zymobiomics dna kits  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    ZymoBIOMICS 96 DNA Kit
    Description:
    The ZymoBIOMICS DNA Kits are designed for purifying DNA from a variety of sample inputs that is immediately ready for microbiome or metagenome analyses The ZymoBIOMICS lysis system eliminates bias associated with unequal lysis efficiencies of different organisms e g Gram negative positive bacteria fungus protozoans and algae making it ideal for microbial community profiling Uniform mechanical lysis of all microbes is achieved by bead beating with the innovative ultra high density BashingBeads This kit is equipped with our OneStep PCR Inhibitor removal technology enabling PCR amplification from DNA derived from inhibitor rich environmental samples Purified DNA is ideal for all downstream applications including PCR arrays 16S rRNA gene sequencing and shotgun sequencing DNA Size is 15 20 kb
    Catalog Number:
    d4303
    Price:
    None
    Applications:
    DNA Purification
    Size:
    2 x 96 units
    Category:
    Life Science Reagents and Media
    Buy from Supplier


    Structured Review

    Zymo Research zymobiomics dna kits
    ZymoBIOMICS 96 DNA Kit
    The ZymoBIOMICS DNA Kits are designed for purifying DNA from a variety of sample inputs that is immediately ready for microbiome or metagenome analyses The ZymoBIOMICS lysis system eliminates bias associated with unequal lysis efficiencies of different organisms e g Gram negative positive bacteria fungus protozoans and algae making it ideal for microbial community profiling Uniform mechanical lysis of all microbes is achieved by bead beating with the innovative ultra high density BashingBeads This kit is equipped with our OneStep PCR Inhibitor removal technology enabling PCR amplification from DNA derived from inhibitor rich environmental samples Purified DNA is ideal for all downstream applications including PCR arrays 16S rRNA gene sequencing and shotgun sequencing DNA Size is 15 20 kb
    https://www.bioz.com/result/zymobiomics dna kits/product/Zymo Research
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    zymobiomics dna kits - by Bioz Stars, 2020-02
    95/100 stars

    Related Products / Commonly Used Together

    bacterial dna extraction

    Images

    Related Articles

    Diagnostic Assay:

    Article Title: Evaluation of Multiple Diagnostic Indicators in Comparison to the Intestinal Biopsy as the Golden Standard in Diagnosing Celiac Disease in Children
    Article Snippet: DNA Diagnostics The DNA diagnostic method was focused on the analysis of nine single nucleotide polymorphisms (SNPs) ( ) previously reported to have an association with CD [ , , , , ]. .. DNA was extracted from buccal swabs using the ZR-96 genomic DNA Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s protocol.

    Clone Assay:

    Article Title: Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases
    Article Snippet: In clonal experiments (Rag1m and DMD21m), cells were plated after treatment and individual clones were grown. .. After 21 days, DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Targeted Gene Therapy of Xeroderma Pigmentosum Cells Using Meganuclease and TALEN(TM)
    Article Snippet: Three days post-transfection, cells were seeded at low density to form individual clones. .. DNA extraction was performed using the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Intragenic transcriptional interference regulates the human immune ligand MICA
    Article Snippet: .. Single clones were picked using cloning cylinders (Sigma), expanded, and genomic DNA was extracted using the ZR‐96 Genomic DNA Kit (Zymo Research) for verification by PCR. .. PCR‐verified clones were then screened by flow cytometry to exclude hyperploid clones based on forward and side‐scattering properties and propidium iodide staining for DNA content.

    Amplification:

    Article Title: Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases
    Article Snippet: Two days post-transfection, genomic DNA was extracted and targets studied were amplified with specific primers flanked by specific adaptators needed for HTS sequencing (For: CCATCTCATCCCTGCGTGTCTCCGACTCAG-Tag and Rev: BiotinTEG/ CCTATCCCCTGTGTGCCTTGGCAGTCTCAG) on the 454 sequencing system (454 Life Sciences). .. After 21 days, DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Targeted Gene Therapy of Xeroderma Pigmentosum Cells Using Meganuclease and TALEN(TM)
    Article Snippet: DNA extraction was performed using the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol. .. The detection of targeted integration was performed via specific PCR amplification using one primer located within the heterologous insert of the DNA repair matrix and another located on the genomic sequence outside the matrix homology arms ( ).

