zymo spin chip kit  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Zymo Spin ChIP Kit
    Description:
    The Zymo Spin ChIP Kit from Zymo Research provides a streamlined ChIP procedure for investigating protein DNA interactions that have been fixed in their natural state and can be used to effectively identify binding sites for transcription factors co factors and other DNA regulatory proteins
    Catalog Number:
    d5209
    Price:
    None
    Applications:
    Chromatin Immunoprecipitation
    Size:
    10 units
    Category:
    Life Science Reagents and Media
    Buy from Supplier


    Structured Review

    Zymo Research zymo spin chip kit
    Zymo Spin ChIP Kit
    The Zymo Spin ChIP Kit from Zymo Research provides a streamlined ChIP procedure for investigating protein DNA interactions that have been fixed in their natural state and can be used to effectively identify binding sites for transcription factors co factors and other DNA regulatory proteins
    https://www.bioz.com/result/zymo spin chip kit/product/Zymo Research
    Average 95 stars, based on 53 article reviews
    Price from $9.99 to $1999.99
    zymo spin chip kit - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Cell Isolation:

    Article Title: DNA methylation and repressive H3K9 and H3K27 trimethylation in the promoter regions of PD-1, CTLA-4, TIM-3, LAG-3, TIGIT, and PD-L1 genes in human primary breast cancer
    Article Snippet: Cells isolated from NT and TT through ED were subjected to ChIP analysis using Zymo-Spin ChIP kit (Zymo Research) as per manufacturer’s instructions. .. Briefly, after cell isolation by ED, nuclear lysate was prepared as per the protocol and sonicated using Omni Sonic Ruptor 400 Ultrasonic Homogenizer (OMNI International, GA, USA) to make small DNA fragments ranging from 100 to 1000 base pairs and then incubated with ChIP grade anti-Histone H3 (tri methyl K9) rabbit mAb (Abcam, Cambridge, United Kingdom) and anti-Histone H3 (tri methyl K27) rabbit mAb (Abcam).

    Amplification:

    Article Title: Role for Chromatin Remodeling Factor Chd1 in Learning and Memory
    Article Snippet: ChIP analyses as well as the qPCR amplification of the DNA recovered from the immunoprecipitates were carried out essentially as described by Riffo-Campos et al. , with the primers shown in Table . .. Hippocampi from each mouse were processed separately for crosslinking and chromatin preparation using the Zymo-Spin ChIP Kit (Zymo Research) exactly following the manufacturer’s ChIP protocol for mouse tissue.

    Article Title: FOXA1 overexpression mediates endocrine resistance by altering the ER transcriptome and IL-8 expression in ER-positive breast cancer
    Article Snippet: ChIP assay was performed using the Zymo-Spin ChIP kit (Zymo Research) following the manufacturer’s protocol. .. The intergenic control sequence was amplified using the following primers: forward, GGAACAGGCAACACATAA and reverse, CTCATACATATCTCTTAGGTCAG.

    SYBR Green Assay:

    Article Title: FOXA1 overexpression mediates endocrine resistance by altering the ER transcriptome and IL-8 expression in ER-positive breast cancer
    Article Snippet: ChIP assay was performed using the Zymo-Spin ChIP kit (Zymo Research) following the manufacturer’s protocol. .. The occupancy of FOXA1 and ER on the IL8 gene locus was analyzed by real-time qPCR using SYBR Green master mixes (Life Technologies) with the following primers: dis. forward AAGCCCTGGACAAATATACT, reverse CTATTCAATGACATCTGTGGTT; and pro. forward ATAAGTTCTCTAGTAGGGTGATGA, reverse TGCTCTGCTGTCTCTGAA.

    Incubation:

    Article Title: Role for Chromatin Remodeling Factor Chd1 in Learning and Memory
    Article Snippet: Hippocampi from each mouse were processed separately for crosslinking and chromatin preparation using the Zymo-Spin ChIP Kit (Zymo Research) exactly following the manufacturer’s ChIP protocol for mouse tissue. .. Before the IP, sheared chromatin from the four mice of each group was pooled to obtain enough material, the samples were precleared for 60 min at 4°C with ZymoMag Protein A magnetic beads (Zymo Research), followed by incubation of 15 μg chromatin with 5 μl α-CHD1 antibody or no antibody (NA) over night at 4°C.

    Article Title: Satb2 determines miRNA expression and long-term memory in the adult central nervous system
    Article Snippet: ChIP ChIP was performed on microdissected adult mouse CA1 tissue (a pool of 8–10 mice) by using the Zymo-Spin ChIP kit (Zymo Research) following manufacturer’s instructions. .. Sonicated chromatin (10–15 µg) was incubated at 4°C overnight with 5 µg antibodies (ab34735, AB_2301417, Abcam or normal rabbit IgG 12–370, AB_145841, Millipore).

    Article Title: DNA methylation and repressive H3K9 and H3K27 trimethylation in the promoter regions of PD-1, CTLA-4, TIM-3, LAG-3, TIGIT, and PD-L1 genes in human primary breast cancer
    Article Snippet: Cells isolated from NT and TT through ED were subjected to ChIP analysis using Zymo-Spin ChIP kit (Zymo Research) as per manufacturer’s instructions. .. Briefly, after cell isolation by ED, nuclear lysate was prepared as per the protocol and sonicated using Omni Sonic Ruptor 400 Ultrasonic Homogenizer (OMNI International, GA, USA) to make small DNA fragments ranging from 100 to 1000 base pairs and then incubated with ChIP grade anti-Histone H3 (tri methyl K9) rabbit mAb (Abcam, Cambridge, United Kingdom) and anti-Histone H3 (tri methyl K27) rabbit mAb (Abcam).

