation in the insecticide resistance-related acetylcholinesterase 2 gene in the invasive Colorado potato beetle
    Article Snippet: DNA extraction was performed using the DNeasy Tissue Kit (QIAGEN) according to the manufacturer’s protocol. .. Sequencing reactions were performed using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and were run on an ABI 3100 automated sequencer.

    Nucleic Acid Electrophoresis:

    Article Title: Fungal endophytes in above-ground tissues of desert plants: infrequent in culture, but highly diverse and distinctive symbionts
    Article Snippet: .. PCR products were verified by gel electrophoresis, cleaned using ExoSap-IT (Affymetrix; Santa Clara, CA, USA), and sequenced bidirectionally using the Applied Biosystems BigDye Terminator v 3.1 cycle sequencing kit and the original PCR primers on an Applied Biosystems 3730 xl DNA Analyzer (Foster City, CA, USA) at the University of Arizona Genetics Core. .. DNA sequences were assembled in phred [ ] and phrap [ ] with orchestration by Mesquite v. 1.06 [ ] and then manually verified and edited in Sequencher v. 5.1 (Gene Codes Corporation, Ann Arbor, MI, USA).

    Mutagenesis:

    Article Title: Familial STAG2 germline mutation defines a new human cohesinopathy
    Article Snippet: Allele-specific PCR was achieved by synthesizing long primers that differed on their 3′ extremity, where the mutation was located. .. Sanger sequencing was achieved by standard methods using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems® ) and the Applied Biosystems (ABI) 3130 Genetic Analyzer.

    Article Title: Promoter Methylation Analysis of IDH Genes in Human Gliomas
    Article Snippet: Paragraph title: IDH1 and IDH2 mutation assessment ... Cycling conditions were, initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. PCR products were sequenced directionally using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), and sequencing reaction products were resolved on a 3730xl DNA Analyzer (Applied Biosystems), according to the manufacturer’s instructions.

    Size-exclusion Chromatography:

    Article Title: Carbonic Anhydrase-Related Protein VIII Deficiency Is Associated With a Distinctive Lifelong Gait Disorder in Waddles Mice
    Article Snippet: PCR products from both genomic and cDNA were purified using an AMPure PCR Purification Kit (Agencourt Beverly, MA) and the purified products were sequenced using a BigDye Terminator v3.1 Cycle Sequencing (Applied Biosystems, Foster City, CA). .. A total of 5-μl sequencing reactions, including 2-μl of Big Dye (plus Half-BD), 10–23 ng of purified DNA template, and 1–3 pmol of either forward or reverse universal sequencing primers, were incubated for 37 cycles at 96° for 180 sec, 50° for 30 sec, and 60° for 180 sec. Unreacted primers were removed by ethanol-acetate precipitation (3.75% 3 m NaOAc, 87.5% nondenatured 100% EtOH, and 8.75% dH2O, pH 4.6).

    Labeling:

    Article Title: Carbonic Anhydrase-Related Protein VIII Deficiency Is Associated With a Distinctive Lifelong Gait Disorder in Waddles Mice
    Article Snippet: PCR products from both genomic and cDNA were purified using an AMPure PCR Purification Kit (Agencourt Beverly, MA) and the purified products were sequenced using a BigDye Terminator v3.1 Cycle Sequencing (Applied Biosystems, Foster City, CA). .. The labeled products were dissolved in 0.02 m m EDTA in HiDi formamide prior to electrophoretically loading onto the SpectruMedix 96 capillary sequencing system.

    Purification:

    Article Title: Investigation of Chlamydophila spp. in dairy cows with reproductive disorders
    Article Snippet: DNA sequence analysis of the PCR products Amplicons from the nested PCR were purified prior to sequencing by the GFX PCR DNA and Gel Band Purification Kit (Amersham Bioscience Europe). .. The PCR products were then sequenced with primers 204 pecor and chomp 336 [ ] and with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) in combination with ethanol/EDTA/sodium acetate precipitation according to the protocol of the manufacturer.

    Article Title: Comparison of Ahlstrom Grade 226, Munktell TFN, and Whatman 903 Filter Papers for Dried Blood Spot Specimen Collection and Subsequent HIV-1 Load and Drug Resistance Genotyping Analysis
    Article Snippet: .. This fragment was purified, sequenced by using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA), and analyzed on an ABI Prism 3730 genetic analyzer (Applied Biosystems). .. The ReCALL software program was used to edit the raw sequences and generate consensus sequences ( ).

