zymolyase  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Zymolyase
    Description:
    Digestion of yeast and fungal cell walls is necessary for many experimental procedures including spheroplasting immunofluorescence transformation protein purification and others The use of lytic enzymes like Zymolyase is routinely used for digestion The Zymolyase from Zymo Research is prepared from Arthrobacter luteus lyophilized and packaged with a resuspension buffer The buffer has been optimized to confer maximal levels of enzymatic activity The main activities of the enzyme are β 1 3 glucanase and β 1 3 glucan laminaripentao hydrolase which hydrolyze glucose polymers at the β 1 3 glucan linkages releasing laminaripentaose as the principal product Optimal Zymolyase activity is at 30° 37°C lytic activity ceases at higher temperatures R Zymolyase includes 0 5 U µl RNase A when reconstituted Susceptible fungal genera Asbya Candida Debaryomyces Eremothecium Endomyces Hansenula Hanseniaspora Kloekera Kluyveromyces Lipomyces Metschikowia Pichia Pullularia Saccharomyces Saccharomyces Saccharomycopsis Schizosaccahromyces Torulopsis
    Catalog Number:
    e1004
    Price:
    None
    Applications:
    Yeast Lysis, Yeast Purification
    Size:
    1000 units
    Category:
    Life Science Reagents and Media
    Buy from Supplier


    Structured Review

    Zymo Research zymolyase
    Zymolyase
    Digestion of yeast and fungal cell walls is necessary for many experimental procedures including spheroplasting immunofluorescence transformation protein purification and others The use of lytic enzymes like Zymolyase is routinely used for digestion The Zymolyase from Zymo Research is prepared from Arthrobacter luteus lyophilized and packaged with a resuspension buffer The buffer has been optimized to confer maximal levels of enzymatic activity The main activities of the enzyme are β 1 3 glucanase and β 1 3 glucan laminaripentao hydrolase which hydrolyze glucose polymers at the β 1 3 glucan linkages releasing laminaripentaose as the principal product Optimal Zymolyase activity is at 30° 37°C lytic activity ceases at higher temperatures R Zymolyase includes 0 5 U µl RNase A when reconstituted Susceptible fungal genera Asbya Candida Debaryomyces Eremothecium Endomyces Hansenula Hanseniaspora Kloekera Kluyveromyces Lipomyces Metschikowia Pichia Pullularia Saccharomyces Saccharomyces Saccharomycopsis Schizosaccahromyces Torulopsis
    https://www.bioz.com/result/zymolyase/product/Zymo Research
    Average 95 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    zymolyase - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "The Candida albicans ENO1 gene encodes a transglutaminase involved in growth, cell division, morphogenesis, and osmotic protection"

    Article Title: The Candida albicans ENO1 gene encodes a transglutaminase involved in growth, cell division, morphogenesis, and osmotic protection

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M117.810440

    [ 14 C]Lysine cross-linked by TGase activity was found in low- and high-molecular-weight cell wall proteins and inhibition of TGase enzyme by cystamine and MDC induced changes in cell wall that sensitized cells to zymolyase treatment. A , paper chromatography of [ 14 C]putrescine-labeled material performed by C. albicans TGase activity and released from CW by zymolyase ( filled circles ). Solubilized fraction containing 20,000 cpm analyzed by paper chromatography was described under the “Experimental procedures.” [ 14 C]Putrescine substrate was also analyzed as a control ( open circles ). B , transglutaminase-mediated incorporation of [ 14 C]lysine into endogenous cell wall proteins. Reaction mixtures containing similar aliquots of cell walls and 2.5 μCi of [ 14 C]lysine with no cystamine ( open circles ) or with 50 m m cystamine ( filled circles ), boiled enzymatic source ( open triangles ), or 2 m m EDTA ( filled triangles ) were incubated for the indicated times; radioactivity in TCA-precipitable material was quantified. C , labeled samples with [ 14 C]lysine were sequentially released from cell walls by SDS, zymolyase, and chitinase and analyzed by 10% SDS-PAGE and fluorography. 10,000 cpm of labeled fractions were loaded in each lane. Lane 1, SDS-released material; lane 2 , zymolyase-released material; lane 3 , chitinase-released material. D and E, inhibition of TGase by cystamine and MDC increased sensitivity of C. albicans cells to treatment with zymolyase. Cells of C. albicans (adjusted to OD 600 nm = 0.5) previously incubated without ( circles ) or with 100 m m cystamine ( D ) or 3.5 m m MDC ( E ) for 1.5 h ( triangles ), 2 h ( inverted triangles ), and 4 h ( squares ) were treated with 50 μg ml −1 zymolyase 20T for up to 120 min. At the indicated times, OD 600 nm of cultures was monitored.
    Figure Legend Snippet: [ 14 C]Lysine cross-linked by TGase activity was found in low- and high-molecular-weight cell wall proteins and inhibition of TGase enzyme by cystamine and MDC induced changes in cell wall that sensitized cells to zymolyase treatment. A , paper chromatography of [ 14 C]putrescine-labeled material performed by C. albicans TGase activity and released from CW by zymolyase ( filled circles ). Solubilized fraction containing 20,000 cpm analyzed by paper chromatography was described under the “Experimental procedures.” [ 14 C]Putrescine substrate was also analyzed as a control ( open circles ). B , transglutaminase-mediated incorporation of [ 14 C]lysine into endogenous cell wall proteins. Reaction mixtures containing similar aliquots of cell walls and 2.5 μCi of [ 14 C]lysine with no cystamine ( open circles ) or with 50 m m cystamine ( filled circles ), boiled enzymatic source ( open triangles ), or 2 m m EDTA ( filled triangles ) were incubated for the indicated times; radioactivity in TCA-precipitable material was quantified. C , labeled samples with [ 14 C]lysine were sequentially released from cell walls by SDS, zymolyase, and chitinase and analyzed by 10% SDS-PAGE and fluorography. 10,000 cpm of labeled fractions were loaded in each lane. Lane 1, SDS-released material; lane 2 , zymolyase-released material; lane 3 , chitinase-released material. D and E, inhibition of TGase by cystamine and MDC increased sensitivity of C. albicans cells to treatment with zymolyase. Cells of C. albicans (adjusted to OD 600 nm = 0.5) previously incubated without ( circles ) or with 100 m m cystamine ( D ) or 3.5 m m MDC ( E ) for 1.5 h ( triangles ), 2 h ( inverted triangles ), and 4 h ( squares ) were treated with 50 μg ml −1 zymolyase 20T for up to 120 min. At the indicated times, OD 600 nm of cultures was monitored.

    Techniques Used: Activity Assay, Molecular Weight, Inhibition, Paper Chromatography, Labeling, Incubation, Radioactivity, SDS Page

    2) Product Images from "Antigen Release Kinetics in the Phagosome Are Critical to Cross-Presentation Efficiency"

    Article Title: Antigen Release Kinetics in the Phagosome Are Critical to Cross-Presentation Efficiency

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    doi:

    Ag displayed on the surface of yeast is cross-presented more efficiently than Ag expressed intracellularly in yeast. A , Diagram of the yeast surface display system of strain EBYN9V. The N9V epitope is in bold. B , Dose response of EBYN9V on cross-presentation. EBYN9V and wild-type EBY100 yeast were added to DCs at the indicated ratios. After 24 h, the DCs were assayed for the ability to stimulate IFN- γ secretion in cocultured N9V-specific T cells. Error bars, SDs of duplicate wells. C , EBYN9V yeast and yeast expressing the same Aga2p-N9V fusion protein intracellularly were added to DCs at a 20:1 ratio and tested for the ability to stimulate IFN- γ secretion in cocultured N9V-specific T cells. Lactacystin (5 μ M) or chloroquine (25 μ M) were added to some wells an hour before the yeast were introduced. Error bars, SDs of duplicate wells. D , Samples of the two yeast cultures and wt yeast were subjected to extensive reduction to release proteins disulfide-bonded to the cell wall. Subsequently, the yeast were treated with Zymolyase and lysed. The proteins reduced off the cell wall and the lysed cell extracts were slot-blotted onto the same nitrocellulose membrane and labeled for c- myc .
    Figure Legend Snippet: Ag displayed on the surface of yeast is cross-presented more efficiently than Ag expressed intracellularly in yeast. A , Diagram of the yeast surface display system of strain EBYN9V. The N9V epitope is in bold. B , Dose response of EBYN9V on cross-presentation. EBYN9V and wild-type EBY100 yeast were added to DCs at the indicated ratios. After 24 h, the DCs were assayed for the ability to stimulate IFN- γ secretion in cocultured N9V-specific T cells. Error bars, SDs of duplicate wells. C , EBYN9V yeast and yeast expressing the same Aga2p-N9V fusion protein intracellularly were added to DCs at a 20:1 ratio and tested for the ability to stimulate IFN- γ secretion in cocultured N9V-specific T cells. Lactacystin (5 μ M) or chloroquine (25 μ M) were added to some wells an hour before the yeast were introduced. Error bars, SDs of duplicate wells. D , Samples of the two yeast cultures and wt yeast were subjected to extensive reduction to release proteins disulfide-bonded to the cell wall. Subsequently, the yeast were treated with Zymolyase and lysed. The proteins reduced off the cell wall and the lysed cell extracts were slot-blotted onto the same nitrocellulose membrane and labeled for c- myc .