    Article Title: Evaluation of Multiple Diagnostic Indicators in Comparison to the Intestinal Biopsy as the Golden Standard in Diagnosing Celiac Disease in Children
    Article Snippet: DNA was extracted from buccal swabs using the ZR-96 genomic DNA Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s protocol. .. DNA fragments surrounding the SNPs, and part of HLA-DQA1 and HLA-DQB1 genes were amplified with Ex-Taq (Takara Bio Inc., Shiga, Japan).

    Article Title: Molecular basis of engineered meganuclease targeting of the endogenous human RAG1 locus
    Article Snippet: DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer’s protocol. .. PCR amplification reactions performed with specific primers enabled us to selectively amplify gene-targeting events.

    Article Title: Molecular basis of engineered meganuclease targeting of the endogenous human RAG1 locus
    Article Snippet: .. After 21 days, DNA was extracted with the ZR-96 genomic DNA kit and PCR amplification on RAG1 locus was performed with the primers F9: 5′- GGCAAAGATGAATCAAAGATTCTGTCCT-3′ and R9: 5′-GATCTCACCCGGAACAGCTTAAATTTC-3′. ..

    Article Title: Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases
    Article Snippet: DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol. .. The detection of targeted integration is performed by specific PCR amplification using a primer located within the heterologous insert of the DNA repair matrix, and another one located on the genomic sequence outside of the homology.

    Picogreen Assay:

    Article Title: Codweb: Whole-genome sequencing uncovers extensive reticulations fueling adaptation among Atlantic, Arctic, and Pacific gadids
    Article Snippet: We cleaned the tagmentated DNA with the Zymo Purification Kit (ZR-96 DNA Clean & Concentrator-5, Zymo Research). .. We quantified the individual libraries with fluorescent detection using the Quant-iT PicoGreen dsDNA Assay Kit (Quantit kit) on a SpectraMax i3x Multi-Mode Detection Platform (Molecular Devices).

    Cytometry:

    Article Title: Intragenic transcriptional interference regulates the human immune ligand MICA
    Article Snippet: Single clones were picked using cloning cylinders (Sigma), expanded, and genomic DNA was extracted using the ZR‐96 Genomic DNA Kit (Zymo Research) for verification by PCR. .. PCR‐verified clones were then screened by flow cytometry to exclude hyperploid clones based on forward and side‐scattering properties and propidium iodide staining for DNA content.

    Construct:

    Article Title: Intragenic transcriptional interference regulates the human immune ligand MICA
    Article Snippet: Single clones were picked using cloning cylinders (Sigma), expanded, and genomic DNA was extracted using the ZR‐96 Genomic DNA Kit (Zymo Research) for verification by PCR. .. At least two independent BAC RMCE clones were generated for each BAC construct.

    Real-time Polymerase Chain Reaction:

    Article Title: Molecular and Phenotypic Characteristics of Healthcare- and Community-Associated Methicillin-Resistant Staphylococcus aureus at a Rural Hospital
    Article Snippet: Molecular Methods DNA was extracted from isolates using ZR-96 DNA extraction kits (Zymo Research, Orange, CA). .. Isolates were tested using a real-time PCR assay to confirm MRSA genotype by detection of mecA and femA genes (Pathogene, LLC).

    Article Title: Codweb: Whole-genome sequencing uncovers extensive reticulations fueling adaptation among Atlantic, Arctic, and Pacific gadids
    Article Snippet: Library sample concentration was determined with quantitative polymerase chain reaction (qPCR) according to an Illumina protocol. .. We cleaned the tagmentated DNA with the Zymo Purification Kit (ZR-96 DNA Clean & Concentrator-5, Zymo Research).

    Article Title: Changes in Microbiota and Bacterial Protein Caseinolytic Peptidase B During Food Restriction in Mice: Relevance for the Onset and Perpetuation of Anorexia Nervosa
    Article Snippet: .. 2.5. qPCR Assay for Faecal Enterobacteriaceae DNA Enterobacteriaceae DNA in faeces were extracted with the ZymoBIOMICS Kit according to the protocol given by the supplier (ZymoResearch, Irvine, CA, USA). .. After extraction, the total DNA was quantified using a NanoDrop spectrophotometer (ThermoScientific, Waltham, MA, USA). qPCR was performed on 1 ng/µL of DNA and with Light Cycler® 480 SYBR® Green I Master (Roche, Swiss).