    Article Title: Carbonic Anhydrase-Related Protein VIII Deficiency Is Associated With a Distinctive Lifelong Gait Disorder in Waddles Mice
    Article Snippet: .. PCR products from both genomic and cDNA were purified using an AMPure PCR Purification Kit (Agencourt Beverly, MA) and the purified products were sequenced using a BigDye Terminator v3.1 Cycle Sequencing (Applied Biosystems, Foster City, CA). .. A total of 5-μl sequencing reactions, including 2-μl of Big Dye (plus Half-BD), 10–23 ng of purified DNA template, and 1–3 pmol of either forward or reverse universal sequencing primers, were incubated for 37 cycles at 96° for 180 sec, 50° for 30 sec, and 60° for 180 sec. Unreacted primers were removed by ethanol-acetate precipitation (3.75% 3 m NaOAc, 87.5% nondenatured 100% EtOH, and 8.75% dH2O, pH 4.6).

    Article Title: Pre-invasion history and demography shape the genetic variation in the insecticide resistance-related acetylcholinesterase 2 gene in the invasive Colorado potato beetle
    Article Snippet: The purification of the lysate was performed with a slight modification from the protocol in which magnetic particles (MagAttract® Suspension G, QIAGEN) were used to shift DNA through purification phases using a Kingfisher (ThermoScientific) automated purification system. .. Sequencing reactions were performed using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and were run on an ABI 3100 automated sequencer.

    Article Title: Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis
    Article Snippet: .. DNA pellets were dissolved in TE buffer, gel purified, and directly sequenced using the P107 (for the left half- site of attP ) or P109 (for the right half- site) primers, a BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, WI, USA) and an ABI 3500 DNA analyzer (Thermo Fisher Scientific). .. Electrophoresis mobility shift assays DNA fragments containing the att sites were amplified with the primer sets P110/P61 (for attP ; 89 bp), P111/P87 (for attB ; 106 bp), P111/P58 (for attL ; 111 bp), and P7/P87 (for attR ; 132 bp).

    Article Title: Distribution of HIV-1 Infection in Different T Lymphocyte Subsets: Antiretroviral Therapy-Na?ve vs. Experienced Patients
    Article Snippet: .. The plasmid preparations were purified by the PCR purification EXO-SAP reaction, consisting of a mixture of E. coli exonuclease I (Epicentre®, Madison, WI) and shrimp alkaline phosphatase (Roche Molecular System, Indianapolis, IN) followed by treatment with a Big Dye® Terminator™ v3.1 Cycle sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequencing reaction was carried out using 3.2 pmol M13 primers (Integrated DNA Technologies, Coralville, IA) M13F 5’-GTAAAACGACGGCCAG-3’ and M13R 5’-CAGGAAACAGCTATGAC-3’.

    Article Title: Divergent selection for opsin gene variation in guppy (Poecilia reticulata) populations of Trinidad and Tobago
    Article Snippet: All the PCR products were purified by polyethylene glycol precipitation. .. The sequencing reactions were performed using a BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Tokyo, Japan) with the PCR primers and additional internal primers.

    Sequencing:

    Article Title: Familial STAG2 germline mutation defines a new human cohesinopathy
    Article Snippet: .. Sanger sequencing was achieved by standard methods using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems® ) and the Applied Biosystems (ABI) 3130 Genetic Analyzer. .. Sequencing data was analyzed using the software Sequencher version 4.1.4 (Gene Code).

    Article Title: Fungal endophytes in above-ground tissues of desert plants: infrequent in culture, but highly diverse and distinctive symbionts
    Article Snippet: .. PCR products were verified by gel electrophoresis, cleaned using ExoSap-IT (Affymetrix; Santa Clara, CA, USA), and sequenced bidirectionally using the Applied Biosystems BigDye Terminator v 3.1 cycle sequencing kit and the original PCR primers on an Applied Biosystems 3730 xl DNA Analyzer (Foster City, CA, USA) at the University of Arizona Genetics Core. .. DNA sequences were assembled in phred [ ] and phrap [ ] with orchestration by Mesquite v. 1.06 [ ] and then manually verified and edited in Sequencher v. 5.1 (Gene Codes Corporation, Ann Arbor, MI, USA).

    Article Title: Investigation of Chlamydophila spp. in dairy cows with reproductive disorders
    Article Snippet: .. The PCR products were then sequenced with primers 204 pecor and chomp 336 [ ] and with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) in combination with ethanol/EDTA/sodium acetate precipitation according to the protocol of the manufacturer. .. Thermocycling was performed in a GeneAmp 2700 Thermocycler (Applied Biosystems).

