abi prism bigdye primer cycle sequencing kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher abi prism bigdye primer cycle sequencing kit
    Abi Prism Bigdye Primer Cycle Sequencing Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism bigdye primer cycle sequencing kit/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    abi prism bigdye primer cycle sequencing kit - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Gene Profiling of Cottontail Rabbit Papillomavirus-Induced Carcinomas Identifies Upregulated Genes Directly Involved in Stroma Invasion as Shown by Small Interfering RNA-Mediated Gene Silencing
    Article Snippet: .. DNA sequencing of the cloned cDNA fragments was carried out by using the M13 reverse primer GAAACAGCTATGACCATG, the T7 promoter primer GTAATACGACTCACTATAGGG, and the BigDye terminator cycle sequencing kit (Applied Biosystems, Warrington, United Kingdom) with an ABI PRISM 310 Genetic Analyzer (Applied Biosystems). ..

    Amplification:

    Article Title: Molecular Characterization of Human and Animal Isolates of Echinococcus granulosus in the Thrace Region, Turkey
    Article Snippet: Thirteen amplicons, representing each unique SSCP and RFLP profile, were selected, and fragments of amplicons mitochondrial CO1 and ND1 genes were amplified with primers published in Bowles et al. ( ) and Sharbatkhori et al. , respectively. .. Sequencing was performed on the ABI 3130 XL Genetic Analyzer (Applied Biosystems, USA) with the BigDye Cycle Sequencing Kit (Applied Biosystems, USA) using the corresponding PCR primers by Refgen Company (Ankara, Turkey).

    Article Title: Infectious hematopoietic necrosis virus (IHNV) persistence in Sockeye Salmon: influence on brain transcriptome and subsequent response to the viral mimic poly(I:C)
    Article Snippet: Amplification was performed on a Mx3000P (Agilent) in a 20 μl reaction that consisted of diluted cDNA, 0.3 μM each of forward and reverse primer and 1X Power SYBR® Green PCR Master Mix (Applied Biosystem). .. PCR amplicons were tested for single products by melt curve analysis and sequenced on an ABI3130xL Genetic Analyzer (Life Technologies™) to confirm identities as per the manufacturer’s protocols using the RT-qPCR primers and a fluorescent dye terminator cycle sequencing kit (Applied Biosystems BigDye Terminator version 3.1).

    Article Title: Clinical and Molecular Characterization of Patients with Fructose 1,6-Bisphosphatase Deficiency
    Article Snippet: The exons and the exon-intron boundaries were amplified using polymerase chain reaction (PCR). .. Sequencing reactions were prepared with the BigDye® Direct Cycle Sequencing Kit (Life Technologies, Thermo Fisher, Waltham, MA, USA).

    Article Title: A Universal Method for Species Identification of Mammals Utilizing Next Generation Sequencing for the Analysis of DNA Mixtures
    Article Snippet: Sanger sequencing and 454 sequencing For the Sanger sequencing, the targeted DNA sequence was amplified using the PCR primers, presented in , tailed with M13-adaptors. .. The PCR amplicons were sequenced by standard Sanger sequencing using BigDye® Direct Cycle Sequencing kit (Applied Biosystems) according to the manufacturer’s protocol.

    Article Title: Germline mutations in the oncogene EZH2 cause Weaver syndrome and increased human height
    Article Snippet: Products were sequenced with the original PCR primers or internal sequencing primers (exons 3 and 20) using the BigDye Terminator Cycle Sequencing Kit and an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA,USA). .. All mutations were confirmed by bidirectional sequencing of a second, independently amplified PCR product.

    Article Title: A new species of the genus Rana from Henan, central China ( Anura, Ranidae)
    Article Snippet: Paragraph title: DNA extraction, amplification, and sequencing ... The cycle sequencing reactions were performed using BigDye Terminator Cycle Sequencing Kit (v.2.0, Applied Biosystems, Foster City, California, USA), using purified products as the template DNA.

    Synthesized:

    Article Title: Infectious hematopoietic necrosis virus (IHNV) persistence in Sockeye Salmon: influence on brain transcriptome and subsequent response to the viral mimic poly(I:C)
    Article Snippet: For each brain sample used in the microarray analysis, first-strand cDNA was synthesized from 400 ng of purified total RNA using the High Capacity RNA-to-cDNA™ Kit (Applied Biosystems) and 2.5 μM (final concentration) oligo d(T)16 primers (Applied Biosystems) according to the manufacturer’s instructions. .. PCR amplicons were tested for single products by melt curve analysis and sequenced on an ABI3130xL Genetic Analyzer (Life Technologies™) to confirm identities as per the manufacturer’s protocols using the RT-qPCR primers and a fluorescent dye terminator cycle sequencing kit (Applied Biosystems BigDye Terminator version 3.1).

    Article Title: Clinical and Molecular Characterization of Patients with Fructose 1,6-Bisphosphatase Deficiency
    Article Snippet: Sanger Sequencing Verification of the FBP1 Gene The primers for amplification of the FBP1 gene (GenBank accession no NM_000507.3) were designed using UCSC ExonPrimer online software ( http://genome.ucsc.edu/index.html ) and synthesized by Map Biotechnology (Shanghai, China). .. Sequencing reactions were prepared with the BigDye® Direct Cycle Sequencing Kit (Life Technologies, Thermo Fisher, Waltham, MA, USA).

    Article Title: Mutation in Mpzl3, a Gene Encoding a Predicted the Adhesion Protein, in the Rough Coat (rc) Mice with Severe Skin and Hair Abnormalities
    Article Snippet: Primers were synthesized at Integrated DNA Technologies (Coralville, IA), and PCR reactions were carried out using both wild-type B6/J and B6/J- rc / rc mouse genomic DNA as templates. .. Sequences from both strands were obtained using the BigDye sequencing kit and an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) at sequencing core facilities (MBSR, CGPBRI, and GMBF) at University of Hawaii at Manoa.

