aavs1 targeting sgrna sgcon  (Addgene inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    pLX sgRNA Plasmid 50662
    Description:

    Catalog Number:
    50662
    Price:
    None
    Buy from Supplier


    Structured Review

    Addgene inc aavs1 targeting sgrna sgcon
    pLX sgRNA Plasmid 50662

    https://www.bioz.com/result/aavs1 targeting sgrna sgcon/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aavs1 targeting sgrna sgcon - by Bioz Stars, 2021-07
    94/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: KDM2B is involved in the epigenetic regulation of TGF-β-induced epithelial–mesenchymal transition in lung and pancreatic cancer cell lines
    Article Snippet: Single-guide RNAs (sgRNAs) and CRISPR/Cas9 screening The oligonucleotides for five different sgRNAs against 23 PRC1-related genes were designed with CRISPRdirect ( http://crispr.dbcls.jp ) and listed in . .. Linker’s sequences (5’-cacc-3’ for forward primer and 5’-aaac-3’ for reverse primer) were attached to the synthesized oligos, and the annealed oligonucleotides were cloned into the modified pLX-sgRNA plasmid (Addgene plasmid #50662) digested with BsmBI (New England Biolabs, Ipswich, USA). .. The modified plasmid termed pLX-sgRNA ver.2 ( A ) was constructed by combining original pLX-sgRNA ( ) and a part of lentiGuide-Puro plasmid (Addgene plasmid #52963) ( ) (See the detailed procedure described in ).

    Clone Assay:

    Article Title: KDM2B is involved in the epigenetic regulation of TGF-β-induced epithelial–mesenchymal transition in lung and pancreatic cancer cell lines
    Article Snippet: Single-guide RNAs (sgRNAs) and CRISPR/Cas9 screening The oligonucleotides for five different sgRNAs against 23 PRC1-related genes were designed with CRISPRdirect ( http://crispr.dbcls.jp ) and listed in . .. Linker’s sequences (5’-cacc-3’ for forward primer and 5’-aaac-3’ for reverse primer) were attached to the synthesized oligos, and the annealed oligonucleotides were cloned into the modified pLX-sgRNA plasmid (Addgene plasmid #50662) digested with BsmBI (New England Biolabs, Ipswich, USA). .. The modified plasmid termed pLX-sgRNA ver.2 ( A ) was constructed by combining original pLX-sgRNA ( ) and a part of lentiGuide-Puro plasmid (Addgene plasmid #52963) ( ) (See the detailed procedure described in ).

    Article Title: West Nile virus capsid protein inhibits autophagy by AMP-activated protein kinase degradation in neurological disease development
    Article Snippet: .. The sgRNA targeting Atg5 were cloned into the pLX-sgRNA (Addgene plasmid # 50662) [ ], and designated as pLX-Atg5-sgRNA. ..

    Article Title: Cell density-dependent ferroptosis in breast cancer is induced by accumulation of polyunsaturated fatty acid-enriched triacylglycerides
    Article Snippet: The following sgRNA sequences were used: GPX4: 5’-TTTCCGCCAAGGACATCGAC-3’, 5’-CGTGTGCATCGTCACCAACG-3’ and 5’-ACTCAGCGTATCGGGCGTGC-3’, ACSL4: 5’-ATTGTTATTAACAAGTGGAC-3’, 5’-CTAGCTGTAATAGACATCCC-3’ and 5’- TGCAATCATCCATTCGGCCC-3’. .. For PTEN deletion, sgRNA was cloned into a pLX-sgRNA vector (Addgene plasmid#50662) . .. HMLE-Twist1-ER 24hi cells were stably transduced with lentiviruses expressing a doxycycline-inducible Cas9 protein (pCW-Cas9, Addgene #50661) and selected with 1 µg/ml puromycin (Sigma).

    Modification:

    Article Title: KDM2B is involved in the epigenetic regulation of TGF-β-induced epithelial–mesenchymal transition in lung and pancreatic cancer cell lines
    Article Snippet: Single-guide RNAs (sgRNAs) and CRISPR/Cas9 screening The oligonucleotides for five different sgRNAs against 23 PRC1-related genes were designed with CRISPRdirect ( http://crispr.dbcls.jp ) and listed in . .. Linker’s sequences (5’-cacc-3’ for forward primer and 5’-aaac-3’ for reverse primer) were attached to the synthesized oligos, and the annealed oligonucleotides were cloned into the modified pLX-sgRNA plasmid (Addgene plasmid #50662) digested with BsmBI (New England Biolabs, Ipswich, USA). .. The modified plasmid termed pLX-sgRNA ver.2 ( A ) was constructed by combining original pLX-sgRNA ( ) and a part of lentiGuide-Puro plasmid (Addgene plasmid #52963) ( ) (See the detailed procedure described in ).

