abi prism bigdye cycle sequencing ready reaction kit v1 1  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher abi prism bigdye cycle sequencing ready reaction kit v1 1
    Abi Prism Bigdye Cycle Sequencing Ready Reaction Kit V1 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism bigdye cycle sequencing ready reaction kit v1 1/product/Thermo Fisher
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    abi prism bigdye cycle sequencing ready reaction kit v1 1 - by Bioz Stars, 2020-04
    99/100 stars

    Related Products / Commonly Used Together

    sequence pcr

    Images

    Related Articles

    Clone Assay:

    Article Title: On the genomics of immunoglobulins in the gray, short-tailed opossum Monodelphis domestica
    Article Snippet: .. PCR products were cloned using TOPO TA cloning Kit (Invitrogen, Carsbad, CA) and sequenced using BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequences were analyzed using Sequencher 3.0 (Gene Codes, Ann Arbor, MI) and compared with the GenBank database and the MonDom5 assembly using the BLAST algorithm ( ).

    Amplification:

    Article Title: On the genomics of immunoglobulins in the gray, short-tailed opossum Monodelphis domestica
    Article Snippet: These primers amplified a 855 bp fragment from M. domestica genomic DNA, which was cloned and sequenced. .. PCR products were cloned using TOPO TA cloning Kit (Invitrogen, Carsbad, CA) and sequenced using BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA).

    Article Title: p53 mutations in classic and pleomorphic invasive lobular carcinoma of the breast
    Article Snippet: Sequencing and mutation analysis For the detection of mutations, genomic DNA was amplified with primers flanking exons 4, 5, 6, 7, 8 and 9 of the TP53 gene (Table ). .. The PCR conditions were set up as follows; initial denaturation at 94°C for 3 min, 35 cycles at 94°C for 1 min (denaturation), 60°C for 30 s (annealing) and 72°C for 45 s (extension), followed by a final extension at 72°C for 5 min. Then, PCR products were sequenced in both sense and antisense directions using the BigDye Terminator v1.1 sequencing kit on ABI 3130 (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions.

    Article Title: Immunoglobulin gene rearrangement IGHV3-48 is a predictive marker of histological transformation into aggressive lymphoma in follicular lymphomas
    Article Snippet: .. IGH rearrangement sequencing and identification PCR products were sequenced in forward and reverse reads, using the same primers as for PCR amplification and the Big-Dye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) . .. Sequencing was carried out with an ABI 3500xL DNA Sequencer (Applied Biosystems).

    Article Title: Analysis of Genetic Alterations in Tunisian Patients with Lung Adenocarcinoma
    Article Snippet: Mutation Analysis Exon 2 of KRAS and exons 18–21 of EGFR were amplified in 53 of the 73 cases by polymerase chain reaction (PCR) assay using the primers indicated in . .. PCR product was purified using exonuclease and then submitted to sequencing using an ABI PRISM 3100-Avant automated DNA sequencer with the BigDye Terminator Cycle Sequencing reaction kit v1.1. (catalog number 4337450, Thermo Fisher Scientific, Monza, Italy).

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: .. Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. .. Sequencing products were separated on either ABI PRISM 3100 Genetic Analyzer or ABI PRISM 3700 DNA Analyzer (Applied Biosystems).

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: Genetic analysis of TP53 mutation, BRAF mutations and ret/PTC rearrangements Analysis of the TP53 gene status was performed as follows: exons 5, 6, 7, and 8 of p53 gene were sequentially amplified by polymerase chain reaction (PCR) assay with the use of AmpliTaq Gold (Applied Biosystems) and following primer sets: exon 5 sense: TTCCTCTTCCTACAGTACTC; exon 5 antisense: GCCCCAGCTGTTCAC; exon 6 sense: ACTGATTGCTCTTAG; exon 6 antisense: AGTTGCAAACCAGAC; exon 7 sense: AGTTGTGTTATCTCCTAG; exon 7 antisense: CAAGTGGCTCCTGAC; exon 8 sense: TCCTATCCTGAGTAG; exon 8 antisense: GTCCTGCTTGCTTAC. .. Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems).

    Modification:

    Article Title: Criteria for effective design, construction, and gene knockdown by shRNA vectors
    Article Snippet: Sequencing reactions were 12.5 uL total volume containing 1 × BigDye Terminator v1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems), 0.26 ug of DNA and 3.75 pmole of primer. .. Modified sequencing reactions substituted part or all of the BigDye v1.1 chemistry with ABI Prism dGTP BigDye Terminator Ready Reaction Mix (Applied Biosystems).