    Techniques Used: Expressing, Labeling

    3) Product Images from "Mechanical feedback coordinates cell wall expansion and assembly in yeast mating morphogenesis"

    Article Title: Mechanical feedback coordinates cell wall expansion and assembly in yeast mating morphogenesis

    Journal: PLoS Computational Biology

    doi: 10.1371/journal.pcbi.1005940

    Effect of mechanical feedback strength and turgor pressure on cell viability. The strength of mechanical feedback, Γ, is experimentally varied by deleting MID2 and WSC1 . The dimensionless parameter ( Pρ w λ X )/(12 μ 0 m w ρ 0 k p ) is varied by changing the osmolarity of the external medium through dilution of the yeast growth media, YPD, in deionized H 2 O, effectively increasing turgor pressure P in cells. Cell lysis was measured using the PI staining viability assay ( Methods ). (A) Percent of lysed cells in the absence of α -factor for WT, mid2Δ and wsc1Δ mutants, as well as the mid2 Δ wsc1Δ double mutant. (B) Percent of WT lysed cells when grown in the presence of α -factor in YPD medium with decreasing osmolarity. (C) Percent of mid2Δ wsc1Δ lysed cells when grown both in the presence and absence of α -factor in YPD, in osmotically supported conditions (YPD + 1M sorbitol), as well as in hypo-osmotic conditions (100% H 2 O). (D) Percent of mid2Δ wsc1Δ lysed cells when grown in the presence of α -factor and osmotically supported media (YPD + sorbitol), diluted for decreasing osmolarities. (E) Percent of lysed cells in mid2Δ and wsc1Δ mutants, as well as the mid2Δ wsc1Δ double mutant, when grown in the presence of α -factor in YPD. (F) Theoretically predicted dynamical regimes for varying values of the mechanical feedback strength Γ and the ratio ( Pρ w λ X )/(12 μ 0 m w ρ 0 k p ). Decreasing osmolarity experimentally, corresponds to increasing P and, therefore, moving along horizontal lines in the positive direction. Addition of zymolyase, a cell wall degrading enzyme, corresponds to decreasing the cell wall viscosity, moving also along horizontal lines in the positive direction. (G) Images (DIC, PI staining and merge) showing the moments before and after the piercing of the cell wall at the tip of a mating projection and subsequent cell lysis of a mid2Δ cell after the addition of zymolyase, for video see S1 Video . Scale bar, 2 μm . (H) Temporal increase in the fraction of pierced mating projections for both mid2Δ (squares) and WT (circles) cells after addition of zymolyase.
    Figure Legend Snippet: Effect of mechanical feedback strength and turgor pressure on cell viability. The strength of mechanical feedback, Γ, is experimentally varied by deleting MID2 and WSC1 . The dimensionless parameter ( Pρ w λ X )/(12 μ 0 m w ρ 0 k p ) is varied by changing the osmolarity of the external medium through dilution of the yeast growth media, YPD, in deionized H 2 O, effectively increasing turgor pressure P in cells. Cell lysis was measured using the PI staining viability assay ( Methods ). (A) Percent of lysed cells in the absence of α -factor for WT, mid2Δ and wsc1Δ mutants, as well as the mid2 Δ wsc1Δ double mutant. (B) Percent of WT lysed cells when grown in the presence of α -factor in YPD medium with decreasing osmolarity. (C) Percent of mid2Δ wsc1Δ lysed cells when grown both in the presence and absence of α -factor in YPD, in osmotically supported conditions (YPD + 1M sorbitol), as well as in hypo-osmotic conditions (100% H 2 O). (D) Percent of mid2Δ wsc1Δ lysed cells when grown in the presence of α -factor and osmotically supported media (YPD + sorbitol), diluted for decreasing osmolarities. (E) Percent of lysed cells in mid2Δ and wsc1Δ mutants, as well as the mid2Δ wsc1Δ double mutant, when grown in the presence of α -factor in YPD. (F) Theoretically predicted dynamical regimes for varying values of the mechanical feedback strength Γ and the ratio ( Pρ w λ X )/(12 μ 0 m w ρ 0 k p ). Decreasing osmolarity experimentally, corresponds to increasing P and, therefore, moving along horizontal lines in the positive direction. Addition of zymolyase, a cell wall degrading enzyme, corresponds to decreasing the cell wall viscosity, moving also along horizontal lines in the positive direction. (G) Images (DIC, PI staining and merge) showing the moments before and after the piercing of the cell wall at the tip of a mating projection and subsequent cell lysis of a mid2Δ cell after the addition of zymolyase, for video see S1 Video . Scale bar, 2 μm . (H) Temporal increase in the fraction of pierced mating projections for both mid2Δ (squares) and WT (circles) cells after addition of zymolyase.

    Techniques Used: Lysis, Staining, Viability Assay, Mutagenesis

    4) Product Images from "Inhibition of Cdc42 during mitotic exit is required for cytokinesis"

    Article Title: Inhibition of Cdc42 during mitotic exit is required for cytokinesis

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201301090

    Active Cdc42 interferes with cytokinesis and cell separation. (A) Cells transformed with vector (VEC) or GAL1-HA-CDC42 plasmids were spotted in fivefold dilutions on the indicated media (3 d at 25°C). OE, overexpression; GAL, galactose. (B) Expression of cdc42 G60D from the CDC42 promoter on a CEN plasmid (one to three copies per cell) is toxic to myo1Δ cells. Cells were grown on the indicated media (3 d at 25°C). Synthetic lethality is detected on 5-fluoroorotic acid (5FOA) media as a counterselection for the indicated URA3 -containing plasmids. (C) myo1Δ cells transformed with control or CDC24 2μ plasmids were grown on plates as in B. SC, synthetic complete. (D) Wild-type (wt) and bem2-ts cells were arrested in metaphase by CDC20 depletion, shifted to the restrictive temperature (37°C at 1.5 h), and processed for Cdc42 activation. Graph shows means ± SEM from three experiments. (E) Cells were arrested in metaphase, shifted to 37°C for 1 h, and released at 37°C. The percentage of cells with the indicated morphology is plotted as means ± SEM from three experiments. Connected indicates two adjacent cell bodies showing evidence of rebudding or repolarization. (F) Bright-field image of cells 50 min after release. Bar, 15 µm. (G) Cells from E were treated with zymolyase to digest the cell wall, and the percentage of large-budded or connected cells was scored. (H) Wild-type cells have a PS (arrow) sandwiched by secondary septa; bem2-ts cells have misaligned, multiple, or otherwise abnormal PSs (arrowheads). Bars, 500 nm.
    Figure Legend Snippet: Active Cdc42 interferes with cytokinesis and cell separation. (A) Cells transformed with vector (VEC) or GAL1-HA-CDC42 plasmids were spotted in fivefold dilutions on the indicated media (3 d at 25°C). OE, overexpression; GAL, galactose. (B) Expression of cdc42 G60D from the CDC42 promoter on a CEN plasmid (one to three copies per cell) is toxic to myo1Δ cells. Cells were grown on the indicated media (3 d at 25°C). Synthetic lethality is detected on 5-fluoroorotic acid (5FOA) media as a counterselection for the indicated URA3 -containing plasmids. (C) myo1Δ cells transformed with control or CDC24 2μ plasmids were grown on plates as in B. SC, synthetic complete. (D) Wild-type (wt) and bem2-ts cells were arrested in metaphase by CDC20 depletion, shifted to the restrictive temperature (37°C at 1.5 h), and processed for Cdc42 activation. Graph shows means ± SEM from three experiments. (E) Cells were arrested in metaphase, shifted to 37°C for 1 h, and released at 37°C. The percentage of cells with the indicated morphology is plotted as means ± SEM from three experiments. Connected indicates two adjacent cell bodies showing evidence of rebudding or repolarization. (F) Bright-field image of cells 50 min after release. Bar, 15 µm. (G) Cells from E were treated with zymolyase to digest the cell wall, and the percentage of large-budded or connected cells was scored. (H) Wild-type cells have a PS (arrow) sandwiched by secondary septa; bem2-ts cells have misaligned, multiple, or otherwise abnormal PSs (arrowheads). Bars, 500 nm.

    Techniques Used: Transformation Assay, Plasmid Preparation, Over Expression, Expressing, Activation Assay

    Related Articles

    Centrifugation:

    Article Title: Genome-Scale Genetic Interactions and Cell Imaging Confirm Cytokinesis as Deleterious to Transient Topoisomerase II Deficiency in Saccharomyces cerevisiae
    Article Snippet: Finally, the sample was split in two; one half was treated with 0.2 mg/ml zymolyase 20T (E1005, Zymo Research) in the above sorbitol buffer containing 4 mM β-mercaptoethanol for 20 min at 37°, whereas the other half was treated in the same conditions but without zymolyase (mock control). .. For the time-lapse movies, an asynchronous culture was concentrated by centrifugation to three OD600 equivalents and plated on YPDA (YPD, agar 2% w/v).

    Amplification:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: T4 DNA ligase (New England Biolabs, cat. no.M0202) T4 DNA Ligase Buffer 10× (New England Biolabs, cat. no. B0202S) T4 Polynucleotide Kinase (New England Biolabs, cat. no. M0201) Deoxyribonucleotide triphosphates (dNTPs; 10 mM each nucleotide; New England Biolabs, cat. no. N0447) DpnI restriction endonuclease (New England Biolabs, cat. no. R0176) Taq polymerase (New England Biolabs, cat. no. M0273) Phusion® High-Fidelity DNA polymerase (New England Biolabs, cat. no. M0530S) ▲CRITICAL – a high-fidelity polymerase should be used for amplification products intended for use in downstream deep-sequencing to limit PCR errors. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Article Title: A genetic tool to track protein aggregates and control prion inheritance
    Article Snippet: RNA was extracted using the YeaSTAR RNA kit (Zymo Research, Cat# E1004). cDNA was prepared using the SuperScriptIII kit (ThermoFisher Scientific, Cat# 18080051), using dT18 NV- as the primer to amplify from the start of polyA tails. .. Internal control primer pairs were amplified in separate reactions simultaneously.