    Activity Assay:

    Article Title: Targeted Gene Therapy of Xeroderma Pigmentosum Cells Using Meganuclease and TALEN(TM)
    Article Snippet: Paragraph title: Monitoring of Nuclease Activity at Endogenous Loci ... DNA extraction was performed using the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Expressing:

    Article Title: Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases
    Article Snippet: Monitoring of MN-induced TM 293-H cells were transfected with 3 µg of MN expressing vector or empty vector, except for ADCY9-induced mutagenesis where 293-H cells were transfected with 5 µg of MN-encoding plasmid. .. After 21 days, DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Molecular basis of engineered meganuclease targeting of the endogenous human RAG1 locus
    Article Snippet: Cells were transfected with 3 µg of the meganuclease expression vector ( ) and 2 µg of matrix vector, in the presence of lipofectamine 2000 (293H cells) or polyfect (MRC5 cells) transfection reagent in accordance with the manufacturer’s protocol (Invitrogen). .. DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer’s protocol.

    Article Title: Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases
    Article Snippet: Monitoring of MN-induced HGT 293-H cells were co-transfected with 3 µg of MN expressing vector, and 2 µg of DNA matrix and seeded at 10 cells per well in 96-well plate, and HGT was monitored by PCR 21 days later. .. DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Efficient targeting of a SCID gene by an engineered single-chain homing endonuclease
    Article Snippet: Cells were co-transfected with 2 µg of the donor plasmid and 3 µg of meganuclease expression vector. .. DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer's protocol.

    Modification:

    Article Title: Targeted Gene Therapy of Xeroderma Pigmentosum Cells Using Meganuclease and TALEN(TM)
    Article Snippet: In XP4PA cells, the matrix was composed of two arms of 1.8 and 1.5 Kb homologous to the XPC sequences, separated by the meganuclease-recognizing site modified via silent mutation to avoid any cleavage of the matrix by XPCm ( ). .. DNA extraction was performed using the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Codweb: Whole-genome sequencing uncovers extensive reticulations fueling adaptation among Atlantic, Arctic, and Pacific gadids
    Article Snippet: We cleaned the tagmentated DNA with the Zymo Purification Kit (ZR-96 DNA Clean & Concentrator-5, Zymo Research). .. We used the modification recommended for PCR clean-up for 2 × 250 runs on the MiSeq using 25 μl of Ampure XP beads (instead of 30 μl) for each well of the NAP2 plate.

    Derivative Assay:

    Article Title: Efficient targeting of a SCID gene by an engineered single-chain homing endonuclease
    Article Snippet: These sequences consisted of either a 1.7-kb DNA fragment derived from a neomycin expression plasmid or a 10-bp DNA sequence containing an HindIII recognition site. .. DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer's protocol.

    Transfection:

    Article Title: Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases
    Article Snippet: Monitoring of MN-induced TM 293-H cells were transfected with 3 µg of MN expressing vector or empty vector, except for ADCY9-induced mutagenesis where 293-H cells were transfected with 5 µg of MN-encoding plasmid. .. After 21 days, DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Intragenic transcriptional interference regulates the human immune ligand MICA
    Article Snippet: BAC RMCE clones were generated by co‐transfection of BAC and pCre‐Pac plasmid into the HT1080‐L3N9 acceptor cell line using GeneJuice transfection reagent (Merck) followed by selection with 250 μg/ml hygromycin (Calbiochem). .. Single clones were picked using cloning cylinders (Sigma), expanded, and genomic DNA was extracted using the ZR‐96 Genomic DNA Kit (Zymo Research) for verification by PCR.

    Article Title: Molecular basis of engineered meganuclease targeting of the endogenous human RAG1 locus
    Article Snippet: Cells were transfected with 3 µg of the meganuclease expression vector ( ) and 2 µg of matrix vector, in the presence of lipofectamine 2000 (293H cells) or polyfect (MRC5 cells) transfection reagent in accordance with the manufacturer’s protocol (Invitrogen). .. DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer’s protocol.

    Article Title: Efficient targeting of a SCID gene by an engineered single-chain homing endonuclease
    Article Snippet: The next day, cells were transfected in the presence of Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer's protocol. .. DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer's protocol.