    Selection:

    Article Title: Analysis of Genetic Alterations in Tunisian Patients with Lung Adenocarcinoma
    Article Snippet: PCR product was purified using exonuclease and then submitted to sequencing using an ABI PRISM 3100-Avant automated DNA sequencer with the BigDye Terminator Cycle Sequencing reaction kit v1.1. (catalog number 4337450, Thermo Fisher Scientific, Monza, Italy). .. The MassARRAY (Sequenom) testing was carried out on 20 cases, and the selection of the methodology to be used was done on the basis of the amount of tumor tissue available.

    Article Title: Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy
    Article Snippet: The selection was performed in such a way that at least one isolate for each pulsotype and different year, if available, could be analyzed. .. The purified samples were used for sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) followed by capillary electrophoresis on the ABI Prism 310 Genetic Analyzer (Applied Biosystems) as described in D'Andrea et al. ( ).

    Mutagenesis:

    Article Title: p53 mutations in classic and pleomorphic invasive lobular carcinoma of the breast
    Article Snippet: Paragraph title: Sequencing and mutation analysis ... The PCR conditions were set up as follows; initial denaturation at 94°C for 3 min, 35 cycles at 94°C for 1 min (denaturation), 60°C for 30 s (annealing) and 72°C for 45 s (extension), followed by a final extension at 72°C for 5 min. Then, PCR products were sequenced in both sense and antisense directions using the BigDye Terminator v1.1 sequencing kit on ABI 3130 (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions.

    Article Title: Analysis of Genetic Alterations in Tunisian Patients with Lung Adenocarcinoma
    Article Snippet: Paragraph title: 2.2.2. Mutation Analysis ... PCR product was purified using exonuclease and then submitted to sequencing using an ABI PRISM 3100-Avant automated DNA sequencer with the BigDye Terminator Cycle Sequencing reaction kit v1.1. (catalog number 4337450, Thermo Fisher Scientific, Monza, Italy).

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: Paragraph title: Identification of the Mutant Gene ... Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions.

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: Paragraph title: Genetic analysis of TP53 mutation, BRAF mutations and ret/PTC rearrangements ... Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems).

    Article Title: A Novel KCNJ2 Mutation Identified in an Autistic Proband Affects the Single Channel Properties of Kir2.1
    Article Snippet: Sequencing reactions were performed on both strands using the BigDye Terminator Cycle Sequencing kit v1.1 and an automated ABI-3130 DNA sequencer (Applied Biosystems, Foster City, CA, USA). .. Mutation detection was performed using ChromasPro v1.34 (Technelysium Ltd.) software.

    Polymerase Chain Reaction:

    Article Title: On the genomics of immunoglobulins in the gray, short-tailed opossum Monodelphis domestica
    Article Snippet: .. PCR products were cloned using TOPO TA cloning Kit (Invitrogen, Carsbad, CA) and sequenced using BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequences were analyzed using Sequencher 3.0 (Gene Codes, Ann Arbor, MI) and compared with the GenBank database and the MonDom5 assembly using the BLAST algorithm ( ).

    Article Title: p53 mutations in classic and pleomorphic invasive lobular carcinoma of the breast
    Article Snippet: .. The PCR conditions were set up as follows; initial denaturation at 94°C for 3 min, 35 cycles at 94°C for 1 min (denaturation), 60°C for 30 s (annealing) and 72°C for 45 s (extension), followed by a final extension at 72°C for 5 min. Then, PCR products were sequenced in both sense and antisense directions using the BigDye Terminator v1.1 sequencing kit on ABI 3130 (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. .. The sequences were analyzed using Mutation Surveyor software (SoftGenetics,LLC., State College, PA, USA).

    Article Title: Immunoglobulin gene rearrangement IGHV3-48 is a predictive marker of histological transformation into aggressive lymphoma in follicular lymphomas
    Article Snippet: .. IGH rearrangement sequencing and identification PCR products were sequenced in forward and reverse reads, using the same primers as for PCR amplification and the Big-Dye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) . .. Sequencing was carried out with an ABI 3500xL DNA Sequencer (Applied Biosystems).