    Picogreen Assay:

    Article Title: Mapping regulatory factors by immunoprecipitation from native chromatin
    Article Snippet: - YPD culture medium - Resuspension Buffer (see Recipes) 1.2 M sorbitol, 100 mM potassium phosphate buffer, pH 7.5, 0.5 M CaCl2, 0.5 mM 2-mercaptoethanol - Zymolyase (100T equivalent, ZymoResearch, Cat. No E1004) - SPC Buffer (see Recipes) 1 M sorbitol, 200 mM PIPES, pH 6.3, 0.1 mM CaCl2 - SPC Buffer with protease inhibitors (see Recipes) Same as above, with 1 mM phenylmethanesulfonyl fluoride (PMSF) and 10 ug/mL each of leupeptin, pepstatin A, and chymostatin (LPC) - Ficoll Buffer 9% Ficoll-400, 20 mM PIPES, pH 6.3, 0.5 mM CaCl2 - Liquid Nitrogen - 1 M CaCl2 - MNase (Sigma-Aldrich, Cat. No. N3755; 1 U MNase/5 uL nuclease-free water) - 0.5 M EDTA, pH 8.0 - 1 M Tris, pH 8.0 - Potassium phosphate buffer, pH 7.5 - 1 M PIPES, pH 6.3 - 80 mM, 150 mM or 600 mM NaCl Extraction Buffer 70, 140, or 590 mM NaCl, 0.75 mM EDTA, 10 mM potassium phosphate buffer, pH 7.5, 0.1% Triton X-100. .. - 5 M NaCl - Anti-FLAG M2 magnetic beads (Sigma-Aldrich, Cat. No. A2220) - IP Wash Buffer 10 mM phosphate phosphate buffer, pH 7.5, 0.75 mM EDTA, 70 mM NaCl - RNase A (10 mg/mL, Thermo Scientific, Cat No EN0531) - Proteinase K (20 mg/mL, Life Technologies, Cat. No. AM2542) - Phenol/Chlorophorm/Isoamyl alcohol - Glycogen (20 mg/mL, Life Technologies, Cat. No. 10814-010) - 100% ethanol - 70% ethanol - TE0.1 buffer (see Recipes) - Quant-iT PicoGreen dsDNA assay kit. (Life Technologies, Cat. No. )

    Cytometry:

    Article Title: Deletion of Cryptococcus neoformans AIF Ortholog Promotes Chromosome Aneuploidy and Fluconazole-Resistance in a Metacaspase-Independent Manner
    Article Snippet: After treatment with 5% β-mercaptoethanol in SPM (1.2 M sorbitol; 50 mM K-phosphate, pH 7.3; and 1 mM MgCl2 ) for 1 h at 37°C with gentle agitation, cells were washed with SPM and then digested with 10 µl of zymolyaseTM (Zymo Research, 4 U/µL), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma), and 0.1% bovine serum albumin (Sigma) in 1 ml of spheroplasting buffer (1 M sorbitol; 10 mM EDTA; and 100 mM sodium citrate, pH 5.8) for 40 min at 37°C with gentle agitation. .. Cells were washed with PBS and immediately analyzed by epifluorescence microscopy (see next section) or flow cytometry.

    Blocking Assay:

    Article Title: CRL4Wdr70 regulates H2B monoubiquitination and facilitates Exo1-dependent resection
    Article Snippet: Microscopy To assay foci of Rad52-YFP and Rpa1-YFP, 10 OD of logarithmically growing cells collected at indicated time points after X-ray treatment were fixed in 70% ethanol for 10 min, washed in PBS and then treated with 0.5 mg ml−1 Zymolyase 20 T (ZYMO Research, E1004-A) in PBS for 10 min. .. Cells were blocked in PBS containing 10% fetal calf serum for 1 h and incubated overnight with a 1:100 dilution of anti-green fluorescent protein antibody (Roche, 1814460001) in blocking buffer containing 0.05% Tween-20.

    Article Title: The Heme Transport Capacity of LHR1 Determines the Extent of Virulence in Leishmania amazonensis
    Article Snippet: Cells were then resuspended in TEβ (200 mM Tris pH 8.0, 20 mM EDTA, 1% β-mercaptoethanol), incubated at 30°C for 10 min, pelleted and resuspended in spheroplast solution (1.2 M sorbitol, 50 mM KH2 PO4 pH 7.4, 1 mM MgCl2 , 0.1 U/ul zymolyase (Zymo Research; Cat. # E1004)) followed by incubation at 30°C for 45 min and washes in 1.2 M sorbitol. .. After blocking for 1 h with 1% horse serum in PBS-BSA (PBS supplemented with 5 mg/ml BSA) spheroplasts were incubated with 1:1000 anti-HA (BioLegend; Cat. # MMS-101P) antibodies in PBS-BSA for 2 h, followed by Alexa Fluor 488 goat anti-mouse (Invitrogen; Cat. # A11001) at 1:10,000 in PBS-BSA for 1 h and mounted using ProLong Gold Antifade.

    SYBR Green Assay:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Incubation:

    Article Title: Structure of the Cladosporium fulvum Avr4 effector in complex with (GlcNAc)6 reveals the ligand-binding mechanism and uncouples its intrinsic function from recognition by the Cf-4 resistance protein
    Article Snippet: The following day, 5 μM of WT-CfAvr4 or ChBD mutants were mixed with 7.5 units of Zymolyase (Zymo Research cat. no. E1004) and 0.2 units of bacterial chitinases (Sigma-Aldrich cat. no. C6137) and the mixture was added to the microtitre plate wells containing the pre-germinated spores in a final volume of 150 μl. .. Plates were incubated at 25°C for 6–8 h before evaluating under the microscope fungal growth and the ability of the proteins to provide protection against chitinases.

    Article Title: CRL4Wdr70 regulates H2B monoubiquitination and facilitates Exo1-dependent resection
    Article Snippet: Microscopy To assay foci of Rad52-YFP and Rpa1-YFP, 10 OD of logarithmically growing cells collected at indicated time points after X-ray treatment were fixed in 70% ethanol for 10 min, washed in PBS and then treated with 0.5 mg ml−1 Zymolyase 20 T (ZYMO Research, E1004-A) in PBS for 10 min. .. Cells were blocked in PBS containing 10% fetal calf serum for 1 h and incubated overnight with a 1:100 dilution of anti-green fluorescent protein antibody (Roche, 1814460001) in blocking buffer containing 0.05% Tween-20.

    Article Title: Genome-Scale Genetic Interactions and Cell Imaging Confirm Cytokinesis as Deleterious to Transient Topoisomerase II Deficiency in Saccharomyces cerevisiae
    Article Snippet: Finally, the sample was split in two; one half was treated with 0.2 mg/ml zymolyase 20T (E1005, Zymo Research) in the above sorbitol buffer containing 4 mM β-mercaptoethanol for 20 min at 37°, whereas the other half was treated in the same conditions but without zymolyase (mock control). .. They were incubated at 37° in high humidity chambers to avoid drying of the agarose patch.

    Article Title: Deletion of Cryptococcus neoformans AIF Ortholog Promotes Chromosome Aneuploidy and Fluconazole-Resistance in a Metacaspase-Independent Manner
    Article Snippet: After treatment with 5% β-mercaptoethanol in SPM (1.2 M sorbitol; 50 mM K-phosphate, pH 7.3; and 1 mM MgCl2 ) for 1 h at 37°C with gentle agitation, cells were washed with SPM and then digested with 10 µl of zymolyaseTM (Zymo Research, 4 U/µL), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma), and 0.1% bovine serum albumin (Sigma) in 1 ml of spheroplasting buffer (1 M sorbitol; 10 mM EDTA; and 100 mM sodium citrate, pH 5.8) for 40 min at 37°C with gentle agitation. .. Samples were permeabilized with 0.5 ml of fresh prepared 0.1% Triton X-100, 0.1% sodium citrate solution in cold SPM for 2 min in ice, washed twice with SPM, and incubated with 50 µl TUNEL reaction mixture (In Situ Cell Death Detection Kit, Roche) for 60 min at 37°C in dark and humid conditions.

    Article Title: Genome analysis of three Pneumocystis species reveals adaptation mechanisms to life exclusively in mammalian hosts
    Article Snippet: .. The pellet was washed three times in PBS, resuspended in 100 μl of 0.5% (w/v) Zymolyase solution (Zymo Research) and incubated at 37 °C for 1 h. Genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre). ..

    Article Title: The Heme Transport Capacity of LHR1 Determines the Extent of Virulence in Leishmania amazonensis
    Article Snippet: .. Cells were then resuspended in TEβ (200 mM Tris pH 8.0, 20 mM EDTA, 1% β-mercaptoethanol), incubated at 30°C for 10 min, pelleted and resuspended in spheroplast solution (1.2 M sorbitol, 50 mM KH2 PO4 pH 7.4, 1 mM MgCl2 , 0.1 U/ul zymolyase (Zymo Research; Cat. # E1004)) followed by incubation at 30°C for 45 min and washes in 1.2 M sorbitol. .. Spheroplasts were permeabilized in 0.6 M sorbitol with 1% SDS for 2 min, washed with 1.2 M sorbitol and attached to coverslips coated with Poly-L-Lysine (Sigma Aldrich; Cat. # P8920).