    Plasmid Preparation:

    Article Title: KDM2B is involved in the epigenetic regulation of TGF-β-induced epithelial–mesenchymal transition in lung and pancreatic cancer cell lines
    Article Snippet: Single-guide RNAs (sgRNAs) and CRISPR/Cas9 screening The oligonucleotides for five different sgRNAs against 23 PRC1-related genes were designed with CRISPRdirect ( http://crispr.dbcls.jp ) and listed in . .. Linker’s sequences (5’-cacc-3’ for forward primer and 5’-aaac-3’ for reverse primer) were attached to the synthesized oligos, and the annealed oligonucleotides were cloned into the modified pLX-sgRNA plasmid (Addgene plasmid #50662) digested with BsmBI (New England Biolabs, Ipswich, USA). .. The modified plasmid termed pLX-sgRNA ver.2 ( A ) was constructed by combining original pLX-sgRNA ( ) and a part of lentiGuide-Puro plasmid (Addgene plasmid #52963) ( ) (See the detailed procedure described in ).

    Article Title: West Nile virus capsid protein inhibits autophagy by AMP-activated protein kinase degradation in neurological disease development
    Article Snippet: .. The sgRNA targeting Atg5 were cloned into the pLX-sgRNA (Addgene plasmid # 50662) [ ], and designated as pLX-Atg5-sgRNA. ..

    Article Title: SHQ1 regulation of RNA splicing is required for T-lymphoblastic leukemia cell survival
    Article Snippet: Flow cytometric sorting was conducted using a FACS Aria (BD Biosciences). .. Inducible SHQ1 knockout cell generation DNA sequences encoding specific sgRNA were constructed into pLX-sgRNA vector according to the instruction (#50662, Addgene). .. Inducible Cas9 JURKAT cells were generated as described .

    Article Title: Cell density-dependent ferroptosis in breast cancer is induced by accumulation of polyunsaturated fatty acid-enriched triacylglycerides
    Article Snippet: The following sgRNA sequences were used: GPX4: 5’-TTTCCGCCAAGGACATCGAC-3’, 5’-CGTGTGCATCGTCACCAACG-3’ and 5’-ACTCAGCGTATCGGGCGTGC-3’, ACSL4: 5’-ATTGTTATTAACAAGTGGAC-3’, 5’-CTAGCTGTAATAGACATCCC-3’ and 5’- TGCAATCATCCATTCGGCCC-3’. .. For PTEN deletion, sgRNA was cloned into a pLX-sgRNA vector (Addgene plasmid#50662) . .. HMLE-Twist1-ER 24hi cells were stably transduced with lentiviruses expressing a doxycycline-inducible Cas9 protein (pCW-Cas9, Addgene #50661) and selected with 1 µg/ml puromycin (Sigma).

    Knock-Out:

    Article Title: SHQ1 regulation of RNA splicing is required for T-lymphoblastic leukemia cell survival
    Article Snippet: Flow cytometric sorting was conducted using a FACS Aria (BD Biosciences). .. Inducible SHQ1 knockout cell generation DNA sequences encoding specific sgRNA were constructed into pLX-sgRNA vector according to the instruction (#50662, Addgene). .. Inducible Cas9 JURKAT cells were generated as described .

    Construct:

    Article Title: SHQ1 regulation of RNA splicing is required for T-lymphoblastic leukemia cell survival
    Article Snippet: Flow cytometric sorting was conducted using a FACS Aria (BD Biosciences). .. Inducible SHQ1 knockout cell generation DNA sequences encoding specific sgRNA were constructed into pLX-sgRNA vector according to the instruction (#50662, Addgene). .. Inducible Cas9 JURKAT cells were generated as described .