    Southern Blot:

    Article Title: Efficient targeting of a SCID gene by an engineered single-chain homing endonuclease
    Article Snippet: DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer's protocol. .. Southern blot analysis was performed with genomic DNA digested with HindIII and hybridized with an 830 bp RAG1 specific probe binding outside of the right homology arm of the donor plasmid.

    Generated:

    Article Title: Intragenic transcriptional interference regulates the human immune ligand MICA
    Article Snippet: BAC RMCE clones were generated by co‐transfection of BAC and pCre‐Pac plasmid into the HT1080‐L3N9 acceptor cell line using GeneJuice transfection reagent (Merck) followed by selection with 250 μg/ml hygromycin (Calbiochem). .. Single clones were picked using cloning cylinders (Sigma), expanded, and genomic DNA was extracted using the ZR‐96 Genomic DNA Kit (Zymo Research) for verification by PCR.

    other:

    Article Title: Dynamic Modulation of the Gut Microbiota and Metabolome by Bacteriophages in a Mouse Model
    Article Snippet: Nucleic Acid Extraction Extraction of DNA from pre-weighed fecal samples as well as bacterial and phage standards from liquid culture was performed using the Zymo Research ZymoBIOMICS DNA 96-well kit according to manufacturer instructions with bead beating for 20 min.

    Polymerase Chain Reaction:

    Article Title: Targeted Gene Therapy of Xeroderma Pigmentosum Cells Using Meganuclease and TALEN(TM)
    Article Snippet: DNA extraction was performed using the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol. .. The detection of targeted integration was performed via specific PCR amplification using one primer located within the heterologous insert of the DNA repair matrix and another located on the genomic sequence outside the matrix homology arms ( ).

    Article Title: Intragenic transcriptional interference regulates the human immune ligand MICA
    Article Snippet: .. Single clones were picked using cloning cylinders (Sigma), expanded, and genomic DNA was extracted using the ZR‐96 Genomic DNA Kit (Zymo Research) for verification by PCR. .. PCR‐verified clones were then screened by flow cytometry to exclude hyperploid clones based on forward and side‐scattering properties and propidium iodide staining for DNA content.

    Article Title: Codweb: Whole-genome sequencing uncovers extensive reticulations fueling adaptation among Atlantic, Arctic, and Pacific gadids
    Article Snippet: We cleaned the tagmentated DNA with the Zymo Purification Kit (ZR-96 DNA Clean & Concentrator-5, Zymo Research). .. We cleaned PCR products, and size was selected with Ampure XP beads (reference A63881, Beckman Coulter Genomics).

    Article Title: Molecular basis of engineered meganuclease targeting of the endogenous human RAG1 locus
    Article Snippet: DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer’s protocol. .. PCR amplification reactions performed with specific primers enabled us to selectively amplify gene-targeting events.

    Article Title: Molecular basis of engineered meganuclease targeting of the endogenous human RAG1 locus
    Article Snippet: .. After 21 days, DNA was extracted with the ZR-96 genomic DNA kit and PCR amplification on RAG1 locus was performed with the primers F9: 5′- GGCAAAGATGAATCAAAGATTCTGTCCT-3′ and R9: 5′-GATCTCACCCGGAACAGCTTAAATTTC-3′. ..

    Article Title: Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases
    Article Snippet: Monitoring of MN-induced HGT 293-H cells were co-transfected with 3 µg of MN expressing vector, and 2 µg of DNA matrix and seeded at 10 cells per well in 96-well plate, and HGT was monitored by PCR 21 days later. .. DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Efficient targeting of a SCID gene by an engineered single-chain homing endonuclease
    Article Snippet: DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer's protocol. .. PCR amplification reactions were performed with the primers F2:5′-AGGATCTCCTGTCATCTCAC-3′ and R2: 5′-GCAGTGTTGCAGATGTCACAG-3′, and F2:5′-AGGATCTCCTGTCATCTCAC-3′ and R12: 5′-CTTTCACAGTCCTGTACATCTTGT-3′ in order to detect the targeted integrations of the 10 bp and 1700 bp exogenous fragments, respectively.