    Article Title: Structural Analysis of an Avr4 Effector Ortholog Offers Insight into Chitin Binding and Recognition by the Cf-4 Receptor
    Article Snippet: .. Fifty microliters of germinated spores were mixed with 50 μL 0.2 μg/μL whole tomato leaf protein extract and 10 μg Avr4 protein in a total reaction volume of 150 μL, and the reaction was incubated at 25°C for 8 to 10 h. To detect the ability of the Avr4 proteins to protect T. viride germlings against bacterial chitinase (chitinase from Streptomyces griseus ; Sigma-Aldrich; cat. no. C6137) and fungal chitinase (chitinase from T.viride ; Sigma-Aldrich; cat. no. C8241) activity, T. viride germlings were treated with 5 units of Zymolyase (Zymo Research; cat. no. E1004), 0.2 units of either bacterial chitinase or fungal chitinase, and 10 μg Avr4 protein in a total reaction volume of 150 μL. .. Zymolase contains β-1,3 glucanase and β-1,3-glucan laminaripentao-hydrolase activity and was used to remove the surface glucan layer on the fungal cell wall, exposing the underlying chitin.

    Activity Assay:

    Article Title: Structure of the Cladosporium fulvum Avr4 effector in complex with (GlcNAc)6 reveals the ligand-binding mechanism and uncouples its intrinsic function from recognition by the Cf-4 resistance protein
    Article Snippet: The following day, 5 μM of WT-CfAvr4 or ChBD mutants were mixed with 7.5 units of Zymolyase (Zymo Research cat. no. E1004) and 0.2 units of bacterial chitinases (Sigma-Aldrich cat. no. C6137) and the mixture was added to the microtitre plate wells containing the pre-germinated spores in a final volume of 150 μl. .. Zymolase has β-1,3 glucanase and β-1,3-glucan laminaripentaohydrolase activity and is added to the mixture in order to remove the surface glucans from the fungal cell wall and thus expose the underlying chitin layer.

    Article Title: Structural Analysis of an Avr4 Effector Ortholog Offers Insight into Chitin Binding and Recognition by the Cf-4 Receptor
    Article Snippet: .. Fifty microliters of germinated spores were mixed with 50 μL 0.2 μg/μL whole tomato leaf protein extract and 10 μg Avr4 protein in a total reaction volume of 150 μL, and the reaction was incubated at 25°C for 8 to 10 h. To detect the ability of the Avr4 proteins to protect T. viride germlings against bacterial chitinase (chitinase from Streptomyces griseus ; Sigma-Aldrich; cat. no. C6137) and fungal chitinase (chitinase from T.viride ; Sigma-Aldrich; cat. no. C8241) activity, T. viride germlings were treated with 5 units of Zymolyase (Zymo Research; cat. no. E1004), 0.2 units of either bacterial chitinase or fungal chitinase, and 10 μg Avr4 protein in a total reaction volume of 150 μL. .. Zymolase contains β-1,3 glucanase and β-1,3-glucan laminaripentao-hydrolase activity and was used to remove the surface glucan layer on the fungal cell wall, exposing the underlying chitin.

    Förster Resonance Energy Transfer:

    Article Title: Genome analysis of three Pneumocystis species reveals adaptation mechanisms to life exclusively in mammalian hosts
    Article Snippet: The pellet was washed three times in PBS, resuspended in 100 μl of 0.5% (w/v) Zymolyase solution (Zymo Research) and incubated at 37 °C for 1 h. Genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre). .. All DNA samples were analysed by quantitative real-time PCR (qPCR) assays using fluorescence resonance energy transfer probes to measure the fraction of Pneumocystis DNA compared with host DNA in each sample.

    Expressing:

    Article Title: The Heme Transport Capacity of LHR1 Determines the Extent of Virulence in Leishmania amazonensis
    Article Snippet: Immunofluorescence For S . cerevisiae , plasmids for yLHR1 expression (pYesDEST52-yLHR1-HA WT/Y18A/H36A/Y80A/Y129A) or vector alone (pYesDEST52) were transformed into the Δhem1 (6D) strain, selected for as described above, then grown in 2% w/v raffinose, 0.4% w/v galactose SC (-Ura) supplemented with 250 μM ALA starting at an OD600 of 0.1 until an OD600 of 0.6–0.8. .. Cells were then resuspended in TEβ (200 mM Tris pH 8.0, 20 mM EDTA, 1% β-mercaptoethanol), incubated at 30°C for 10 min, pelleted and resuspended in spheroplast solution (1.2 M sorbitol, 50 mM KH2 PO4 pH 7.4, 1 mM MgCl2 , 0.1 U/ul zymolyase (Zymo Research; Cat. # E1004)) followed by incubation at 30°C for 45 min and washes in 1.2 M sorbitol.

    Transformation Assay:

    Article Title: The Heme Transport Capacity of LHR1 Determines the Extent of Virulence in Leishmania amazonensis
    Article Snippet: Immunofluorescence For S . cerevisiae , plasmids for yLHR1 expression (pYesDEST52-yLHR1-HA WT/Y18A/H36A/Y80A/Y129A) or vector alone (pYesDEST52) were transformed into the Δhem1 (6D) strain, selected for as described above, then grown in 2% w/v raffinose, 0.4% w/v galactose SC (-Ura) supplemented with 250 μM ALA starting at an OD600 of 0.1 until an OD600 of 0.6–0.8. .. Cells were then resuspended in TEβ (200 mM Tris pH 8.0, 20 mM EDTA, 1% β-mercaptoethanol), incubated at 30°C for 10 min, pelleted and resuspended in spheroplast solution (1.2 M sorbitol, 50 mM KH2 PO4 pH 7.4, 1 mM MgCl2 , 0.1 U/ul zymolyase (Zymo Research; Cat. # E1004)) followed by incubation at 30°C for 45 min and washes in 1.2 M sorbitol.

    Over Expression:

    Article Title: A genetic tool to track protein aggregates and control prion inheritance
    Article Snippet: Rapid Amplification of cDNA Ends (RACE) was used to detect alterations in mRNA polyadenylation sites in the presence of Nab2 overexpression. .. RNA was extracted using the YeaSTAR RNA kit (Zymo Research, Cat# E1004). cDNA was prepared using the SuperScriptIII kit (ThermoFisher Scientific, Cat# 18080051), using dT18 NV- as the primer to amplify from the start of polyA tails.

    TUNEL Assay:

    Article Title: Deletion of Cryptococcus neoformans AIF Ortholog Promotes Chromosome Aneuploidy and Fluconazole-Resistance in a Metacaspase-Independent Manner
    Article Snippet: Paragraph title: TUNEL assay ... After treatment with 5% β-mercaptoethanol in SPM (1.2 M sorbitol; 50 mM K-phosphate, pH 7.3; and 1 mM MgCl2 ) for 1 h at 37°C with gentle agitation, cells were washed with SPM and then digested with 10 µl of zymolyaseTM (Zymo Research, 4 U/µL), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma), and 0.1% bovine serum albumin (Sigma) in 1 ml of spheroplasting buffer (1 M sorbitol; 10 mM EDTA; and 100 mM sodium citrate, pH 5.8) for 40 min at 37°C with gentle agitation.

    Flow Cytometry:

    Article Title: Deletion of Cryptococcus neoformans AIF Ortholog Promotes Chromosome Aneuploidy and Fluconazole-Resistance in a Metacaspase-Independent Manner
    Article Snippet: After treatment with 5% β-mercaptoethanol in SPM (1.2 M sorbitol; 50 mM K-phosphate, pH 7.3; and 1 mM MgCl2 ) for 1 h at 37°C with gentle agitation, cells were washed with SPM and then digested with 10 µl of zymolyaseTM (Zymo Research, 4 U/µL), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma), and 0.1% bovine serum albumin (Sigma) in 1 ml of spheroplasting buffer (1 M sorbitol; 10 mM EDTA; and 100 mM sodium citrate, pH 5.8) for 40 min at 37°C with gentle agitation. .. Cells were washed with PBS and immediately analyzed by epifluorescence microscopy (see next section) or flow cytometry.

    Ligation:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: A starting plasmid to generate libraries that does not contain sites for the type IIS endonuclease that you plan to use for the cassette ligation strategy, such as pRNDM ( ). .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Transferring:

    Article Title: The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions
    Article Snippet: Add 50 μl of zymolyase solution (100 mM sodium phosphate buffer, pH 7.4, 1 M sorbitol, and 2 units zymolyase from ZymoResearch). .. Mix by pipetting the solution in and out of a pipette tip.

    Infection:

    Article Title: Genome analysis of three Pneumocystis species reveals adaptation mechanisms to life exclusively in mammalian hosts
    Article Snippet: Preparation of genomic DNA samples Pneumocystis -infected lung tissues were cut into small pieces, homogenized in Qiagen Tissuelyser (5 times for 20 s at 1/30 frequency), then centrifuged at 15,000g for 6 min. .. The pellet was washed three times in PBS, resuspended in 100 μl of 0.5% (w/v) Zymolyase solution (Zymo Research) and incubated at 37 °C for 1 h. Genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre).

    Polymerase Chain Reaction:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Article Title: Conserved and Diverged Functions of the Calcineurin-Activated Prz1 Transcription Factor in Fission Yeast
    Article Snippet: Cell-wall sensitivity was assayed with 0.5 µg/ml micafungin (A13270-1: AdooQ Bioscience, Irvine, CA) and 25 U/ml Zymolyase 100T (E1005: Zymo Research, Irvine, CA). .. Deletion and epitope-tagged strains were constructed by a PCR-based stitching method as described in .

    Article Title: A genetic tool to track protein aggregates and control prion inheritance
    Article Snippet: Paragraph title: 3’ UTR PCR (RACE) experiments ... RNA was extracted using the YeaSTAR RNA kit (Zymo Research, Cat# E1004). cDNA was prepared using the SuperScriptIII kit (ThermoFisher Scientific, Cat# 18080051), using dT18 NV- as the primer to amplify from the start of polyA tails.