    Article Title: Interleukin-10 control of pre-miR155 maturation involves CELF2
    Article Snippet: .. Constructs Lentiviral expression vectors for the doxycycline inducible CRISPR-Cas9 and sgRNA were purchased from Addgene (Lenti-iCas9-neo #85400; pLX-sgRNA #50662 [ , ]). .. Using CRISPR Gold online tool [ ], guide RNA sequence targeting CELF2 gene has been designed: CELF2 target sequence ( 5' GCACTTACCGCCAGGTACTG).

    Article Title: Interleukin-10 contributes to PGE2 signalling through upregulation of EP4 via SHIP1 and STAT3
    Article Snippet: .. Constructs Lentiviral expression vectors for the doxycycline (Dox) inducible CRISPR/Cas9 and sgRNA were purchased from Addgene (Lenti-iCas9-neo #85400; pLX-sgRNA #50662 [ , ]). .. Guide sequences used in the present study to target EP4 gene were designed via CRISPR Gold online tool [ ].

    CRISPR:

    Article Title: Function of HNRNPC in breast cancer cells by controlling the dsRNA‐induced interferon response
    Article Snippet: shRNA lentivirus production and infection The shRNA (MISSION® .. Tet‐on CRISPR/Cas9‐mediated knock‐down Lentiviral expression vectors for Tet‐on CRISPR/Cas9 and sgRNA were purchased from Addgene (pCW‐Cas9 50661; pLX‐sgRNA 50662). .. The constructs were separately mixed with the packaging plasmid psPAX2 and VSVG and transfected to HEK293T cells using the Lipofectamine 2000 reagent (Invitrogen).

    Article Title: Interleukin-10 control of pre-miR155 maturation involves CELF2
    Article Snippet: .. Constructs Lentiviral expression vectors for the doxycycline inducible CRISPR-Cas9 and sgRNA were purchased from Addgene (Lenti-iCas9-neo #85400; pLX-sgRNA #50662 [ , ]). .. Using CRISPR Gold online tool [ ], guide RNA sequence targeting CELF2 gene has been designed: CELF2 target sequence ( 5' GCACTTACCGCCAGGTACTG).

    Article Title: Interleukin-10 contributes to PGE2 signalling through upregulation of EP4 via SHIP1 and STAT3
    Article Snippet: .. Constructs Lentiviral expression vectors for the doxycycline (Dox) inducible CRISPR/Cas9 and sgRNA were purchased from Addgene (Lenti-iCas9-neo #85400; pLX-sgRNA #50662 [ , ]). .. Guide sequences used in the present study to target EP4 gene were designed via CRISPR Gold online tool [ ].

    Expressing:

    Article Title: Function of HNRNPC in breast cancer cells by controlling the dsRNA‐induced interferon response
    Article Snippet: shRNA lentivirus production and infection The shRNA (MISSION® .. Tet‐on CRISPR/Cas9‐mediated knock‐down Lentiviral expression vectors for Tet‐on CRISPR/Cas9 and sgRNA were purchased from Addgene (pCW‐Cas9 50661; pLX‐sgRNA 50662). .. The constructs were separately mixed with the packaging plasmid psPAX2 and VSVG and transfected to HEK293T cells using the Lipofectamine 2000 reagent (Invitrogen).

    Article Title: Interleukin-10 control of pre-miR155 maturation involves CELF2
    Article Snippet: .. Constructs Lentiviral expression vectors for the doxycycline inducible CRISPR-Cas9 and sgRNA were purchased from Addgene (Lenti-iCas9-neo #85400; pLX-sgRNA #50662 [ , ]). .. Using CRISPR Gold online tool [ ], guide RNA sequence targeting CELF2 gene has been designed: CELF2 target sequence ( 5' GCACTTACCGCCAGGTACTG).

    Article Title: Interleukin-10 contributes to PGE2 signalling through upregulation of EP4 via SHIP1 and STAT3
    Article Snippet: .. Constructs Lentiviral expression vectors for the doxycycline (Dox) inducible CRISPR/Cas9 and sgRNA were purchased from Addgene (Lenti-iCas9-neo #85400; pLX-sgRNA #50662 [ , ]). .. Guide sequences used in the present study to target EP4 gene were designed via CRISPR Gold online tool [ ].

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Addgene inc aavs1 targeting sgrna sgcon
    Aavs1 Targeting Sgrna Sgcon, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aavs1 targeting sgrna sgcon/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aavs1 targeting sgrna sgcon - by Bioz Stars, 2021-07
    94/100 stars
      Buy from Supplier

    Image Search Results