    Article Title: Analysis of Genetic Alterations in Tunisian Patients with Lung Adenocarcinoma
    Article Snippet: .. PCR product was purified using exonuclease and then submitted to sequencing using an ABI PRISM 3100-Avant automated DNA sequencer with the BigDye Terminator Cycle Sequencing reaction kit v1.1. (catalog number 4337450, Thermo Fisher Scientific, Monza, Italy). .. Each exon was sequenced on both strands, amplified, and then sequenced again on both strands to eliminate the risk of PCR artifacts.

    Article Title: Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy
    Article Snippet: PCR products derived from the seven housekeeping genes (arcc , aroe , glpf , gmk , pta , tpi , yqil ) were treated with HT ExoSAP-IT (Affymetrix) following the manufacturer's instruction. .. The purified samples were used for sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) followed by capillary electrophoresis on the ABI Prism 310 Genetic Analyzer (Applied Biosystems) as described in D'Andrea et al. ( ).

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: .. Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. .. Sequencing products were separated on either ABI PRISM 3100 Genetic Analyzer or ABI PRISM 3700 DNA Analyzer (Applied Biosystems).

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: DNA sequencing The cycle sequencing reaction (20 μl) was performed with the Cycle Sequencing Mix (8 μl) from the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems), containing ∼0.3 pmol of the template and 4 pmol of the sequencing primer (20-mer), in the presence of 40 pmol or 1 nmol of 4-propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde 5′-triphosphate (d Pa′ TP) (40 pmol for DNA fragments containing one Ds base and 1 nmol for DNAs with two Ds bases) or 1 nmol of dd Pa′ TP. .. After 25 cycles of PCR (96°C, 10 s; 50°C, 5 s; 60°C, 4 min), the residual dye terminators were removed from the reaction with CENTRI-SEP columns (Princeton Separations), and the solutions were dried.

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: .. Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems). .. Sequence data were analyzed by means of SeqScape software (version 2.1, Applied Biosystems) followed by manual review.

    Article Title: HylA, an Alternative Hydrolase for Initiation of Catabolism of the Phenylurea Herbicide Linuron in Variovorax sp. Strains
    Article Snippet: .. Amplicons were purified with the Qiaquick PCR purification kit (Qiagen) according to the manufacturer's instructions and sequenced using the BigDye Terminator cycle sequencing kit (Applied Biosystems) as described by the manufacturer. .. The sequencing reaction was performed on a thermocycler UNOII (Biometra, Germany).

    TA Cloning:

    Article Title: On the genomics of immunoglobulins in the gray, short-tailed opossum Monodelphis domestica
    Article Snippet: .. PCR products were cloned using TOPO TA cloning Kit (Invitrogen, Carsbad, CA) and sequenced using BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequences were analyzed using Sequencher 3.0 (Gene Codes, Ann Arbor, MI) and compared with the GenBank database and the MonDom5 assembly using the BLAST algorithm ( ).

    Construct:

    Article Title: Criteria for effective design, construction, and gene knockdown by shRNA vectors
    Article Snippet: Sequencing reactions were 12.5 uL total volume containing 1 × BigDye Terminator v1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems), 0.26 ug of DNA and 3.75 pmole of primer. .. The shRNA vectors used to assess sequencing efficacy were constructed as stem loop hairpins as described above and contain the following target sequences: pHSPG-shTLR4, AGGTGATTGTTGTGGTGTC; pHSPG-shmutTLR4, AGGTGATTCTTGTGGTGTC; pHSPG-shmCNN3, AGGAATGAGCGTGTATGGG; and pHSPG-shTLR2, GTATGAACTGGACTTCTCC.

    Purification:

    Article Title: Analysis of Genetic Alterations in Tunisian Patients with Lung Adenocarcinoma
    Article Snippet: .. PCR product was purified using exonuclease and then submitted to sequencing using an ABI PRISM 3100-Avant automated DNA sequencer with the BigDye Terminator Cycle Sequencing reaction kit v1.1. (catalog number 4337450, Thermo Fisher Scientific, Monza, Italy). .. Each exon was sequenced on both strands, amplified, and then sequenced again on both strands to eliminate the risk of PCR artifacts.

    Article Title: Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy
    Article Snippet: .. The purified samples were used for sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) followed by capillary electrophoresis on the ABI Prism 310 Genetic Analyzer (Applied Biosystems) as described in D'Andrea et al. ( ). .. The sequences were then analyzed using the ABI3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: .. Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems). .. Sequence data were analyzed by means of SeqScape software (version 2.1, Applied Biosystems) followed by manual review.