    Cellular Antioxidant Activity Assay:

    Article Title: The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions
    Article Snippet: Confirm that colonies used in (1.21) are Ura+ by streaking them out on a CAA-Ura plate. .. Add 50 μl of zymolyase solution (100 mM sodium phosphate buffer, pH 7.4, 1 M sorbitol, and 2 units zymolyase from ZymoResearch).

    Immunofluorescence:

    Article Title: The Heme Transport Capacity of LHR1 Determines the Extent of Virulence in Leishmania amazonensis
    Article Snippet: Paragraph title: Immunofluorescence ... Cells were then resuspended in TEβ (200 mM Tris pH 8.0, 20 mM EDTA, 1% β-mercaptoethanol), incubated at 30°C for 10 min, pelleted and resuspended in spheroplast solution (1.2 M sorbitol, 50 mM KH2 PO4 pH 7.4, 1 mM MgCl2 , 0.1 U/ul zymolyase (Zymo Research; Cat. # E1004)) followed by incubation at 30°C for 45 min and washes in 1.2 M sorbitol.

    Fluorescence:

    Article Title: Genome-Scale Genetic Interactions and Cell Imaging Confirm Cytokinesis as Deleterious to Transient Topoisomerase II Deficiency in Saccharomyces cerevisiae
    Article Snippet: Paragraph title: Yeast strain construction, cell cycle experiments, and fluorescence microscopy ... Finally, the sample was split in two; one half was treated with 0.2 mg/ml zymolyase 20T (E1005, Zymo Research) in the above sorbitol buffer containing 4 mM β-mercaptoethanol for 20 min at 37°, whereas the other half was treated in the same conditions but without zymolyase (mock control).

    Article Title: Genome analysis of three Pneumocystis species reveals adaptation mechanisms to life exclusively in mammalian hosts
    Article Snippet: The pellet was washed three times in PBS, resuspended in 100 μl of 0.5% (w/v) Zymolyase solution (Zymo Research) and incubated at 37 °C for 1 h. Genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre). .. All DNA samples were analysed by quantitative real-time PCR (qPCR) assays using fluorescence resonance energy transfer probes to measure the fraction of Pneumocystis DNA compared with host DNA in each sample.

    Magnetic Beads:

    Article Title: Mapping regulatory factors by immunoprecipitation from native chromatin
    Article Snippet: - YPD culture medium - Resuspension Buffer (see Recipes) 1.2 M sorbitol, 100 mM potassium phosphate buffer, pH 7.5, 0.5 M CaCl2, 0.5 mM 2-mercaptoethanol - Zymolyase (100T equivalent, ZymoResearch, Cat. No E1004) - SPC Buffer (see Recipes) 1 M sorbitol, 200 mM PIPES, pH 6.3, 0.1 mM CaCl2 - SPC Buffer with protease inhibitors (see Recipes) Same as above, with 1 mM phenylmethanesulfonyl fluoride (PMSF) and 10 ug/mL each of leupeptin, pepstatin A, and chymostatin (LPC) - Ficoll Buffer 9% Ficoll-400, 20 mM PIPES, pH 6.3, 0.5 mM CaCl2 - Liquid Nitrogen - 1 M CaCl2 - MNase (Sigma-Aldrich, Cat. No. N3755; 1 U MNase/5 uL nuclease-free water) - 0.5 M EDTA, pH 8.0 - 1 M Tris, pH 8.0 - Potassium phosphate buffer, pH 7.5 - 1 M PIPES, pH 6.3 - 80 mM, 150 mM or 600 mM NaCl Extraction Buffer 70, 140, or 590 mM NaCl, 0.75 mM EDTA, 10 mM potassium phosphate buffer, pH 7.5, 0.1% Triton X-100. .. - 5 M NaCl - Anti-FLAG M2 magnetic beads (Sigma-Aldrich, Cat. No. A2220) - IP Wash Buffer 10 mM phosphate phosphate buffer, pH 7.5, 0.75 mM EDTA, 70 mM NaCl - RNase A (10 mg/mL, Thermo Scientific, Cat No EN0531) - Proteinase K (20 mg/mL, Life Technologies, Cat. No. AM2542) - Phenol/Chlorophorm/Isoamyl alcohol - Glycogen (20 mg/mL, Life Technologies, Cat. No. 10814-010) - 100% ethanol - 70% ethanol - TE0.1 buffer (see Recipes) - Quant-iT PicoGreen dsDNA assay kit. (Life Technologies, Cat. No. )

    Microscopy:

    Article Title: Structure of the Cladosporium fulvum Avr4 effector in complex with (GlcNAc)6 reveals the ligand-binding mechanism and uncouples its intrinsic function from recognition by the Cf-4 resistance protein
    Article Snippet: The following day, 5 μM of WT-CfAvr4 or ChBD mutants were mixed with 7.5 units of Zymolyase (Zymo Research cat. no. E1004) and 0.2 units of bacterial chitinases (Sigma-Aldrich cat. no. C6137) and the mixture was added to the microtitre plate wells containing the pre-germinated spores in a final volume of 150 μl. .. Plates were incubated at 25°C for 6–8 h before evaluating under the microscope fungal growth and the ability of the proteins to provide protection against chitinases.

    Article Title: CRL4Wdr70 regulates H2B monoubiquitination and facilitates Exo1-dependent resection
    Article Snippet: .. Microscopy To assay foci of Rad52-YFP and Rpa1-YFP, 10 OD of logarithmically growing cells collected at indicated time points after X-ray treatment were fixed in 70% ethanol for 10 min, washed in PBS and then treated with 0.5 mg ml−1 Zymolyase 20 T (ZYMO Research, E1004-A) in PBS for 10 min. .. Cells were blocked in PBS containing 10% fetal calf serum for 1 h and incubated overnight with a 1:100 dilution of anti-green fluorescent protein antibody (Roche, 1814460001) in blocking buffer containing 0.05% Tween-20.

    Article Title: Genome-Scale Genetic Interactions and Cell Imaging Confirm Cytokinesis as Deleterious to Transient Topoisomerase II Deficiency in Saccharomyces cerevisiae
    Article Snippet: Paragraph title: Yeast strain construction, cell cycle experiments, and fluorescence microscopy ... Finally, the sample was split in two; one half was treated with 0.2 mg/ml zymolyase 20T (E1005, Zymo Research) in the above sorbitol buffer containing 4 mM β-mercaptoethanol for 20 min at 37°, whereas the other half was treated in the same conditions but without zymolyase (mock control).

    Article Title: The Heme Transport Capacity of LHR1 Determines the Extent of Virulence in Leishmania amazonensis
    Article Snippet: Cells were then resuspended in TEβ (200 mM Tris pH 8.0, 20 mM EDTA, 1% β-mercaptoethanol), incubated at 30°C for 10 min, pelleted and resuspended in spheroplast solution (1.2 M sorbitol, 50 mM KH2 PO4 pH 7.4, 1 mM MgCl2 , 0.1 U/ul zymolyase (Zymo Research; Cat. # E1004)) followed by incubation at 30°C for 45 min and washes in 1.2 M sorbitol. .. Images were acquired using a DeltaVision Elite Deconvolution Microscope (GE Healthcare) under identical acquisition settings.

    Article Title: Structural Analysis of an Avr4 Effector Ortholog Offers Insight into Chitin Binding and Recognition by the Cf-4 Receptor
    Article Snippet: Fifty microliters of germinated spores were mixed with 50 μL 0.2 μg/μL whole tomato leaf protein extract and 10 μg Avr4 protein in a total reaction volume of 150 μL, and the reaction was incubated at 25°C for 8 to 10 h. To detect the ability of the Avr4 proteins to protect T. viride germlings against bacterial chitinase (chitinase from Streptomyces griseus ; Sigma-Aldrich; cat. no. C6137) and fungal chitinase (chitinase from T.viride ; Sigma-Aldrich; cat. no. C8241) activity, T. viride germlings were treated with 5 units of Zymolyase (Zymo Research; cat. no. E1004), 0.2 units of either bacterial chitinase or fungal chitinase, and 10 μg Avr4 protein in a total reaction volume of 150 μL. .. The reactions were incubated at 25°C for 8 to 10 h, after which time images were taken with a Nikon Diaphot inverted tissue culture microscope.

    Article Title: Cytological and genetic consequences for the progeny of a mitotic catastrophe provoked by Topoisomerase II deficiency
    Article Snippet: For MB (Sigma-Aldrich; M9140) staining, 1 μl of each sample was mixed with 1 μl of a 0.04% w/v MB solution in water onto a microscope slide and directly visualized (bright field). .. Minor modifications to this protocol were employed; namely, we used the TACS Annexin V-FITC Apoptosis Detection Kit (R & Dsystems; 4830-01-K) as well as 60 units/ml of zymolyase (ZymoResearch; E1005) for cell was digestion.

    Sequencing:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Article Title: Conserved and Diverged Functions of the Calcineurin-Activated Prz1 Transcription Factor in Fission Yeast
    Article Snippet: Cell-wall sensitivity was assayed with 0.5 µg/ml micafungin (A13270-1: AdooQ Bioscience, Irvine, CA) and 25 U/ml Zymolyase 100T (E1005: Zymo Research, Irvine, CA). .. All constructed strains were verified by colony PCR and sequencing of the amplicons.