    Binding Assay:

    Article Title: Efficient targeting of a SCID gene by an engineered single-chain homing endonuclease
    Article Snippet: DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer's protocol. .. Southern blot analysis was performed with genomic DNA digested with HindIII and hybridized with an 830 bp RAG1 specific probe binding outside of the right homology arm of the donor plasmid.

    DNA Extraction:

    Article Title: Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases
    Article Snippet: .. After 21 days, DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol. ..

    Article Title: Molecular and Phenotypic Characteristics of Healthcare- and Community-Associated Methicillin-Resistant Staphylococcus aureus at a Rural Hospital
    Article Snippet: .. Molecular Methods DNA was extracted from isolates using ZR-96 DNA extraction kits (Zymo Research, Orange, CA). .. Isolates were tested using a real-time PCR assay to confirm MRSA genotype by detection of mecA and femA genes (Pathogene, LLC).

    Article Title: Targeted Gene Therapy of Xeroderma Pigmentosum Cells Using Meganuclease and TALEN(TM)
    Article Snippet: .. DNA extraction was performed using the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol. .. The detection of targeted integration was performed via specific PCR amplification using one primer located within the heterologous insert of the DNA repair matrix and another located on the genomic sequence outside the matrix homology arms ( ).

    Article Title: Decaffeinated Green Tea Extract Does Not Elicit Hepatotoxic Effects and Modulates the Gut Microbiome in Lean B6C3F1 Mice
    Article Snippet: .. Bacterial DNA extraction was performed using ZymoBIOMICS DNA Kits (Zymo Research). .. In total, 400 ng of each sample was used for tagmentation and library preparation, as directed by manufacturer’s protocol of KAPA HyperPlus Kit (Roche, Madison, WI, USA).

    Article Title: Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases
    Article Snippet: .. DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol. .. The detection of targeted integration is performed by specific PCR amplification using a primer located within the heterologous insert of the DNA repair matrix, and another one located on the genomic sequence outside of the homology.

    Mutagenesis:

    Article Title: Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases
    Article Snippet: Monitoring of MN-induced TM 293-H cells were transfected with 3 µg of MN expressing vector or empty vector, except for ADCY9-induced mutagenesis where 293-H cells were transfected with 5 µg of MN-encoding plasmid. .. After 21 days, DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Targeted Gene Therapy of Xeroderma Pigmentosum Cells Using Meganuclease and TALEN(TM)
    Article Snippet: In XP4PA cells, the matrix was composed of two arms of 1.8 and 1.5 Kb homologous to the XPC sequences, separated by the meganuclease-recognizing site modified via silent mutation to avoid any cleavage of the matrix by XPCm ( ). .. DNA extraction was performed using the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Molecular basis of engineered meganuclease targeting of the endogenous human RAG1 locus
    Article Snippet: The mutation was located 265 bp downstream of the double-strand break. .. DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer’s protocol.

    Flow Cytometry:

    Article Title: Intragenic transcriptional interference regulates the human immune ligand MICA
    Article Snippet: Single clones were picked using cloning cylinders (Sigma), expanded, and genomic DNA was extracted using the ZR‐96 Genomic DNA Kit (Zymo Research) for verification by PCR. .. PCR‐verified clones were then screened by flow cytometry to exclude hyperploid clones based on forward and side‐scattering properties and propidium iodide staining for DNA content.

    Mouse Assay:

    Article Title: Decaffeinated Green Tea Extract Does Not Elicit Hepatotoxic Effects and Modulates the Gut Microbiome in Lean B6C3F1 Mice
    Article Snippet: Analysis of the Gut Microbiome Fecal samples from individual mice were placed into collection tubes containing a nucleic acid stabilizer (Zymo Research, Irvine, CA, USA). .. Bacterial DNA extraction was performed using ZymoBIOMICS DNA Kits (Zymo Research).

    Sequencing:

    Article Title: Targeted Gene Therapy of Xeroderma Pigmentosum Cells Using Meganuclease and TALEN(TM)
    Article Snippet: In 293-H cells, the matrix was composed of two homologous arms (980 bp and 1,000 bp) separated by 29 bp of an exogenous sequence. .. DNA extraction was performed using the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Decaffeinated Green Tea Extract Does Not Elicit Hepatotoxic Effects and Modulates the Gut Microbiome in Lean B6C3F1 Mice
    Article Snippet: Bacterial DNA extraction was performed using ZymoBIOMICS DNA Kits (Zymo Research). .. Normalized libraries were pooled and pair-end sequencing using the Illumina NextSeq 500 platform to obtain 150 bp paired-end reads was performed.