    Quantitative RT-PCR:

    Article Title: Infectious hematopoietic necrosis virus (IHNV) persistence in Sockeye Salmon: influence on brain transcriptome and subsequent response to the viral mimic poly(I:C)
    Article Snippet: .. PCR amplicons were tested for single products by melt curve analysis and sequenced on an ABI3130xL Genetic Analyzer (Life Technologies™) to confirm identities as per the manufacturer’s protocols using the RT-qPCR primers and a fluorescent dye terminator cycle sequencing kit (Applied Biosystems BigDye Terminator version 3.1). .. Primer efficiencies were determined using a serial dilution (2-fold, 5-point) of a pool of undiluted cDNA samples from all experimental conditions.

    SYBR Green Assay:

    Article Title: Infectious hematopoietic necrosis virus (IHNV) persistence in Sockeye Salmon: influence on brain transcriptome and subsequent response to the viral mimic poly(I:C)
    Article Snippet: Amplification was performed on a Mx3000P (Agilent) in a 20 μl reaction that consisted of diluted cDNA, 0.3 μM each of forward and reverse primer and 1X Power SYBR® Green PCR Master Mix (Applied Biosystem). .. PCR amplicons were tested for single products by melt curve analysis and sequenced on an ABI3130xL Genetic Analyzer (Life Technologies™) to confirm identities as per the manufacturer’s protocols using the RT-qPCR primers and a fluorescent dye terminator cycle sequencing kit (Applied Biosystems BigDye Terminator version 3.1).

    Microarray:

    Article Title: Infectious hematopoietic necrosis virus (IHNV) persistence in Sockeye Salmon: influence on brain transcriptome and subsequent response to the viral mimic poly(I:C)
    Article Snippet: For each brain sample used in the microarray analysis, first-strand cDNA was synthesized from 400 ng of purified total RNA using the High Capacity RNA-to-cDNA™ Kit (Applied Biosystems) and 2.5 μM (final concentration) oligo d(T)16 primers (Applied Biosystems) according to the manufacturer’s instructions. .. PCR amplicons were tested for single products by melt curve analysis and sequenced on an ABI3130xL Genetic Analyzer (Life Technologies™) to confirm identities as per the manufacturer’s protocols using the RT-qPCR primers and a fluorescent dye terminator cycle sequencing kit (Applied Biosystems BigDye Terminator version 3.1).

    In Silico:

    Article Title: Clinical and Molecular Characterization of Patients with Fructose 1,6-Bisphosphatase Deficiency
    Article Snippet: The primers designed for exons 3–7 are listed in and the in silico analysis results of the primers are showed in . .. Sequencing reactions were prepared with the BigDye® Direct Cycle Sequencing Kit (Life Technologies, Thermo Fisher, Waltham, MA, USA).

    Expressing:

    Article Title: Infectious hematopoietic necrosis virus (IHNV) persistence in Sockeye Salmon: influence on brain transcriptome and subsequent response to the viral mimic poly(I:C)
    Article Snippet: PCR amplicons were tested for single products by melt curve analysis and sequenced on an ABI3130xL Genetic Analyzer (Life Technologies™) to confirm identities as per the manufacturer’s protocols using the RT-qPCR primers and a fluorescent dye terminator cycle sequencing kit (Applied Biosystems BigDye Terminator version 3.1). .. Relative expression levels were calculated by using the comparative Ct method for relative quantification including primer-specific efficiencies [ ].

    Modification:

    Article Title: Bovine Kobuviruses from Cattle with Diarrhea
    Article Snippet: The presence of bovine kobuvirus in fecal specimens was detected by using RT-PCR with a protocol modified from the method described by Yamashita et al. ( ). .. All the bovine kobuvirus strains detected in our study were analyzed further by direct sequencing of their PCR amplicons with the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on an automated sequencer (ABI 3100, Applied Biosystems).

    Transformation Assay:

    Article Title: The Novel Kasugamycin 2?-N-Acetyltransferase Gene aac(2′)-IIa, Carried by the IncP Island, Confers Kasugamycin Resistance to Rice-Pathogenic Bacteria
    Article Snippet: Procedures for general DNA techniques, such as E. coli transformation, plasmid extraction, restriction enzyme digestion, ligation, and agarose gel electrophoresis were performed essentially as described previously ( ). .. The sequences of ksgA and 16S rRNA genes from B. glumae were determined directly by using Ksg-F (5′-ACCGCGGGCATGACGG-3′) and Ksg-831R (5′-TTCGTTTGATTCTTTCGATGTCGA-3′) primers for the ksgA gene and S705-F (5′-ATGTGGAGGAATACCGATGG-3′) and S1536-R (5′-AAAGGAGGTGATCCAGCC-3′) primers for the 16S rRNA gene with a BigDye Terminator cycle sequencing kit (Applied Biosystems, Inc.).

    High Performance Liquid Chromatography:

    Article Title: A Universal Method for Species Identification of Mammals Utilizing Next Generation Sequencing for the Analysis of DNA Mixtures
    Article Snippet: The PCR amplicons were sequenced by standard Sanger sequencing using BigDye® Direct Cycle Sequencing kit (Applied Biosystems) according to the manufacturer’s protocol. .. For the 454 deep sequencing, the HPLC-purified PCR primers (Biomers) were used with adaptors suitable for the 454 sequencing chemistry on the 454 GS Junior (Roche) ( ).

    Sequencing:

    Article Title: Molecular Characterization of Human and Animal Isolates of Echinococcus granulosus in the Thrace Region, Turkey
    Article Snippet: .. Sequencing was performed on the ABI 3130 XL Genetic Analyzer (Applied Biosystems, USA) with the BigDye Cycle Sequencing Kit (Applied Biosystems, USA) using the corresponding PCR primers by Refgen Company (Ankara, Turkey). ..