    Article Title: Conditionally controlling nuclear trafficking in yeast by chemical-induced protein dimerization
    Article Snippet: DNA cassette consisting of sequence encoding the Venus variant of yellow fluorescent protein (vYFP) , FRBPLF domain and hygromycin B resistance gene ( )—available on request. .. Rapamycin (Sigma-Aldrich, cat. no. R0395) C20-MaRap (made in-house, see ) G418 sulfate (Sigma-Aldrich, cat. no. A1720) Hygromycin B (Sigma-Aldrich, cat. no. H3274) SC-Leu dropout mix (Sigma-Aldrich, cat. no. Y 1376) Yeast nitrogen base without amino acids (BD Biosciences, cat. no. 291920) Dextrose (Sigma-Aldrich, cat. no. 7528) Bacto agar (BD Biosciences, cat. no. 214030) Yeast extract (BD Biosciences, cat. no. 212750)) Peptone (BD Biosciences, cat. no. 211677) T4 DNA ligase (New England BioLabs, cat. no. M0202) Zymolyase (Zymo Research, cat. no. E1004) DMSO (Sigma-Aldrich, cat. no. D2650) !

    In Vitro:

    Article Title: Structure of the Cladosporium fulvum Avr4 effector in complex with (GlcNAc)6 reveals the ligand-binding mechanism and uncouples its intrinsic function from recognition by the Cf-4 resistance protein
    Article Snippet: Paragraph title: In vitro protection assays of T . viride germlings against chitinases ... The following day, 5 μM of WT-CfAvr4 or ChBD mutants were mixed with 7.5 units of Zymolyase (Zymo Research cat. no. E1004) and 0.2 units of bacterial chitinases (Sigma-Aldrich cat. no. C6137) and the mixture was added to the microtitre plate wells containing the pre-germinated spores in a final volume of 150 μl.

    Construct:

    Article Title: Conserved and Diverged Functions of the Calcineurin-Activated Prz1 Transcription Factor in Fission Yeast
    Article Snippet: Cell-wall sensitivity was assayed with 0.5 µg/ml micafungin (A13270-1: AdooQ Bioscience, Irvine, CA) and 25 U/ml Zymolyase 100T (E1005: Zymo Research, Irvine, CA). .. Deletion and epitope-tagged strains were constructed by a PCR-based stitching method as described in .

    Staining:

    Article Title: Genome-Scale Genetic Interactions and Cell Imaging Confirm Cytokinesis as Deleterious to Transient Topoisomerase II Deficiency in Saccharomyces cerevisiae
    Article Snippet: When this reporter was not available, PM was stained with 5 µg/ml Hoechst 33258 (94403, Sigma-Aldrich) for either 5 or 15 min at 37° before processing for fluorescence microscopy. .. Finally, the sample was split in two; one half was treated with 0.2 mg/ml zymolyase 20T (E1005, Zymo Research) in the above sorbitol buffer containing 4 mM β-mercaptoethanol for 20 min at 37°, whereas the other half was treated in the same conditions but without zymolyase (mock control).

    Article Title: Cytological and genetic consequences for the progeny of a mitotic catastrophe provoked by Topoisomerase II deficiency
    Article Snippet: Staining with FITC-labeled annexin V was undertaken in spheroplasts as previously described [ ]. .. Minor modifications to this protocol were employed; namely, we used the TACS Annexin V-FITC Apoptosis Detection Kit (R & Dsystems; 4830-01-K) as well as 60 units/ml of zymolyase (ZymoResearch; E1005) for cell was digestion.

    Rapid Amplification of cDNA Ends:

    Article Title: A genetic tool to track protein aggregates and control prion inheritance
    Article Snippet: Rapid Amplification of cDNA Ends (RACE) was used to detect alterations in mRNA polyadenylation sites in the presence of Nab2 overexpression. .. RNA was extracted using the YeaSTAR RNA kit (Zymo Research, Cat# E1004). cDNA was prepared using the SuperScriptIII kit (ThermoFisher Scientific, Cat# 18080051), using dT18 NV- as the primer to amplify from the start of polyA tails.

    Plasmid Preparation:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Article Title: The Heme Transport Capacity of LHR1 Determines the Extent of Virulence in Leishmania amazonensis
    Article Snippet: Immunofluorescence For S . cerevisiae , plasmids for yLHR1 expression (pYesDEST52-yLHR1-HA WT/Y18A/H36A/Y80A/Y129A) or vector alone (pYesDEST52) were transformed into the Δhem1 (6D) strain, selected for as described above, then grown in 2% w/v raffinose, 0.4% w/v galactose SC (-Ura) supplemented with 250 μM ALA starting at an OD600 of 0.1 until an OD600 of 0.6–0.8. .. Cells were then resuspended in TEβ (200 mM Tris pH 8.0, 20 mM EDTA, 1% β-mercaptoethanol), incubated at 30°C for 10 min, pelleted and resuspended in spheroplast solution (1.2 M sorbitol, 50 mM KH2 PO4 pH 7.4, 1 mM MgCl2 , 0.1 U/ul zymolyase (Zymo Research; Cat. # E1004)) followed by incubation at 30°C for 45 min and washes in 1.2 M sorbitol.

    Article Title: Conditionally controlling nuclear trafficking in yeast by chemical-induced protein dimerization
    Article Snippet: Plasmid derivatives of pRS425 with the FKBP12-NLS and FKBP12-NES fusions under transcriptional control of the constitutive GPD1 promoter ( )—available on request. .. Rapamycin (Sigma-Aldrich, cat. no. R0395) C20-MaRap (made in-house, see ) G418 sulfate (Sigma-Aldrich, cat. no. A1720) Hygromycin B (Sigma-Aldrich, cat. no. H3274) SC-Leu dropout mix (Sigma-Aldrich, cat. no. Y 1376) Yeast nitrogen base without amino acids (BD Biosciences, cat. no. 291920) Dextrose (Sigma-Aldrich, cat. no. 7528) Bacto agar (BD Biosciences, cat. no. 214030) Yeast extract (BD Biosciences, cat. no. 212750)) Peptone (BD Biosciences, cat. no. 211677) T4 DNA ligase (New England BioLabs, cat. no. M0202) Zymolyase (Zymo Research, cat. no. E1004) DMSO (Sigma-Aldrich, cat. no. D2650) !

    Software:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Real-time Polymerase Chain Reaction:

    Article Title: Genome analysis of three Pneumocystis species reveals adaptation mechanisms to life exclusively in mammalian hosts
    Article Snippet: The pellet was washed three times in PBS, resuspended in 100 μl of 0.5% (w/v) Zymolyase solution (Zymo Research) and incubated at 37 °C for 1 h. Genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre). .. All DNA samples were analysed by quantitative real-time PCR (qPCR) assays using fluorescence resonance energy transfer probes to measure the fraction of Pneumocystis DNA compared with host DNA in each sample.

    In Situ:

    Article Title: Deletion of Cryptococcus neoformans AIF Ortholog Promotes Chromosome Aneuploidy and Fluconazole-Resistance in a Metacaspase-Independent Manner
    Article Snippet: After treatment with 5% β-mercaptoethanol in SPM (1.2 M sorbitol; 50 mM K-phosphate, pH 7.3; and 1 mM MgCl2 ) for 1 h at 37°C with gentle agitation, cells were washed with SPM and then digested with 10 µl of zymolyaseTM (Zymo Research, 4 U/µL), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma), and 0.1% bovine serum albumin (Sigma) in 1 ml of spheroplasting buffer (1 M sorbitol; 10 mM EDTA; and 100 mM sodium citrate, pH 5.8) for 40 min at 37°C with gentle agitation. .. Samples were permeabilized with 0.5 ml of fresh prepared 0.1% Triton X-100, 0.1% sodium citrate solution in cold SPM for 2 min in ice, washed twice with SPM, and incubated with 50 µl TUNEL reaction mixture (In Situ Cell Death Detection Kit, Roche) for 60 min at 37°C in dark and humid conditions.

    DNA Purification:

    Article Title: Genome analysis of three Pneumocystis species reveals adaptation mechanisms to life exclusively in mammalian hosts
    Article Snippet: .. The pellet was washed three times in PBS, resuspended in 100 μl of 0.5% (w/v) Zymolyase solution (Zymo Research) and incubated at 37 °C for 1 h. Genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre). ..

    End Labeling:

    Article Title: Deletion of Cryptococcus neoformans AIF Ortholog Promotes Chromosome Aneuploidy and Fluconazole-Resistance in a Metacaspase-Independent Manner
    Article Snippet: TUNEL assay TdT-mediated dUTP nick end labeling (TUNEL) assays were performed as described previously , with the following modifications. .. After treatment with 5% β-mercaptoethanol in SPM (1.2 M sorbitol; 50 mM K-phosphate, pH 7.3; and 1 mM MgCl2 ) for 1 h at 37°C with gentle agitation, cells were washed with SPM and then digested with 10 µl of zymolyaseTM (Zymo Research, 4 U/µL), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma), and 0.1% bovine serum albumin (Sigma) in 1 ml of spheroplasting buffer (1 M sorbitol; 10 mM EDTA; and 100 mM sodium citrate, pH 5.8) for 40 min at 37°C with gentle agitation.

    Lysis:

    Article Title: Genome analysis of three Pneumocystis species reveals adaptation mechanisms to life exclusively in mammalian hosts
    Article Snippet: The pellet was washed once in PBS, resuspended in lysis buffer containing 2.9% (w/v) collagenase type I (Gibco) and 0.1% (w/v) DNase I (Sigma), incubated at 37 °C for 30 min, and centrifuged at 15,000g for 6 min. .. The pellet was washed three times in PBS, resuspended in 100 μl of 0.5% (w/v) Zymolyase solution (Zymo Research) and incubated at 37 °C for 1 h. Genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre).