    Article Title: Codweb: Whole-genome sequencing uncovers extensive reticulations fueling adaptation among Atlantic, Arctic, and Pacific gadids
    Article Snippet: We prepared libraries for low-coverage sequencing using the Nextera DNA Library Preparation Kit (FC-121-1031, Illumina). .. We cleaned the tagmentated DNA with the Zymo Purification Kit (ZR-96 DNA Clean & Concentrator-5, Zymo Research).

    Article Title: Molecular basis of engineered meganuclease targeting of the endogenous human RAG1 locus
    Article Snippet: To prevent cleavage of the repair matrix by the meganuclease targeting the human RAG1 locus, a 9 bp deletion (comprising the nucleotides +4 to +12 from the meganuclease DNA target sequence) was also introduced. .. DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer’s protocol.

    Article Title: Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases
    Article Snippet: DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol. .. The detection of targeted integration is performed by specific PCR amplification using a primer located within the heterologous insert of the DNA repair matrix, and another one located on the genomic sequence outside of the homology.

    Article Title: Efficient targeting of a SCID gene by an engineered single-chain homing endonuclease
    Article Snippet: These sequences consisted of either a 1.7-kb DNA fragment derived from a neomycin expression plasmid or a 10-bp DNA sequence containing an HindIII recognition site. .. DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer's protocol.

    Cotransfection:

    Article Title: Intragenic transcriptional interference regulates the human immune ligand MICA
    Article Snippet: BAC RMCE clones were generated by co‐transfection of BAC and pCre‐Pac plasmid into the HT1080‐L3N9 acceptor cell line using GeneJuice transfection reagent (Merck) followed by selection with 250 μg/ml hygromycin (Calbiochem). .. Single clones were picked using cloning cylinders (Sigma), expanded, and genomic DNA was extracted using the ZR‐96 Genomic DNA Kit (Zymo Research) for verification by PCR.

    Purification:

    Article Title: Decaffeinated Green Tea Extract Does Not Elicit Hepatotoxic Effects and Modulates the Gut Microbiome in Lean B6C3F1 Mice
    Article Snippet: Bacterial DNA extraction was performed using ZymoBIOMICS DNA Kits (Zymo Research). .. Then, each library was purified using AMPure XP bead (Beckman Coulter, Indianapolis, IN, USA).

    Article Title: Codweb: Whole-genome sequencing uncovers extensive reticulations fueling adaptation among Atlantic, Arctic, and Pacific gadids
    Article Snippet: .. We cleaned the tagmentated DNA with the Zymo Purification Kit (ZR-96 DNA Clean & Concentrator-5, Zymo Research). .. We cleaned PCR products, and size was selected with Ampure XP beads (reference A63881, Beckman Coulter Genomics).

    Plasmid Preparation:

    Article Title: Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases
    Article Snippet: Monitoring of MN-induced TM 293-H cells were transfected with 3 µg of MN expressing vector or empty vector, except for ADCY9-induced mutagenesis where 293-H cells were transfected with 5 µg of MN-encoding plasmid. .. After 21 days, DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Targeted Gene Therapy of Xeroderma Pigmentosum Cells Using Meganuclease and TALEN(TM)
    Article Snippet: The matrix was cloned in a circular plasmid. .. DNA extraction was performed using the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Intragenic transcriptional interference regulates the human immune ligand MICA
    Article Snippet: BAC RMCE clones were generated by co‐transfection of BAC and pCre‐Pac plasmid into the HT1080‐L3N9 acceptor cell line using GeneJuice transfection reagent (Merck) followed by selection with 250 μg/ml hygromycin (Calbiochem). .. Single clones were picked using cloning cylinders (Sigma), expanded, and genomic DNA was extracted using the ZR‐96 Genomic DNA Kit (Zymo Research) for verification by PCR.

    Article Title: Molecular basis of engineered meganuclease targeting of the endogenous human RAG1 locus
    Article Snippet: Cells were transfected with 3 µg of the meganuclease expression vector ( ) and 2 µg of matrix vector, in the presence of lipofectamine 2000 (293H cells) or polyfect (MRC5 cells) transfection reagent in accordance with the manufacturer’s protocol (Invitrogen). .. DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer’s protocol.