    Article Title: Infectious hematopoietic necrosis virus (IHNV) persistence in Sockeye Salmon: influence on brain transcriptome and subsequent response to the viral mimic poly(I:C)
    Article Snippet: .. PCR amplicons were tested for single products by melt curve analysis and sequenced on an ABI3130xL Genetic Analyzer (Life Technologies™) to confirm identities as per the manufacturer’s protocols using the RT-qPCR primers and a fluorescent dye terminator cycle sequencing kit (Applied Biosystems BigDye Terminator version 3.1). .. Primer efficiencies were determined using a serial dilution (2-fold, 5-point) of a pool of undiluted cDNA samples from all experimental conditions.

    Article Title: Clinical and Molecular Characterization of Patients with Fructose 1,6-Bisphosphatase Deficiency
    Article Snippet: .. Sequencing reactions were prepared with the BigDye® Direct Cycle Sequencing Kit (Life Technologies, Thermo Fisher, Waltham, MA, USA). .. The final products were purified from agarose gel using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and the capillary electrophoresis sequencing was performed by using an ABI Prism 3730XL Genetic Analyzer (Applied Biosystems; Thermo Fisher, Waltham, MA, USA) with the forward and reverse primers.

    Article Title: A Universal Method for Species Identification of Mammals Utilizing Next Generation Sequencing for the Analysis of DNA Mixtures
    Article Snippet: .. The PCR amplicons were sequenced by standard Sanger sequencing using BigDye® Direct Cycle Sequencing kit (Applied Biosystems) according to the manufacturer’s protocol. .. Separation, by capillary electrophoresis, was performed on an ABI3500 XL instrument using POP-7 (Applied Biosystems) and the DNA sequences were called using Sequence analysis software v. 5.4 (Applied Biosystems).

    Article Title: Analysis of the Prevalence of HTLV-1 Proviral DNA in Cervical Smears and Carcinomas from HIV Positive and Negative Kenyan Women
    Article Snippet: .. DNA Sequencing The gel-separated DNA bands were excised, isolated, purified and sequenced using an ABI BigDye Cycle sequencing kit (Applied Biosystems, Warrington, UK) as indicated by the manufacturer and a 3100 ABI sequencer (Applied Biosystems, Warrington, UK). ..

    Article Title: Bovine Kobuviruses from Cattle with Diarrhea
    Article Snippet: .. All the bovine kobuvirus strains detected in our study were analyzed further by direct sequencing of their PCR amplicons with the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on an automated sequencer (ABI 3100, Applied Biosystems). ..

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: .. Sequencing was bidirectional and conducted using a BigDye® Terminator Cycle sequencing kit 3.1(Applied Biosystems [ABI], Darmstadt, Germany). .. PCR products were analysed by gel electrophoresis and visualised by GelRed (Biotium Inc, Hayward, CA, USA) staining.

    Article Title: Germline mutations in the oncogene EZH2 cause Weaver syndrome and increased human height
    Article Snippet: .. Products were sequenced with the original PCR primers or internal sequencing primers (exons 3 and 20) using the BigDye Terminator Cycle Sequencing Kit and an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA,USA). .. Sequences were analyzed using Mutation Surveyor software v3.97 (SoftGenetics, State College, PA, USA).

    Article Title: Gene Profiling of Cottontail Rabbit Papillomavirus-Induced Carcinomas Identifies Upregulated Genes Directly Involved in Stroma Invasion as Shown by Small Interfering RNA-Mediated Gene Silencing
    Article Snippet: .. DNA sequencing of the cloned cDNA fragments was carried out by using the M13 reverse primer GAAACAGCTATGACCATG, the T7 promoter primer GTAATACGACTCACTATAGGG, and the BigDye terminator cycle sequencing kit (Applied Biosystems, Warrington, United Kingdom) with an ABI PRISM 310 Genetic Analyzer (Applied Biosystems). ..

    Article Title: A new species of the genus Rana from Henan, central China ( Anura, Ranidae)
    Article Snippet: .. The cycle sequencing reactions were performed using BigDye Terminator Cycle Sequencing Kit (v.2.0, Applied Biosystems, Foster City, California, USA), using purified products as the template DNA. .. Sequences were determined using an ABI PRISM 3730 automated DNA sequencer with sequencing in both directions.

    Article Title: Mutation in Mpzl3, a Gene Encoding a Predicted the Adhesion Protein, in the Rough Coat (rc) Mice with Severe Skin and Hair Abnormalities
    Article Snippet: .. Sequences from both strands were obtained using the BigDye sequencing kit and an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) at sequencing core facilities (MBSR, CGPBRI, and GMBF) at University of Hawaii at Manoa. .. Once the mutation was identified, it was confirmed in four more mice each of both +/+ and rc / rc genotypes from different parents, and in heterozygous (+/ rc ) mice.

    Article Title: The Novel Kasugamycin 2?-N-Acetyltransferase Gene aac(2′)-IIa, Carried by the IncP Island, Confers Kasugamycin Resistance to Rice-Pathogenic Bacteria
    Article Snippet: .. The sequences of ksgA and 16S rRNA genes from B. glumae were determined directly by using Ksg-F (5′-ACCGCGGGCATGACGG-3′) and Ksg-831R (5′-TTCGTTTGATTCTTTCGATGTCGA-3′) primers for the ksgA gene and S705-F (5′-ATGTGGAGGAATACCGATGG-3′) and S1536-R (5′-AAAGGAGGTGATCCAGCC-3′) primers for the 16S rRNA gene with a BigDye Terminator cycle sequencing kit (Applied Biosystems, Inc.). .. DNA sequences were performed on a 3100 DNA sequencer (Applied Biosystems, Inc.).