    Variant Assay:

    Article Title: Conditionally controlling nuclear trafficking in yeast by chemical-induced protein dimerization
    Article Snippet: DNA cassette consisting of sequence encoding the Venus variant of yellow fluorescent protein (vYFP) , FRBPLF domain and hygromycin B resistance gene ( )—available on request. .. Rapamycin (Sigma-Aldrich, cat. no. R0395) C20-MaRap (made in-house, see ) G418 sulfate (Sigma-Aldrich, cat. no. A1720) Hygromycin B (Sigma-Aldrich, cat. no. H3274) SC-Leu dropout mix (Sigma-Aldrich, cat. no. Y 1376) Yeast nitrogen base without amino acids (BD Biosciences, cat. no. 291920) Dextrose (Sigma-Aldrich, cat. no. 7528) Bacto agar (BD Biosciences, cat. no. 214030) Yeast extract (BD Biosciences, cat. no. 212750)) Peptone (BD Biosciences, cat. no. 211677) T4 DNA ligase (New England BioLabs, cat. no. M0202) Zymolyase (Zymo Research, cat. no. E1004) DMSO (Sigma-Aldrich, cat. no. D2650) !

    Epifluorescence Microscopy:

    Article Title: Deletion of Cryptococcus neoformans AIF Ortholog Promotes Chromosome Aneuploidy and Fluconazole-Resistance in a Metacaspase-Independent Manner
    Article Snippet: After treatment with 5% β-mercaptoethanol in SPM (1.2 M sorbitol; 50 mM K-phosphate, pH 7.3; and 1 mM MgCl2 ) for 1 h at 37°C with gentle agitation, cells were washed with SPM and then digested with 10 µl of zymolyaseTM (Zymo Research, 4 U/µL), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma), and 0.1% bovine serum albumin (Sigma) in 1 ml of spheroplasting buffer (1 M sorbitol; 10 mM EDTA; and 100 mM sodium citrate, pH 5.8) for 40 min at 37°C with gentle agitation. .. Cells were washed with PBS and immediately analyzed by epifluorescence microscopy (see next section) or flow cytometry.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Zymo Research zymolyase treatment
    Active Cdc42 interferes with cytokinesis and cell separation. (A) Cells transformed with vector (VEC) or GAL1-HA-CDC42 plasmids were spotted in fivefold dilutions on the indicated media (3 d at 25°C). OE, overexpression; GAL, galactose. (B) Expression of cdc42 G60D from the CDC42 promoter on a CEN plasmid (one to three copies per cell) is toxic to myo1Δ cells. Cells were grown on the indicated media (3 d at 25°C). Synthetic lethality is detected on 5-fluoroorotic acid (5FOA) media as a counterselection for the indicated URA3 -containing plasmids. (C) myo1Δ cells transformed with control or CDC24 2μ plasmids were grown on plates as in B. SC, synthetic complete. (D) Wild-type (wt) and bem2-ts cells were arrested in metaphase by CDC20 depletion, shifted to the restrictive temperature (37°C at 1.5 h), and processed for Cdc42 activation. Graph shows means ± SEM from three experiments. (E) Cells were arrested in metaphase, shifted to 37°C for 1 h, and released at 37°C. The percentage of cells with the indicated morphology is plotted as means ± SEM from three experiments. Connected indicates two adjacent cell bodies showing evidence of rebudding or repolarization. (F) Bright-field image of cells 50 min after release. Bar, 15 µm. (G) Cells from E were treated with <t>zymolyase</t> to digest the cell wall, and the percentage of large-budded or connected cells was scored. (H) Wild-type cells have a PS (arrow) sandwiched by secondary septa; bem2-ts cells have misaligned, multiple, or otherwise abnormal PSs (arrowheads). Bars, 500 nm.
    Zymolyase Treatment, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/zymolyase treatment/product/Zymo Research
    Average 95 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    zymolyase treatment - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Active Cdc42 interferes with cytokinesis and cell separation. (A) Cells transformed with vector (VEC) or GAL1-HA-CDC42 plasmids were spotted in fivefold dilutions on the indicated media (3 d at 25°C). OE, overexpression; GAL, galactose. (B) Expression of cdc42 G60D from the CDC42 promoter on a CEN plasmid (one to three copies per cell) is toxic to myo1Δ cells. Cells were grown on the indicated media (3 d at 25°C). Synthetic lethality is detected on 5-fluoroorotic acid (5FOA) media as a counterselection for the indicated URA3 -containing plasmids. (C) myo1Δ cells transformed with control or CDC24 2μ plasmids were grown on plates as in B. SC, synthetic complete. (D) Wild-type (wt) and bem2-ts cells were arrested in metaphase by CDC20 depletion, shifted to the restrictive temperature (37°C at 1.5 h), and processed for Cdc42 activation. Graph shows means ± SEM from three experiments. (E) Cells were arrested in metaphase, shifted to 37°C for 1 h, and released at 37°C. The percentage of cells with the indicated morphology is plotted as means ± SEM from three experiments. Connected indicates two adjacent cell bodies showing evidence of rebudding or repolarization. (F) Bright-field image of cells 50 min after release. Bar, 15 µm. (G) Cells from E were treated with zymolyase to digest the cell wall, and the percentage of large-budded or connected cells was scored. (H) Wild-type cells have a PS (arrow) sandwiched by secondary septa; bem2-ts cells have misaligned, multiple, or otherwise abnormal PSs (arrowheads). Bars, 500 nm.

    Journal: The Journal of Cell Biology

    Article Title: Inhibition of Cdc42 during mitotic exit is required for cytokinesis

    doi: 10.1083/jcb.201301090

    Figure Lengend Snippet: Active Cdc42 interferes with cytokinesis and cell separation. (A) Cells transformed with vector (VEC) or GAL1-HA-CDC42 plasmids were spotted in fivefold dilutions on the indicated media (3 d at 25°C). OE, overexpression; GAL, galactose. (B) Expression of cdc42 G60D from the CDC42 promoter on a CEN plasmid (one to three copies per cell) is toxic to myo1Δ cells. Cells were grown on the indicated media (3 d at 25°C). Synthetic lethality is detected on 5-fluoroorotic acid (5FOA) media as a counterselection for the indicated URA3 -containing plasmids. (C) myo1Δ cells transformed with control or CDC24 2μ plasmids were grown on plates as in B. SC, synthetic complete. (D) Wild-type (wt) and bem2-ts cells were arrested in metaphase by CDC20 depletion, shifted to the restrictive temperature (37°C at 1.5 h), and processed for Cdc42 activation. Graph shows means ± SEM from three experiments. (E) Cells were arrested in metaphase, shifted to 37°C for 1 h, and released at 37°C. The percentage of cells with the indicated morphology is plotted as means ± SEM from three experiments. Connected indicates two adjacent cell bodies showing evidence of rebudding or repolarization. (F) Bright-field image of cells 50 min after release. Bar, 15 µm. (G) Cells from E were treated with zymolyase to digest the cell wall, and the percentage of large-budded or connected cells was scored. (H) Wild-type cells have a PS (arrow) sandwiched by secondary septa; bem2-ts cells have misaligned, multiple, or otherwise abnormal PSs (arrowheads). Bars, 500 nm.

    Article Snippet: In brief, for zymolyase treatment, cells were fixed for 1 h with 3.7% formaldehyde, washed three times with PBS and twice with KS buffer (1.2 M sorbitol and 50 mM KHPO4 ), and then resuspended in KS containing 0.2 mg/ml zymolyase (Zymo Research) and 2 mM DTT until > 90% of cells lost their refractive appearance.

    Techniques: Transformation Assay, Plasmid Preparation, Over Expression, Expressing, Activation Assay

    [ 14 C]Lysine cross-linked by TGase activity was found in low- and high-molecular-weight cell wall proteins and inhibition of TGase enzyme by cystamine and MDC induced changes in cell wall that sensitized cells to zymolyase treatment. A , paper chromatography of [ 14 C]putrescine-labeled material performed by C. albicans TGase activity and released from CW by zymolyase ( filled circles ). Solubilized fraction containing 20,000 cpm analyzed by paper chromatography was described under the “Experimental procedures.” [ 14 C]Putrescine substrate was also analyzed as a control ( open circles ). B , transglutaminase-mediated incorporation of [ 14 C]lysine into endogenous cell wall proteins. Reaction mixtures containing similar aliquots of cell walls and 2.5 μCi of [ 14 C]lysine with no cystamine ( open circles ) or with 50 m m cystamine ( filled circles ), boiled enzymatic source ( open triangles ), or 2 m m EDTA ( filled triangles ) were incubated for the indicated times; radioactivity in TCA-precipitable material was quantified. C , labeled samples with [ 14 C]lysine were sequentially released from cell walls by SDS, zymolyase, and chitinase and analyzed by 10% SDS-PAGE and fluorography. 10,000 cpm of labeled fractions were loaded in each lane. Lane 1, SDS-released material; lane 2 , zymolyase-released material; lane 3 , chitinase-released material. D and E, inhibition of TGase by cystamine and MDC increased sensitivity of C. albicans cells to treatment with zymolyase. Cells of C. albicans (adjusted to OD 600 nm = 0.5) previously incubated without ( circles ) or with 100 m m cystamine ( D ) or 3.5 m m MDC ( E ) for 1.5 h ( triangles ), 2 h ( inverted triangles ), and 4 h ( squares ) were treated with 50 μg ml −1 zymolyase 20T for up to 120 min. At the indicated times, OD 600 nm of cultures was monitored.