    Article Title: HylA, an Alternative Hydrolase for Initiation of Catabolism of the Phenylurea Herbicide Linuron in Variovorax sp. Strains
    Article Snippet: .. Amplicons were purified with the Qiaquick PCR purification kit (Qiagen) according to the manufacturer's instructions and sequenced using the BigDye Terminator cycle sequencing kit (Applied Biosystems) as described by the manufacturer. .. The sequencing reaction was performed on a thermocycler UNOII (Biometra, Germany).

    Electrophoresis:

    Article Title: Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy
    Article Snippet: .. The purified samples were used for sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) followed by capillary electrophoresis on the ABI Prism 310 Genetic Analyzer (Applied Biosystems) as described in D'Andrea et al. ( ). .. The sequences were then analyzed using the ABI3130 Genetic Analyzer (Applied Biosystems).

    Sequencing:

    Article Title: On the genomics of immunoglobulins in the gray, short-tailed opossum Monodelphis domestica
    Article Snippet: .. PCR products were cloned using TOPO TA cloning Kit (Invitrogen, Carsbad, CA) and sequenced using BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). .. Sequences were analyzed using Sequencher 3.0 (Gene Codes, Ann Arbor, MI) and compared with the GenBank database and the MonDom5 assembly using the BLAST algorithm ( ).

    Article Title: The Association of SERPINE2 Gene with COPD in a Chinese Han Population
    Article Snippet: .. Sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems), and analyzed on an ABI PRISM 3100 DNA sequencer (Applied Biosystems, Foster City, CA, USA). ..

    Article Title: p53 mutations in classic and pleomorphic invasive lobular carcinoma of the breast
    Article Snippet: .. The PCR conditions were set up as follows; initial denaturation at 94°C for 3 min, 35 cycles at 94°C for 1 min (denaturation), 60°C for 30 s (annealing) and 72°C for 45 s (extension), followed by a final extension at 72°C for 5 min. Then, PCR products were sequenced in both sense and antisense directions using the BigDye Terminator v1.1 sequencing kit on ABI 3130 (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. .. The sequences were analyzed using Mutation Surveyor software (SoftGenetics,LLC., State College, PA, USA).

    Article Title: Immunoglobulin gene rearrangement IGHV3-48 is a predictive marker of histological transformation into aggressive lymphoma in follicular lymphomas
    Article Snippet: .. IGH rearrangement sequencing and identification PCR products were sequenced in forward and reverse reads, using the same primers as for PCR amplification and the Big-Dye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) . .. Sequencing was carried out with an ABI 3500xL DNA Sequencer (Applied Biosystems).

    Article Title: Analysis of Genetic Alterations in Tunisian Patients with Lung Adenocarcinoma
    Article Snippet: .. PCR product was purified using exonuclease and then submitted to sequencing using an ABI PRISM 3100-Avant automated DNA sequencer with the BigDye Terminator Cycle Sequencing reaction kit v1.1. (catalog number 4337450, Thermo Fisher Scientific, Monza, Italy). .. Each exon was sequenced on both strands, amplified, and then sequenced again on both strands to eliminate the risk of PCR artifacts.

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: .. Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. .. Sequencing products were separated on either ABI PRISM 3100 Genetic Analyzer or ABI PRISM 3700 DNA Analyzer (Applied Biosystems).

    Article Title: Criteria for effective design, construction, and gene knockdown by shRNA vectors
    Article Snippet: .. Sequencing reactions were 12.5 uL total volume containing 1 × BigDye Terminator v1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems), 0.26 ug of DNA and 3.75 pmole of primer. .. LTRa primer (sequence CGCGAACAGAAGCGAGAA) that binds the HSPG vector approximately 120 bp downstream from the inserted hairpin was used in all sequencing reactions.

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. DNA sequencing The cycle sequencing reaction (20 μl) was performed with the Cycle Sequencing Mix (8 μl) from the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems), containing ∼0.3 pmol of the template and 4 pmol of the sequencing primer (20-mer), in the presence of 40 pmol or 1 nmol of 4-propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde 5′-triphosphate (d Pa′ TP) (40 pmol for DNA fragments containing one Ds base and 1 nmol for DNAs with two Ds bases) or 1 nmol of dd Pa′ TP. .. After 25 cycles of PCR (96°C, 10 s; 50°C, 5 s; 60°C, 4 min), the residual dye terminators were removed from the reaction with CENTRI-SEP columns (Princeton Separations), and the solutions were dried.

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: .. Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems). .. Sequence data were analyzed by means of SeqScape software (version 2.1, Applied Biosystems) followed by manual review.