    Ligation:

    Article Title: The Novel Kasugamycin 2?-N-Acetyltransferase Gene aac(2′)-IIa, Carried by the IncP Island, Confers Kasugamycin Resistance to Rice-Pathogenic Bacteria
    Article Snippet: Procedures for general DNA techniques, such as E. coli transformation, plasmid extraction, restriction enzyme digestion, ligation, and agarose gel electrophoresis were performed essentially as described previously ( ). .. The sequences of ksgA and 16S rRNA genes from B. glumae were determined directly by using Ksg-F (5′-ACCGCGGGCATGACGG-3′) and Ksg-831R (5′-TTCGTTTGATTCTTTCGATGTCGA-3′) primers for the ksgA gene and S705-F (5′-ATGTGGAGGAATACCGATGG-3′) and S1536-R (5′-AAAGGAGGTGATCCAGCC-3′) primers for the 16S rRNA gene with a BigDye Terminator cycle sequencing kit (Applied Biosystems, Inc.).

    Serial Dilution:

    Article Title: Infectious hematopoietic necrosis virus (IHNV) persistence in Sockeye Salmon: influence on brain transcriptome and subsequent response to the viral mimic poly(I:C)
    Article Snippet: PCR amplicons were tested for single products by melt curve analysis and sequenced on an ABI3130xL Genetic Analyzer (Life Technologies™) to confirm identities as per the manufacturer’s protocols using the RT-qPCR primers and a fluorescent dye terminator cycle sequencing kit (Applied Biosystems BigDye Terminator version 3.1). .. Primer efficiencies were determined using a serial dilution (2-fold, 5-point) of a pool of undiluted cDNA samples from all experimental conditions.

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: PCR cycling conditions started with initial denaturation at 95 °C for 3 min, followed by 35 cycles at 94 °C for 30 s, 57 °C for 30 s, 72 °C for 45 s, and terminated with a final elongation step at 72 °C for 4 min. We investigated PCR sensitivity using a serial dilution of Dipylidium DNA extract mixed within faeces from adult captive spotted hyaenas not infected with any species of Dipylidium or other cestode species, at a volume of 1:1. .. Sequencing was bidirectional and conducted using a BigDye® Terminator Cycle sequencing kit 3.1(Applied Biosystems [ABI], Darmstadt, Germany).

    Infection:

    Article Title: Bovine Kobuviruses from Cattle with Diarrhea
    Article Snippet: This finding suggested that bovine kobuvirus is common and that the virus particles could be detected in the stool samples of infected cattle. .. All the bovine kobuvirus strains detected in our study were analyzed further by direct sequencing of their PCR amplicons with the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on an automated sequencer (ABI 3100, Applied Biosystems).

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: PCR cycling conditions started with initial denaturation at 95 °C for 3 min, followed by 35 cycles at 94 °C for 30 s, 57 °C for 30 s, 72 °C for 45 s, and terminated with a final elongation step at 72 °C for 4 min. We investigated PCR sensitivity using a serial dilution of Dipylidium DNA extract mixed within faeces from adult captive spotted hyaenas not infected with any species of Dipylidium or other cestode species, at a volume of 1:1. .. Sequencing was bidirectional and conducted using a BigDye® Terminator Cycle sequencing kit 3.1(Applied Biosystems [ABI], Darmstadt, Germany).

    Generated:

    Article Title: Mutation in Mpzl3, a Gene Encoding a Predicted the Adhesion Protein, in the Rough Coat (rc) Mice with Severe Skin and Hair Abnormalities
    Article Snippet: Sequences from both strands were obtained using the BigDye sequencing kit and an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) at sequencing core facilities (MBSR, CGPBRI, and GMBF) at University of Hawaii at Manoa. .. We also confirmed the mutation in B6/J- rc genomic DNA purchased from the Jackson Laboratory (Bar Harbor, ME) and in PCR-amplified cDNA generated from rc / rc mouse skin RNA.

    DNA Sequencing:

    Article Title: Molecular Characterization of Human and Animal Isolates of Echinococcus granulosus in the Thrace Region, Turkey
    Article Snippet: Paragraph title: Mitochondrial DNA sequencing and phylogenetic analysis ... Sequencing was performed on the ABI 3130 XL Genetic Analyzer (Applied Biosystems, USA) with the BigDye Cycle Sequencing Kit (Applied Biosystems, USA) using the corresponding PCR primers by Refgen Company (Ankara, Turkey).

    Article Title: Analysis of the Prevalence of HTLV-1 Proviral DNA in Cervical Smears and Carcinomas from HIV Positive and Negative Kenyan Women
    Article Snippet: .. DNA Sequencing The gel-separated DNA bands were excised, isolated, purified and sequenced using an ABI BigDye Cycle sequencing kit (Applied Biosystems, Warrington, UK) as indicated by the manufacturer and a 3100 ABI sequencer (Applied Biosystems, Warrington, UK). ..

    Article Title: Gene Profiling of Cottontail Rabbit Papillomavirus-Induced Carcinomas Identifies Upregulated Genes Directly Involved in Stroma Invasion as Shown by Small Interfering RNA-Mediated Gene Silencing
    Article Snippet: .. DNA sequencing of the cloned cDNA fragments was carried out by using the M13 reverse primer GAAACAGCTATGACCATG, the T7 promoter primer GTAATACGACTCACTATAGGG, and the BigDye terminator cycle sequencing kit (Applied Biosystems, Warrington, United Kingdom) with an ABI PRISM 310 Genetic Analyzer (Applied Biosystems). ..