    Article Title: Comparison of Ahlstrom Grade 226, Munktell TFN, and Whatman 903 Filter Papers for Dried Blood Spot Specimen Collection and Subsequent HIV-1 Load and Drug Resistance Genotyping Analysis
    Article Snippet: .. This fragment was purified, sequenced by using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA), and analyzed on an ABI Prism 3730 genetic analyzer (Applied Biosystems). .. The ReCALL software program was used to edit the raw sequences and generate consensus sequences ( ).

    Article Title: Characterization of the Quasi-Enveloped Hepatitis E Virus Particles Released by the Cellular Exosomal Pathway
    Article Snippet: .. The amplification product was sequenced directly on both strands by use of a BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific) on an ABI Prism 3130xl genetic analyzer (Thermo Fisher Scientific). .. Total RNA was extracted from the exosome fraction or culture supernatant by use of TRIzol-LS reagent.

    Article Title: Carbonic Anhydrase-Related Protein VIII Deficiency Is Associated With a Distinctive Lifelong Gait Disorder in Waddles Mice
    Article Snippet: .. PCR products from both genomic and cDNA were purified using an AMPure PCR Purification Kit (Agencourt Beverly, MA) and the purified products were sequenced using a BigDye Terminator v3.1 Cycle Sequencing (Applied Biosystems, Foster City, CA). .. A total of 5-μl sequencing reactions, including 2-μl of Big Dye (plus Half-BD), 10–23 ng of purified DNA template, and 1–3 pmol of either forward or reverse universal sequencing primers, were incubated for 37 cycles at 96° for 180 sec, 50° for 30 sec, and 60° for 180 sec. Unreacted primers were removed by ethanol-acetate precipitation (3.75% 3 m NaOAc, 87.5% nondenatured 100% EtOH, and 8.75% dH2O, pH 4.6).

    Article Title: Pre-invasion history and demography shape the genetic variation in the insecticide resistance-related acetylcholinesterase 2 gene in the invasive Colorado potato beetle
    Article Snippet: .. Sequencing reactions were performed using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and were run on an ABI 3100 automated sequencer. .. In general, amplification success was variable.

    Article Title: Fatal Fungemia due to Paracoccidioides lutzii
    Article Snippet: .. The PCR fragments were completely sequenced in an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, CA) using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). ..

    Article Title: Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis
    Article Snippet: .. DNA pellets were dissolved in TE buffer, gel purified, and directly sequenced using the P107 (for the left half- site of attP ) or P109 (for the right half- site) primers, a BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, WI, USA) and an ABI 3500 DNA analyzer (Thermo Fisher Scientific). .. Electrophoresis mobility shift assays DNA fragments containing the att sites were amplified with the primer sets P110/P61 (for attP ; 89 bp), P111/P87 (for attB ; 106 bp), P111/P58 (for attL ; 111 bp), and P7/P87 (for attR ; 132 bp).

    Article Title: Promoter Methylation Analysis of IDH Genes in Human Gliomas
    Article Snippet: .. Cycling conditions were, initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. PCR products were sequenced directionally using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), and sequencing reaction products were resolved on a 3730xl DNA Analyzer (Applied Biosystems), according to the manufacturer’s instructions. .. Statistics Two-tailed Student t -test was used to compare mean IDH1 and IDH2 promoter methylation levels between IDH-mutant and wildtype tumors.

    Article Title: Distribution of HIV-1 Infection in Different T Lymphocyte Subsets: Antiretroviral Therapy-Na?ve vs. Experienced Patients
    Article Snippet: .. The plasmid preparations were purified by the PCR purification EXO-SAP reaction, consisting of a mixture of E. coli exonuclease I (Epicentre®, Madison, WI) and shrimp alkaline phosphatase (Roche Molecular System, Indianapolis, IN) followed by treatment with a Big Dye® Terminator™ v3.1 Cycle sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequencing reaction was carried out using 3.2 pmol M13 primers (Integrated DNA Technologies, Coralville, IA) M13F 5’-GTAAAACGACGGCCAG-3’ and M13R 5’-CAGGAAACAGCTATGAC-3’.