    Article Title: HylA, an Alternative Hydrolase for Initiation of Catabolism of the Phenylurea Herbicide Linuron in Variovorax sp. Strains
    Article Snippet: .. Amplicons were purified with the Qiaquick PCR purification kit (Qiagen) according to the manufacturer's instructions and sequenced using the BigDye Terminator cycle sequencing kit (Applied Biosystems) as described by the manufacturer. .. The sequencing reaction was performed on a thermocycler UNOII (Biometra, Germany).

    Article Title: A Novel KCNJ2 Mutation Identified in an Autistic Proband Affects the Single Channel Properties of Kir2.1
    Article Snippet: .. Sequencing reactions were performed on both strands using the BigDye Terminator Cycle Sequencing kit v1.1 and an automated ABI-3130 DNA sequencer (Applied Biosystems, Foster City, CA, USA). .. Mutation detection was performed using ChromasPro v1.34 (Technelysium Ltd.) software.

    shRNA:

    Article Title: Criteria for effective design, construction, and gene knockdown by shRNA vectors
    Article Snippet: Paragraph title: Sequencing of shRNA vectors ... Sequencing reactions were 12.5 uL total volume containing 1 × BigDye Terminator v1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems), 0.26 ug of DNA and 3.75 pmole of primer.

    DNA Sequencing:

    Article Title: The Association of SERPINE2 Gene with COPD in a Chinese Han Population
    Article Snippet: Paragraph title: DNA sequencing ... Sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems), and analyzed on an ABI PRISM 3100 DNA sequencer (Applied Biosystems, Foster City, CA, USA).

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. .. Raw sequencing data were analyzed with the DNA Sequencing Analysis Software v3.7 (Applied Biosystems).

    Article Title: Criteria for effective design, construction, and gene knockdown by shRNA vectors
    Article Snippet: Sequencing of shRNA vectors DNA sequencing was done at the UNC-CH Genome Analysis Facility. .. Sequencing reactions were 12.5 uL total volume containing 1 × BigDye Terminator v1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems), 0.26 ug of DNA and 3.75 pmole of primer.

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. DNA sequencing The cycle sequencing reaction (20 μl) was performed with the Cycle Sequencing Mix (8 μl) from the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems), containing ∼0.3 pmol of the template and 4 pmol of the sequencing primer (20-mer), in the presence of 40 pmol or 1 nmol of 4-propynyl-1-(β-D-ribofuranosyl)pyrrole-2-carbaldehyde 5′-triphosphate (d Pa′ TP) (40 pmol for DNA fragments containing one Ds base and 1 nmol for DNAs with two Ds bases) or 1 nmol of dd Pa′ TP. .. After 25 cycles of PCR (96°C, 10 s; 50°C, 5 s; 60°C, 4 min), the residual dye terminators were removed from the reaction with CENTRI-SEP columns (Princeton Separations), and the solutions were dried.

    Article Title: A Novel KCNJ2 Mutation Identified in an Autistic Proband Affects the Single Channel Properties of Kir2.1
    Article Snippet: Comprehensive mutational analyses of KCNJ2 and KCNJ10 were performed using polymerase chain reactions (PCRs) and DNA sequencing. .. Sequencing reactions were performed on both strands using the BigDye Terminator Cycle Sequencing kit v1.1 and an automated ABI-3130 DNA sequencer (Applied Biosystems, Foster City, CA, USA).

    DNA Purification:

    Article Title: A Novel KCNJ2 Mutation Identified in an Autistic Proband Affects the Single Channel Properties of Kir2.1
    Article Snippet: For each participant genomic DNA was obtained using the Wizard genomic DNA purification kit (Promega, Madison, WI, USA) from venous blood. .. Sequencing reactions were performed on both strands using the BigDye Terminator Cycle Sequencing kit v1.1 and an automated ABI-3130 DNA sequencer (Applied Biosystems, Foster City, CA, USA).

    Touchdown PCR:

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: .. Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. .. Sequencing products were separated on either ABI PRISM 3100 Genetic Analyzer or ABI PRISM 3700 DNA Analyzer (Applied Biosystems).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems). .. Screening for ret/PTC 1 and ret/PTC 3 rearrangements was performed by RT-PCR using primers spanning the breakpoints, as previously described [ ].

    Quantitative RT-PCR:

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems). .. Search for mutations of BRAF was conducted by single-stranded conformational polymorphism (SSCP) screening of real-time (RT)-PCR products of exons 15, followed by sequencing, as previously described [ ].