    Polymerase Chain Reaction:

    Article Title: Molecular Characterization of Human and Animal Isolates of Echinococcus granulosus in the Thrace Region, Turkey
    Article Snippet: .. Sequencing was performed on the ABI 3130 XL Genetic Analyzer (Applied Biosystems, USA) with the BigDye Cycle Sequencing Kit (Applied Biosystems, USA) using the corresponding PCR primers by Refgen Company (Ankara, Turkey). ..

    Article Title: Infectious hematopoietic necrosis virus (IHNV) persistence in Sockeye Salmon: influence on brain transcriptome and subsequent response to the viral mimic poly(I:C)
    Article Snippet: .. PCR amplicons were tested for single products by melt curve analysis and sequenced on an ABI3130xL Genetic Analyzer (Life Technologies™) to confirm identities as per the manufacturer’s protocols using the RT-qPCR primers and a fluorescent dye terminator cycle sequencing kit (Applied Biosystems BigDye Terminator version 3.1). .. Primer efficiencies were determined using a serial dilution (2-fold, 5-point) of a pool of undiluted cDNA samples from all experimental conditions.

    Article Title: Clinical and Molecular Characterization of Patients with Fructose 1,6-Bisphosphatase Deficiency
    Article Snippet: The PCR products (5 μL) were examined on a 1% agarose gel and purified using ExoSAP-IT Kit (GE Healthcare, Cleveland, OH, USA). .. Sequencing reactions were prepared with the BigDye® Direct Cycle Sequencing Kit (Life Technologies, Thermo Fisher, Waltham, MA, USA).

    Article Title: A Universal Method for Species Identification of Mammals Utilizing Next Generation Sequencing for the Analysis of DNA Mixtures
    Article Snippet: .. The PCR amplicons were sequenced by standard Sanger sequencing using BigDye® Direct Cycle Sequencing kit (Applied Biosystems) according to the manufacturer’s protocol. .. Separation, by capillary electrophoresis, was performed on an ABI3500 XL instrument using POP-7 (Applied Biosystems) and the DNA sequences were called using Sequence analysis software v. 5.4 (Applied Biosystems).

    Article Title: Bovine Kobuviruses from Cattle with Diarrhea
    Article Snippet: .. All the bovine kobuvirus strains detected in our study were analyzed further by direct sequencing of their PCR amplicons with the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on an automated sequencer (ABI 3100, Applied Biosystems). ..

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: PCR products were either purified using RapidTip (Diffinity Genomics, West Henrietta, NY, USA) or QIA quick Gel Extraction (Qiagen GmbH, Hilden, Germany). .. Sequencing was bidirectional and conducted using a BigDye® Terminator Cycle sequencing kit 3.1(Applied Biosystems [ABI], Darmstadt, Germany).

    Article Title: Germline mutations in the oncogene EZH2 cause Weaver syndrome and increased human height
    Article Snippet: .. Products were sequenced with the original PCR primers or internal sequencing primers (exons 3 and 20) using the BigDye Terminator Cycle Sequencing Kit and an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA,USA). .. Sequences were analyzed using Mutation Surveyor software v3.97 (SoftGenetics, State College, PA, USA).

    Article Title: A new species of the genus Rana from Henan, central China ( Anura, Ranidae)
    Article Snippet: PCR products were purified with Gel Extraction Mini Kit (Tiangen Biotech, Beijing). .. The cycle sequencing reactions were performed using BigDye Terminator Cycle Sequencing Kit (v.2.0, Applied Biosystems, Foster City, California, USA), using purified products as the template DNA.

    Article Title: Mutation in Mpzl3, a Gene Encoding a Predicted the Adhesion Protein, in the Rough Coat (rc) Mice with Severe Skin and Hair Abnormalities
    Article Snippet: Primers were synthesized at Integrated DNA Technologies (Coralville, IA), and PCR reactions were carried out using both wild-type B6/J and B6/J- rc / rc mouse genomic DNA as templates. .. Sequences from both strands were obtained using the BigDye sequencing kit and an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) at sequencing core facilities (MBSR, CGPBRI, and GMBF) at University of Hawaii at Manoa.

    Multiplexing:

    Article Title: A Universal Method for Species Identification of Mammals Utilizing Next Generation Sequencing for the Analysis of DNA Mixtures
    Article Snippet: The PCR amplicons were sequenced by standard Sanger sequencing using BigDye® Direct Cycle Sequencing kit (Applied Biosystems) according to the manufacturer’s protocol. .. Barcodes were included in the primers to aid the ability for sample multiplexing ( ).

    Nucleic Acid Electrophoresis:

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: Sequencing was bidirectional and conducted using a BigDye® Terminator Cycle sequencing kit 3.1(Applied Biosystems [ABI], Darmstadt, Germany). .. PCR products were analysed by gel electrophoresis and visualised by GelRed (Biotium Inc, Hayward, CA, USA) staining.

    Mutagenesis:

    Article Title: Clinical and Molecular Characterization of Patients with Fructose 1,6-Bisphosphatase Deficiency
    Article Snippet: Sequencing reactions were prepared with the BigDye® Direct Cycle Sequencing Kit (Life Technologies, Thermo Fisher, Waltham, MA, USA). .. The sequence data were analyzed using Mutation Surveyor® software version 4.0.4 (SoftGenetics, State College, PA, USA).

    Article Title: Germline mutations in the oncogene EZH2 cause Weaver syndrome and increased human height
    Article Snippet: Paragraph title: EZH2 mutation analysis ... Products were sequenced with the original PCR primers or internal sequencing primers (exons 3 and 20) using the BigDye Terminator Cycle Sequencing Kit and an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA,USA).

    Article Title: Mutation in Mpzl3, a Gene Encoding a Predicted the Adhesion Protein, in the Rough Coat (rc) Mice with Severe Skin and Hair Abnormalities
    Article Snippet: Paragraph title: Mutation detection ... Sequences from both strands were obtained using the BigDye sequencing kit and an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) at sequencing core facilities (MBSR, CGPBRI, and GMBF) at University of Hawaii at Manoa.