    Journal: The Journal of Biological Chemistry

    Article Title: The Candida albicans ENO1 gene encodes a transglutaminase involved in growth, cell division, morphogenesis, and osmotic protection

    doi: 10.1074/jbc.M117.810440

    Figure Lengend Snippet: [ 14 C]Lysine cross-linked by TGase activity was found in low- and high-molecular-weight cell wall proteins and inhibition of TGase enzyme by cystamine and MDC induced changes in cell wall that sensitized cells to zymolyase treatment. A , paper chromatography of [ 14 C]putrescine-labeled material performed by C. albicans TGase activity and released from CW by zymolyase ( filled circles ). Solubilized fraction containing 20,000 cpm analyzed by paper chromatography was described under the “Experimental procedures.” [ 14 C]Putrescine substrate was also analyzed as a control ( open circles ). B , transglutaminase-mediated incorporation of [ 14 C]lysine into endogenous cell wall proteins. Reaction mixtures containing similar aliquots of cell walls and 2.5 μCi of [ 14 C]lysine with no cystamine ( open circles ) or with 50 m m cystamine ( filled circles ), boiled enzymatic source ( open triangles ), or 2 m m EDTA ( filled triangles ) were incubated for the indicated times; radioactivity in TCA-precipitable material was quantified. C , labeled samples with [ 14 C]lysine were sequentially released from cell walls by SDS, zymolyase, and chitinase and analyzed by 10% SDS-PAGE and fluorography. 10,000 cpm of labeled fractions were loaded in each lane. Lane 1, SDS-released material; lane 2 , zymolyase-released material; lane 3 , chitinase-released material. D and E, inhibition of TGase by cystamine and MDC increased sensitivity of C. albicans cells to treatment with zymolyase. Cells of C. albicans (adjusted to OD 600 nm = 0.5) previously incubated without ( circles ) or with 100 m m cystamine ( D ) or 3.5 m m MDC ( E ) for 1.5 h ( triangles ), 2 h ( inverted triangles ), and 4 h ( squares ) were treated with 50 μg ml −1 zymolyase 20T for up to 120 min. At the indicated times, OD 600 nm of cultures was monitored.

    Article Snippet: Identification of TGase protein using a fluorescent TGase inhibitor MDC probe Cell walls from C. albicans were simultaneously digested with 60 units of chitinase (Sigma) and 100 units of zymolyase (Zymo Research) overnight at room temperature.

    Techniques: Activity Assay, Molecular Weight, Inhibition, Paper Chromatography, Labeling, Incubation, Radioactivity, SDS Page

    Ag displayed on the surface of yeast is cross-presented more efficiently than Ag expressed intracellularly in yeast. A , Diagram of the yeast surface display system of strain EBYN9V. The N9V epitope is in bold. B , Dose response of EBYN9V on cross-presentation. EBYN9V and wild-type EBY100 yeast were added to DCs at the indicated ratios. After 24 h, the DCs were assayed for the ability to stimulate IFN- γ secretion in cocultured N9V-specific T cells. Error bars, SDs of duplicate wells. C , EBYN9V yeast and yeast expressing the same Aga2p-N9V fusion protein intracellularly were added to DCs at a 20:1 ratio and tested for the ability to stimulate IFN- γ secretion in cocultured N9V-specific T cells. Lactacystin (5 μ M) or chloroquine (25 μ M) were added to some wells an hour before the yeast were introduced. Error bars, SDs of duplicate wells. D , Samples of the two yeast cultures and wt yeast were subjected to extensive reduction to release proteins disulfide-bonded to the cell wall. Subsequently, the yeast were treated with Zymolyase and lysed. The proteins reduced off the cell wall and the lysed cell extracts were slot-blotted onto the same nitrocellulose membrane and labeled for c- myc .

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    Article Title: Antigen Release Kinetics in the Phagosome Are Critical to Cross-Presentation Efficiency

    doi:

    Figure Lengend Snippet: Ag displayed on the surface of yeast is cross-presented more efficiently than Ag expressed intracellularly in yeast. A , Diagram of the yeast surface display system of strain EBYN9V. The N9V epitope is in bold. B , Dose response of EBYN9V on cross-presentation. EBYN9V and wild-type EBY100 yeast were added to DCs at the indicated ratios. After 24 h, the DCs were assayed for the ability to stimulate IFN- γ secretion in cocultured N9V-specific T cells. Error bars, SDs of duplicate wells. C , EBYN9V yeast and yeast expressing the same Aga2p-N9V fusion protein intracellularly were added to DCs at a 20:1 ratio and tested for the ability to stimulate IFN- γ secretion in cocultured N9V-specific T cells. Lactacystin (5 μ M) or chloroquine (25 μ M) were added to some wells an hour before the yeast were introduced. Error bars, SDs of duplicate wells. D , Samples of the two yeast cultures and wt yeast were subjected to extensive reduction to release proteins disulfide-bonded to the cell wall. Subsequently, the yeast were treated with Zymolyase and lysed. The proteins reduced off the cell wall and the lysed cell extracts were slot-blotted onto the same nitrocellulose membrane and labeled for c- myc .

    Article Snippet: The yeast pellets were then washed with spheroplast buffer (50 mM Tris-HCl, pH 7.5, 1.4 M sorbitol, and 40 mM 2-ME), incubated with 2.4 U Zymolyase (Zymo Research) in 120 μ l spheroplast buffer containing a protease inhibitor mixture (Roche) for 15 min at 37°C, and boiled in 2% SDS for 5 min.

    Techniques: Expressing, Labeling

    Effect of mechanical feedback strength and turgor pressure on cell viability. The strength of mechanical feedback, Γ, is experimentally varied by deleting MID2 and WSC1 . The dimensionless parameter ( Pρ w λ X )/(12 μ 0 m w ρ 0 k p ) is varied by changing the osmolarity of the external medium through dilution of the yeast growth media, YPD, in deionized H 2 O, effectively increasing turgor pressure P in cells. Cell lysis was measured using the PI staining viability assay ( Methods ). (A) Percent of lysed cells in the absence of α -factor for WT, mid2Δ and wsc1Δ mutants, as well as the mid2 Δ wsc1Δ double mutant. (B) Percent of WT lysed cells when grown in the presence of α -factor in YPD medium with decreasing osmolarity. (C) Percent of mid2Δ wsc1Δ lysed cells when grown both in the presence and absence of α -factor in YPD, in osmotically supported conditions (YPD + 1M sorbitol), as well as in hypo-osmotic conditions (100% H 2 O). (D) Percent of mid2Δ wsc1Δ lysed cells when grown in the presence of α -factor and osmotically supported media (YPD + sorbitol), diluted for decreasing osmolarities. (E) Percent of lysed cells in mid2Δ and wsc1Δ mutants, as well as the mid2Δ wsc1Δ double mutant, when grown in the presence of α -factor in YPD. (F) Theoretically predicted dynamical regimes for varying values of the mechanical feedback strength Γ and the ratio ( Pρ w λ X )/(12 μ 0 m w ρ 0 k p ). Decreasing osmolarity experimentally, corresponds to increasing P and, therefore, moving along horizontal lines in the positive direction. Addition of zymolyase, a cell wall degrading enzyme, corresponds to decreasing the cell wall viscosity, moving also along horizontal lines in the positive direction. (G) Images (DIC, PI staining and merge) showing the moments before and after the piercing of the cell wall at the tip of a mating projection and subsequent cell lysis of a mid2Δ cell after the addition of zymolyase, for video see S1 Video . Scale bar, 2 μm . (H) Temporal increase in the fraction of pierced mating projections for both mid2Δ (squares) and WT (circles) cells after addition of zymolyase.

    Journal: PLoS Computational Biology

    Article Title: Mechanical feedback coordinates cell wall expansion and assembly in yeast mating morphogenesis

    doi: 10.1371/journal.pcbi.1005940

    Figure Lengend Snippet: Effect of mechanical feedback strength and turgor pressure on cell viability. The strength of mechanical feedback, Γ, is experimentally varied by deleting MID2 and WSC1 . The dimensionless parameter ( Pρ w λ X )/(12 μ 0 m w ρ 0 k p ) is varied by changing the osmolarity of the external medium through dilution of the yeast growth media, YPD, in deionized H 2 O, effectively increasing turgor pressure P in cells. Cell lysis was measured using the PI staining viability assay ( Methods ). (A) Percent of lysed cells in the absence of α -factor for WT, mid2Δ and wsc1Δ mutants, as well as the mid2 Δ wsc1Δ double mutant. (B) Percent of WT lysed cells when grown in the presence of α -factor in YPD medium with decreasing osmolarity. (C) Percent of mid2Δ wsc1Δ lysed cells when grown both in the presence and absence of α -factor in YPD, in osmotically supported conditions (YPD + 1M sorbitol), as well as in hypo-osmotic conditions (100% H 2 O). (D) Percent of mid2Δ wsc1Δ lysed cells when grown in the presence of α -factor and osmotically supported media (YPD + sorbitol), diluted for decreasing osmolarities. (E) Percent of lysed cells in mid2Δ and wsc1Δ mutants, as well as the mid2Δ wsc1Δ double mutant, when grown in the presence of α -factor in YPD. (F) Theoretically predicted dynamical regimes for varying values of the mechanical feedback strength Γ and the ratio ( Pρ w λ X )/(12 μ 0 m w ρ 0 k p ). Decreasing osmolarity experimentally, corresponds to increasing P and, therefore, moving along horizontal lines in the positive direction. Addition of zymolyase, a cell wall degrading enzyme, corresponds to decreasing the cell wall viscosity, moving also along horizontal lines in the positive direction. (G) Images (DIC, PI staining and merge) showing the moments before and after the piercing of the cell wall at the tip of a mating projection and subsequent cell lysis of a mid2Δ cell after the addition of zymolyase, for video see S1 Video . Scale bar, 2 μm . (H) Temporal increase in the fraction of pierced mating projections for both mid2Δ (squares) and WT (circles) cells after addition of zymolyase.

    Article Snippet: Zymolyase (Zymo Research, 1 μ l (2 units) per 100 μ l of cells) was added to cells exposed to alpha-factor for 1.5 hours.

    Techniques: Lysis, Staining, Viability Assay, Mutagenesis