    Article Title: Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases
    Article Snippet: Monitoring of MN-induced HGT 293-H cells were co-transfected with 3 µg of MN expressing vector, and 2 µg of DNA matrix and seeded at 10 cells per well in 96-well plate, and HGT was monitored by PCR 21 days later. .. DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier’s protocol.

    Article Title: Efficient targeting of a SCID gene by an engineered single-chain homing endonuclease
    Article Snippet: Cells were co-transfected with 2 µg of the donor plasmid and 3 µg of meganuclease expression vector. .. DNA was extracted with the ZR-96 genomic DNA kit (Zymo research) according to the manufacturer's protocol.

    SYBR Green Assay:

    Article Title: Changes in Microbiota and Bacterial Protein Caseinolytic Peptidase B During Food Restriction in Mice: Relevance for the Onset and Perpetuation of Anorexia Nervosa
    Article Snippet: 2.5. qPCR Assay for Faecal Enterobacteriaceae DNA Enterobacteriaceae DNA in faeces were extracted with the ZymoBIOMICS Kit according to the protocol given by the supplier (ZymoResearch, Irvine, CA, USA). .. After extraction, the total DNA was quantified using a NanoDrop spectrophotometer (ThermoScientific, Waltham, MA, USA). qPCR was performed on 1 ng/µL of DNA and with Light Cycler® 480 SYBR® Green I Master (Roche, Swiss).

    Selection:

    Article Title: Intragenic transcriptional interference regulates the human immune ligand MICA
    Article Snippet: BAC RMCE clones were generated by co‐transfection of BAC and pCre‐Pac plasmid into the HT1080‐L3N9 acceptor cell line using GeneJuice transfection reagent (Merck) followed by selection with 250 μg/ml hygromycin (Calbiochem). .. Single clones were picked using cloning cylinders (Sigma), expanded, and genomic DNA was extracted using the ZR‐96 Genomic DNA Kit (Zymo Research) for verification by PCR.

    Spectrophotometry:

    Article Title: Changes in Microbiota and Bacterial Protein Caseinolytic Peptidase B During Food Restriction in Mice: Relevance for the Onset and Perpetuation of Anorexia Nervosa
    Article Snippet: 2.5. qPCR Assay for Faecal Enterobacteriaceae DNA Enterobacteriaceae DNA in faeces were extracted with the ZymoBIOMICS Kit according to the protocol given by the supplier (ZymoResearch, Irvine, CA, USA). .. After extraction, the total DNA was quantified using a NanoDrop spectrophotometer (ThermoScientific, Waltham, MA, USA). qPCR was performed on 1 ng/µL of DNA and with Light Cycler® 480 SYBR® Green I Master (Roche, Swiss).

    Concentration Assay:

    Article Title: Codweb: Whole-genome sequencing uncovers extensive reticulations fueling adaptation among Atlantic, Arctic, and Pacific gadids
    Article Snippet: Library sample concentration was determined with quantitative polymerase chain reaction (qPCR) according to an Illumina protocol. .. We cleaned the tagmentated DNA with the Zymo Purification Kit (ZR-96 DNA Clean & Concentrator-5, Zymo Research).

    BAC Assay:

    Article Title: Intragenic transcriptional interference regulates the human immune ligand MICA
    Article Snippet: Paragraph title: Generation of site‐directed BAC RMCE clones ... Single clones were picked using cloning cylinders (Sigma), expanded, and genomic DNA was extracted using the ZR‐96 Genomic DNA Kit (Zymo Research) for verification by PCR.

    Staining:

    Article Title: Intragenic transcriptional interference regulates the human immune ligand MICA
    Article Snippet: Single clones were picked using cloning cylinders (Sigma), expanded, and genomic DNA was extracted using the ZR‐96 Genomic DNA Kit (Zymo Research) for verification by PCR. .. PCR‐verified clones were then screened by flow cytometry to exclude hyperploid clones based on forward and side‐scattering properties and propidium iodide staining for DNA content.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Zymo Research zymobiomicstm dna mini kit
    Zymobiomicstm Dna Mini Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/zymobiomicstm dna mini kit/product/Zymo Research
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    zymobiomicstm dna mini kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results