    Isolation:

    Article Title: Analysis of the Prevalence of HTLV-1 Proviral DNA in Cervical Smears and Carcinomas from HIV Positive and Negative Kenyan Women
    Article Snippet: .. DNA Sequencing The gel-separated DNA bands were excised, isolated, purified and sequenced using an ABI BigDye Cycle sequencing kit (Applied Biosystems, Warrington, UK) as indicated by the manufacturer and a 3100 ABI sequencer (Applied Biosystems, Warrington, UK). ..

    Purification:

    Article Title: Molecular Characterization of Human and Animal Isolates of Echinococcus granulosus in the Thrace Region, Turkey
    Article Snippet: Then, PCR products were purified using the High Pure PCR Product Purification Kit (Roche, Germany). .. Sequencing was performed on the ABI 3130 XL Genetic Analyzer (Applied Biosystems, USA) with the BigDye Cycle Sequencing Kit (Applied Biosystems, USA) using the corresponding PCR primers by Refgen Company (Ankara, Turkey).

    Article Title: Infectious hematopoietic necrosis virus (IHNV) persistence in Sockeye Salmon: influence on brain transcriptome and subsequent response to the viral mimic poly(I:C)
    Article Snippet: For each brain sample used in the microarray analysis, first-strand cDNA was synthesized from 400 ng of purified total RNA using the High Capacity RNA-to-cDNA™ Kit (Applied Biosystems) and 2.5 μM (final concentration) oligo d(T)16 primers (Applied Biosystems) according to the manufacturer’s instructions. .. PCR amplicons were tested for single products by melt curve analysis and sequenced on an ABI3130xL Genetic Analyzer (Life Technologies™) to confirm identities as per the manufacturer’s protocols using the RT-qPCR primers and a fluorescent dye terminator cycle sequencing kit (Applied Biosystems BigDye Terminator version 3.1).

    Article Title: Clinical and Molecular Characterization of Patients with Fructose 1,6-Bisphosphatase Deficiency
    Article Snippet: The PCR products (5 μL) were examined on a 1% agarose gel and purified using ExoSAP-IT Kit (GE Healthcare, Cleveland, OH, USA). .. Sequencing reactions were prepared with the BigDye® Direct Cycle Sequencing Kit (Life Technologies, Thermo Fisher, Waltham, MA, USA).

    Article Title: Analysis of the Prevalence of HTLV-1 Proviral DNA in Cervical Smears and Carcinomas from HIV Positive and Negative Kenyan Women
    Article Snippet: .. DNA Sequencing The gel-separated DNA bands were excised, isolated, purified and sequenced using an ABI BigDye Cycle sequencing kit (Applied Biosystems, Warrington, UK) as indicated by the manufacturer and a 3100 ABI sequencer (Applied Biosystems, Warrington, UK). ..

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: PCR products were either purified using RapidTip (Diffinity Genomics, West Henrietta, NY, USA) or QIA quick Gel Extraction (Qiagen GmbH, Hilden, Germany). .. Sequencing was bidirectional and conducted using a BigDye® Terminator Cycle sequencing kit 3.1(Applied Biosystems [ABI], Darmstadt, Germany).

    Article Title: A new species of the genus Rana from Henan, central China ( Anura, Ranidae)
    Article Snippet: .. The cycle sequencing reactions were performed using BigDye Terminator Cycle Sequencing Kit (v.2.0, Applied Biosystems, Foster City, California, USA), using purified products as the template DNA. .. Sequences were determined using an ABI PRISM 3730 automated DNA sequencer with sequencing in both directions.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Bovine Kobuviruses from Cattle with Diarrhea
    Article Snippet: The presence of bovine kobuvirus in fecal specimens was detected by using RT-PCR with a protocol modified from the method described by Yamashita et al. ( ). .. All the bovine kobuvirus strains detected in our study were analyzed further by direct sequencing of their PCR amplicons with the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on an automated sequencer (ABI 3100, Applied Biosystems).

    Gel Extraction:

    Article Title: Clinical and Molecular Characterization of Patients with Fructose 1,6-Bisphosphatase Deficiency
    Article Snippet: Sequencing reactions were prepared with the BigDye® Direct Cycle Sequencing Kit (Life Technologies, Thermo Fisher, Waltham, MA, USA). .. The final products were purified from agarose gel using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and the capillary electrophoresis sequencing was performed by using an ABI Prism 3730XL Genetic Analyzer (Applied Biosystems; Thermo Fisher, Waltham, MA, USA) with the forward and reverse primers.

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: PCR products were either purified using RapidTip (Diffinity Genomics, West Henrietta, NY, USA) or QIA quick Gel Extraction (Qiagen GmbH, Hilden, Germany). .. Sequencing was bidirectional and conducted using a BigDye® Terminator Cycle sequencing kit 3.1(Applied Biosystems [ABI], Darmstadt, Germany).

    Article Title: A new species of the genus Rana from Henan, central China ( Anura, Ranidae)
    Article Snippet: PCR products were purified with Gel Extraction Mini Kit (Tiangen Biotech, Beijing). .. The cycle sequencing reactions were performed using BigDye Terminator Cycle Sequencing Kit (v.2.0, Applied Biosystems, Foster City, California, USA), using purified products as the template DNA.

    IA:

    Article Title: Mutation in Mpzl3, a Gene Encoding a Predicted the Adhesion Protein, in the Rough Coat (rc) Mice with Severe Skin and Hair Abnormalities
    Article Snippet: Primers were synthesized at Integrated DNA Technologies (Coralville, IA), and PCR reactions were carried out using both wild-type B6/J and B6/J- rc / rc mouse genomic DNA as templates. .. Sequences from both strands were obtained using the BigDye sequencing kit and an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) at sequencing core facilities (MBSR, CGPBRI, and GMBF) at University of Hawaii at Manoa.