    Recombinant:

    Article Title: Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy
    Article Snippet: Polymerase chain reaction (PCR) was performed in a 30 μL volume reaction containing 1.5 U of recombinant Taq DNA polymerase (Invitrogen, Life Technologies) as described in Randazzo et al. ( ). .. The purified samples were used for sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) followed by capillary electrophoresis on the ABI Prism 310 Genetic Analyzer (Applied Biosystems) as described in D'Andrea et al. ( ).

    Derivative Assay:

    Article Title: Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy
    Article Snippet: PCR products derived from the seven housekeeping genes (arcc , aroe , glpf , gmk , pta , tpi , yqil ) were treated with HT ExoSAP-IT (Affymetrix) following the manufacturer's instruction. .. The purified samples were used for sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) followed by capillary electrophoresis on the ABI Prism 310 Genetic Analyzer (Applied Biosystems) as described in D'Andrea et al. ( ).

    Plasmid Preparation:

    Article Title: Criteria for effective design, construction, and gene knockdown by shRNA vectors
    Article Snippet: Sequencing reactions were 12.5 uL total volume containing 1 × BigDye Terminator v1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems), 0.26 ug of DNA and 3.75 pmole of primer. .. LTRa primer (sequence CGCGAACAGAAGCGAGAA) that binds the HSPG vector approximately 120 bp downstream from the inserted hairpin was used in all sequencing reactions.

    Software:

    Article Title: p53 mutations in classic and pleomorphic invasive lobular carcinoma of the breast
    Article Snippet: The PCR conditions were set up as follows; initial denaturation at 94°C for 3 min, 35 cycles at 94°C for 1 min (denaturation), 60°C for 30 s (annealing) and 72°C for 45 s (extension), followed by a final extension at 72°C for 5 min. Then, PCR products were sequenced in both sense and antisense directions using the BigDye Terminator v1.1 sequencing kit on ABI 3130 (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. .. The sequences were analyzed using Mutation Surveyor software (SoftGenetics,LLC., State College, PA, USA).

    Article Title: Immunoglobulin gene rearrangement IGHV3-48 is a predictive marker of histological transformation into aggressive lymphoma in follicular lymphomas
    Article Snippet: IGH rearrangement sequencing and identification PCR products were sequenced in forward and reverse reads, using the same primers as for PCR amplification and the Big-Dye® Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) . .. Complete V-D-J rearrangements and the percentage of germline identity were identified using the IMGT/V-QUEST software ( http://www.imgt.org ).

    Article Title: Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase
    Article Snippet: Amplification conditions were an initial denaturation of 4 min. at 94°C, followed by 20 cycles of touchdown PCR in 30 s at 94°C, 30 s at 65°C (decrease 0.5°C per cycle), 40 s at 72°C; and a final 20 cycles in 30 s at 94°C, 30 s at 55°C, followed by 40 s at 72°C and then a final extension at 72°C for 5 min. All amplified PCR fragments were digested with shrimp alkaline phosphatase and Exo I to remove unincorporated primers and sequenced using the BigDye Terminator Cycle Sequencing Kit v1.1/3.1 (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. .. Raw sequencing data were analyzed with the DNA Sequencing Analysis Software v3.7 (Applied Biosystems).

    Article Title: Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties
    Article Snippet: Purified PCR products were sequenced in both directions with the use of the BigDye terminator Cycle sequencing Kit (version 1.1, Applied Biosystems) and an ABI Genetic Analyzer (Model 3130, Applied Biosystems). .. Sequence data were analyzed by means of SeqScape software (version 2.1, Applied Biosystems) followed by manual review.

    Article Title: A Novel KCNJ2 Mutation Identified in an Autistic Proband Affects the Single Channel Properties of Kir2.1
    Article Snippet: Flanking primers (Sigma-Aldrich, St. Louis, MO, USA) designed with the Oligo 6.0 software were used to amplify KCNJ2 and KCNJ10 coding sequences. .. Sequencing reactions were performed on both strands using the BigDye Terminator Cycle Sequencing kit v1.1 and an automated ABI-3130 DNA sequencer (Applied Biosystems, Foster City, CA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher abi prism bigdye terminator v1 1 cycle sequencing kit
    Abi Prism Bigdye Terminator V1 1 Cycle Sequencing Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism bigdye terminator v1 1 cycle sequencing kit/product/Thermo Fisher
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    abi prism bigdye terminator v1 1 cycle sequencing kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results