    Article Title: Divergent selection for opsin gene variation in guppy (Poecilia reticulata) populations of Trinidad and Tobago
    Article Snippet: .. The sequencing reactions were performed using a BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Tokyo, Japan) with the PCR primers and additional internal primers. .. The sequences were determined in both strands using ABI3130 and ABI3170 Genetic Analyzer systems (Applied Biosystems).

    IA:

    Article Title: Distribution of HIV-1 Infection in Different T Lymphocyte Subsets: Antiretroviral Therapy-Na?ve vs. Experienced Patients
    Article Snippet: The plasmid preparations were purified by the PCR purification EXO-SAP reaction, consisting of a mixture of E. coli exonuclease I (Epicentre®, Madison, WI) and shrimp alkaline phosphatase (Roche Molecular System, Indianapolis, IN) followed by treatment with a Big Dye® Terminator™ v3.1 Cycle sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequencing reaction was carried out using 3.2 pmol M13 primers (Integrated DNA Technologies, Coralville, IA) M13F 5’-GTAAAACGACGGCCAG-3’ and M13R 5’-CAGGAAACAGCTATGAC-3’.

    Plasmid Preparation:

    Article Title: Distribution of HIV-1 Infection in Different T Lymphocyte Subsets: Antiretroviral Therapy-Na?ve vs. Experienced Patients
    Article Snippet: .. The plasmid preparations were purified by the PCR purification EXO-SAP reaction, consisting of a mixture of E. coli exonuclease I (Epicentre®, Madison, WI) and shrimp alkaline phosphatase (Roche Molecular System, Indianapolis, IN) followed by treatment with a Big Dye® Terminator™ v3.1 Cycle sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequencing reaction was carried out using 3.2 pmol M13 primers (Integrated DNA Technologies, Coralville, IA) M13F 5’-GTAAAACGACGGCCAG-3’ and M13R 5’-CAGGAAACAGCTATGAC-3’.

    Software:

    Article Title: Familial STAG2 germline mutation defines a new human cohesinopathy
    Article Snippet: Sanger sequencing was achieved by standard methods using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems® ) and the Applied Biosystems (ABI) 3130 Genetic Analyzer. .. Sequencing data was analyzed using the software Sequencher version 4.1.4 (Gene Code).

    Article Title: Comparison of Ahlstrom Grade 226, Munktell TFN, and Whatman 903 Filter Papers for Dried Blood Spot Specimen Collection and Subsequent HIV-1 Load and Drug Resistance Genotyping Analysis
    Article Snippet: This fragment was purified, sequenced by using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA), and analyzed on an ABI Prism 3730 genetic analyzer (Applied Biosystems). .. The ReCALL software program was used to edit the raw sequences and generate consensus sequences ( ).

    Article Title: Fatal Fungemia due to Paracoccidioides lutzii
    Article Snippet: The PCR fragments were completely sequenced in an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, CA) using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. The nucleotide sequences were aligned using the Simultaneous Alignment and Tree Estimation software (SATé 2.2.2).

    Concentration Assay:

    Article Title: Distribution of HIV-1 Infection in Different T Lymphocyte Subsets: Antiretroviral Therapy-Na?ve vs. Experienced Patients
    Article Snippet: Approximately 15 colonies were randomly picked from the plates of the lowest template concentrations that successfully yielded the amplicon; another 15 came from the plates that used x100 higher template concentration. .. The plasmid preparations were purified by the PCR purification EXO-SAP reaction, consisting of a mixture of E. coli exonuclease I (Epicentre®, Madison, WI) and shrimp alkaline phosphatase (Roche Molecular System, Indianapolis, IN) followed by treatment with a Big Dye® Terminator™ v3.1 Cycle sequencing Kit (Applied Biosystems, Foster City, CA).

    Variant Assay:

    Article Title: Familial STAG2 germline mutation defines a new human cohesinopathy
    Article Snippet: Allele-specific PCR and Sanger sequencing The presence of the c.980 G > A variant in STAG2 gene in the proband and his relatives was confirmed using allele-specific PCR and Sanger sequencing. .. Sanger sequencing was achieved by standard methods using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems® ) and the Applied Biosystems (ABI) 3130 Genetic Analyzer.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher abi prism bigdye terminator v3 1 cycle sequencing ready reaction kit
    Abi Prism Bigdye Terminator V3 1 Cycle Sequencing Ready Reaction Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism bigdye terminator v3 1 cycle sequencing ready reaction kit/product/Thermo Fisher
    Average 94 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    abi prism bigdye terminator v3 1 cycle sequencing ready reaction kit - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results