    Mouse Assay:

    Article Title: Mutation in Mpzl3, a Gene Encoding a Predicted the Adhesion Protein, in the Rough Coat (rc) Mice with Severe Skin and Hair Abnormalities
    Article Snippet: Sequences from both strands were obtained using the BigDye sequencing kit and an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) at sequencing core facilities (MBSR, CGPBRI, and GMBF) at University of Hawaii at Manoa. .. Once the mutation was identified, it was confirmed in four more mice each of both +/+ and rc / rc genotypes from different parents, and in heterozygous (+/ rc ) mice.

    Plasmid Preparation:

    Article Title: The Novel Kasugamycin 2?-N-Acetyltransferase Gene aac(2′)-IIa, Carried by the IncP Island, Confers Kasugamycin Resistance to Rice-Pathogenic Bacteria
    Article Snippet: Procedures for general DNA techniques, such as E. coli transformation, plasmid extraction, restriction enzyme digestion, ligation, and agarose gel electrophoresis were performed essentially as described previously ( ). .. The sequences of ksgA and 16S rRNA genes from B. glumae were determined directly by using Ksg-F (5′-ACCGCGGGCATGACGG-3′) and Ksg-831R (5′-TTCGTTTGATTCTTTCGATGTCGA-3′) primers for the ksgA gene and S705-F (5′-ATGTGGAGGAATACCGATGG-3′) and S1536-R (5′-AAAGGAGGTGATCCAGCC-3′) primers for the 16S rRNA gene with a BigDye Terminator cycle sequencing kit (Applied Biosystems, Inc.).

    Software:

    Article Title: Molecular Characterization of Human and Animal Isolates of Echinococcus granulosus in the Thrace Region, Turkey
    Article Snippet: Sequencing was performed on the ABI 3130 XL Genetic Analyzer (Applied Biosystems, USA) with the BigDye Cycle Sequencing Kit (Applied Biosystems, USA) using the corresponding PCR primers by Refgen Company (Ankara, Turkey). .. Phylogenetic analysis of concatenated CO1 and ND1 data was conducted by the maximum likelihood (ML) method, employing the MEGA5 (Molecular Evolutionary Genetics Analysis) software.

    Article Title: Clinical and Molecular Characterization of Patients with Fructose 1,6-Bisphosphatase Deficiency
    Article Snippet: Sanger Sequencing Verification of the FBP1 Gene The primers for amplification of the FBP1 gene (GenBank accession no NM_000507.3) were designed using UCSC ExonPrimer online software ( http://genome.ucsc.edu/index.html ) and synthesized by Map Biotechnology (Shanghai, China). .. Sequencing reactions were prepared with the BigDye® Direct Cycle Sequencing Kit (Life Technologies, Thermo Fisher, Waltham, MA, USA).

    Article Title: A Universal Method for Species Identification of Mammals Utilizing Next Generation Sequencing for the Analysis of DNA Mixtures
    Article Snippet: The PCR amplicons were sequenced by standard Sanger sequencing using BigDye® Direct Cycle Sequencing kit (Applied Biosystems) according to the manufacturer’s protocol. .. Separation, by capillary electrophoresis, was performed on an ABI3500 XL instrument using POP-7 (Applied Biosystems) and the DNA sequences were called using Sequence analysis software v. 5.4 (Applied Biosystems).

    Article Title: Germline mutations in the oncogene EZH2 cause Weaver syndrome and increased human height
    Article Snippet: Products were sequenced with the original PCR primers or internal sequencing primers (exons 3 and 20) using the BigDye Terminator Cycle Sequencing Kit and an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA,USA). .. Sequences were analyzed using Mutation Surveyor software v3.97 (SoftGenetics, State College, PA, USA).

    Real-time Polymerase Chain Reaction:

    Article Title: Infectious hematopoietic necrosis virus (IHNV) persistence in Sockeye Salmon: influence on brain transcriptome and subsequent response to the viral mimic poly(I:C)
    Article Snippet: Paragraph title: Reverse transcriptase quantitative PCR ... PCR amplicons were tested for single products by melt curve analysis and sequenced on an ABI3130xL Genetic Analyzer (Life Technologies™) to confirm identities as per the manufacturer’s protocols using the RT-qPCR primers and a fluorescent dye terminator cycle sequencing kit (Applied Biosystems BigDye Terminator version 3.1).

    Multiplex Assay:

    Article Title: Germline mutations in the oncogene EZH2 cause Weaver syndrome and increased human height
    Article Snippet: The PCR was carried out using a Qiagen Multiplex PCR kit according to the manufacturer's instructions. .. Products were sequenced with the original PCR primers or internal sequencing primers (exons 3 and 20) using the BigDye Terminator Cycle Sequencing Kit and an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA,USA).

    Agarose Gel Electrophoresis:

    Article Title: Clinical and Molecular Characterization of Patients with Fructose 1,6-Bisphosphatase Deficiency
    Article Snippet: The PCR products (5 μL) were examined on a 1% agarose gel and purified using ExoSAP-IT Kit (GE Healthcare, Cleveland, OH, USA). .. Sequencing reactions were prepared with the BigDye® Direct Cycle Sequencing Kit (Life Technologies, Thermo Fisher, Waltham, MA, USA).

    Article Title: Mutation in Mpzl3, a Gene Encoding a Predicted the Adhesion Protein, in the Rough Coat (rc) Mice with Severe Skin and Hair Abnormalities
    Article Snippet: The amplicons were analyzed by agarose gel electrophoresis, and the DNA was recovered from the gel using GeneClean Spin Kit (Q-Biogene, Carlsbad, CA). .. Sequences from both strands were obtained using the BigDye sequencing kit and an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) at sequencing core facilities (MBSR, CGPBRI, and GMBF) at University of Hawaii at Manoa.

    Article Title: The Novel Kasugamycin 2?-N-Acetyltransferase Gene aac(2′)-IIa, Carried by the IncP Island, Confers Kasugamycin Resistance to Rice-Pathogenic Bacteria
    Article Snippet: Procedures for general DNA techniques, such as E. coli transformation, plasmid extraction, restriction enzyme digestion, ligation, and agarose gel electrophoresis were performed essentially as described previously ( ). .. The sequences of ksgA and 16S rRNA genes from B. glumae were determined directly by using Ksg-F (5′-ACCGCGGGCATGACGG-3′) and Ksg-831R (5′-TTCGTTTGATTCTTTCGATGTCGA-3′) primers for the ksgA gene and S705-F (5′-ATGTGGAGGAATACCGATGG-3′) and S1536-R (5′-AAAGGAGGTGATCCAGCC-3′) primers for the 16S rRNA gene with a BigDye Terminator cycle sequencing kit (Applied Biosystems, Inc.).

    Electrophoresis:

    Article Title: Clinical and Molecular Characterization of Patients with Fructose 1,6-Bisphosphatase Deficiency
    Article Snippet: Sequencing reactions were prepared with the BigDye® Direct Cycle Sequencing Kit (Life Technologies, Thermo Fisher, Waltham, MA, USA). .. The final products were purified from agarose gel using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and the capillary electrophoresis sequencing was performed by using an ABI Prism 3730XL Genetic Analyzer (Applied Biosystems; Thermo Fisher, Waltham, MA, USA) with the forward and reverse primers.

    Article Title: A Universal Method for Species Identification of Mammals Utilizing Next Generation Sequencing for the Analysis of DNA Mixtures
    Article Snippet: The PCR amplicons were sequenced by standard Sanger sequencing using BigDye® Direct Cycle Sequencing kit (Applied Biosystems) according to the manufacturer’s protocol. .. Separation, by capillary electrophoresis, was performed on an ABI3500 XL instrument using POP-7 (Applied Biosystems) and the DNA sequences were called using Sequence analysis software v. 5.4 (Applied Biosystems).

    DNA Extraction:

    Article Title: A new species of the genus Rana from Henan, central China ( Anura, Ranidae)
    Article Snippet: Paragraph title: DNA extraction, amplification, and sequencing ... The cycle sequencing reactions were performed using BigDye Terminator Cycle Sequencing Kit (v.2.0, Applied Biosystems, Foster City, California, USA), using purified products as the template DNA.

    Concentration Assay:

    Article Title: Infectious hematopoietic necrosis virus (IHNV) persistence in Sockeye Salmon: influence on brain transcriptome and subsequent response to the viral mimic poly(I:C)
    Article Snippet: For each brain sample used in the microarray analysis, first-strand cDNA was synthesized from 400 ng of purified total RNA using the High Capacity RNA-to-cDNA™ Kit (Applied Biosystems) and 2.5 μM (final concentration) oligo d(T)16 primers (Applied Biosystems) according to the manufacturer’s instructions. .. PCR amplicons were tested for single products by melt curve analysis and sequenced on an ABI3130xL Genetic Analyzer (Life Technologies™) to confirm identities as per the manufacturer’s protocols using the RT-qPCR primers and a fluorescent dye terminator cycle sequencing kit (Applied Biosystems BigDye Terminator version 3.1).

    Staining:

    Article Title: Factors influencing Dipylidium sp. infection in a free-ranging social carnivore, the spotted hyaena (Crocuta crocuta)
    Article Snippet: Sequencing was bidirectional and conducted using a BigDye® Terminator Cycle sequencing kit 3.1(Applied Biosystems [ABI], Darmstadt, Germany). .. PCR products were analysed by gel electrophoresis and visualised by GelRed (Biotium Inc, Hayward, CA, USA) staining.

    Fluorescence In Situ Hybridization:

    Article Title: Infectious hematopoietic necrosis virus (IHNV) persistence in Sockeye Salmon: influence on brain transcriptome and subsequent response to the viral mimic poly(I:C)
    Article Snippet: PCR amplicons were tested for single products by melt curve analysis and sequenced on an ABI3130xL Genetic Analyzer (Life Technologies™) to confirm identities as per the manufacturer’s protocols using the RT-qPCR primers and a fluorescent dye terminator cycle sequencing kit (Applied Biosystems BigDye Terminator version 3.1). .. Naïve fish served as a calibrator and U6 snRNA-associated Sm-like protein LSm8 (LSM8 ) and dynein light chain 1 cytoplasmic (DYN ) were used as reference genes.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher abi prism bigdye terminator v3 1 cycle sequencing kit
    Abi Prism Bigdye Terminator V3 1 Cycle Sequencing Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 153 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism bigdye terminator v3 1 cycle sequencing kit/product/Thermo Fisher
    Average 99 stars, based on 153 article reviews
    Price from $9.99 to $1999.99
    abi prism bigdye terminator v3 1 cycle sequencing kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    98
    Thermo Fisher abi prism bigdye terminator cycle sequencing ready reaction kit
    Abi Prism Bigdye Terminator Cycle Sequencing Ready Reaction Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 393 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism bigdye terminator cycle sequencing ready reaction kit/product/Thermo Fisher
    Average 98 stars, based on 393 article reviews
    Price from $9.99 to $1999.99
    abi prism bigdye terminator cycle sequencing ready reaction kit - by Bioz Stars, 2020-04
    98/100 stars
      Buy from Supplier

    Image Search Results