    Article Title: miR-425 reduction causes aberrant proliferation and collagen synthesis through modulating TGF-β/Smad signaling in acute respiratory distress syndrome
    Article Snippet: Nuclear lysates were sonicated to make small DNA fragments ranging from 100 to 1000 base pairs and then incubated with ChIP grade anti-H3K27me3 or H3K4me3 or H3K9me3 rabbit antibody (Abcam). .. Immune complexes containing DNA fragments were precipitated using Magna A/G beads supplied within Zymo-Spin ChIP kit (Zymo Research).

    Expressing:

    Article Title: HBZ Stimulates Brain-Derived Neurotrophic Factor/TrkB Autocrine/Paracrine Signaling To Promote Survival of Human T-Cell Leukemia Virus Type 1-Infected T Cells
    Article Snippet: HeLa clonal cells expressing HBZ or carrying the empty vector were analyzed. .. Chromatin immunoprecipitation (ChIP) assays were performed as described previously , but using a Zymo-Spin ChIP kit (Zymo Research).

    Modification:

    Article Title: Genome-wide (ChIP-seq) identification of target genes regulated by BdbZIP10 during paraquat-induced oxidative stress
    Article Snippet: .. Chromatin was prepared using the Zymo-Spin™ ChIP kit (Zymo Research Corp., Irvine, CA) following their modified protocol for isolation of plant chromatin. .. Sonication was performed at high power setting for 40 cycles (30 s on, 30 s off) using a Bioruptor Plus™ (Diagenode Inc., Denville, NJ), yielding a DNA fragment-size range of 200–700 bp.

    Transfection:

    Article Title: The Translesion Polymerase Pol η Is Required for Efficient Epstein-Barr Virus Infectivity and Is Regulated by the Viral Deubiquitinating Enzyme BPLF1
    Article Snippet: Chromatin immunoprecipitations were performed using a Zymo-Spin ChIP kit (Zymo Research) essentially following the manufacturer's guidelines. .. 293EBV+ cells were transfected with BZLF1 and FLAG-tagged Pol η. Twenty-four hours after transfection, the cells were harvested, washed, and resuspended in 1 ml phosphate-buffered saline (PBS).

    Concentration Assay:

    Article Title: Activation of STAT3 signaling is mediated by TFF1 silencing in gastric neoplasia
    Article Snippet: ChIP assay AGS cells were fixed with 1% formaldehyde final concentration (Sigma-Aldrich) and chromatin fragmentation was done by sonication on ice for four cycles (30 s “ON”, 30 s “OFF” at 40% amplitude) to yield an average length of 235 bp. .. ChIP assay was performed using the Zymo-Spin ChIP Kit (Irvine, California, USA) following the manufacturer’s protocol.

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: AGS cells were fixed with formaldehyde (1% final concentration, Sigma–Aldrich) and chromatin fragmentation was done by sonication on ice for four cycles (30 s ‘ON’, 30s ‘OFF’ at 40% amplitude) to yield an average length of < 500 bp. .. Chromatin immunoprecipitation (ChIP) assay was performed using Zymo-Spin ChIP Kit (Irvine, California, USA) following the manufacturer’s protocol.

    Article Title: Genome-wide (ChIP-seq) identification of target genes regulated by BdbZIP10 during paraquat-induced oxidative stress
    Article Snippet: Chromatin was prepared using the Zymo-Spin™ ChIP kit (Zymo Research Corp., Irvine, CA) following their modified protocol for isolation of plant chromatin. .. Anti-IgG (Millipore, PP64B; Lot 2,565,474) at a concentration of 10 μg was included as a negative control.

    Polymerase Chain Reaction:

    Article Title: Comprehensive epigenetic landscape of rheumatoid arthritis fibroblast-like synoviocytes
    Article Snippet: The sample preparation for ChIP-seq was performed using the Zymo-spin ChIP kit (Zymo Research, Irvine, CA) according to the manufacturer’s instructions. .. To assess the library complexity and the enrichment of the data, quality control was done using several metrics, including non-redundant fraction of reads, fraction of reads that fall into peak regions, PCR bottleneck coefficient, normalized strand cross-correlation coefficient and the relative strand cross-correlation coefficient.

    Sonication:

    Article Title: Role for Chromatin Remodeling Factor Chd1 in Learning and Memory
    Article Snippet: For fragmentation chromatin was subjected to 3 cycles of 5 min sonication (30 s on, 30 s off) in a Bioruptor Plus instrument (Diagenode). .. Hippocampi from each mouse were processed separately for crosslinking and chromatin preparation using the Zymo-Spin ChIP Kit (Zymo Research) exactly following the manufacturer’s ChIP protocol for mouse tissue.

    Article Title: Satb2 determines miRNA expression and long-term memory in the adult central nervous system
    Article Snippet: ChIP ChIP was performed on microdissected adult mouse CA1 tissue (a pool of 8–10 mice) by using the Zymo-Spin ChIP kit (Zymo Research) following manufacturer’s instructions. .. Sonicated chromatin (10–15 µg) was incubated at 4°C overnight with 5 µg antibodies (ab34735, AB_2301417, Abcam or normal rabbit IgG 12–370, AB_145841, Millipore).

    Article Title: DNA methylation and repressive H3K9 and H3K27 trimethylation in the promoter regions of PD-1, CTLA-4, TIM-3, LAG-3, TIGIT, and PD-L1 genes in human primary breast cancer
    Article Snippet: Cells isolated from NT and TT through ED were subjected to ChIP analysis using Zymo-Spin ChIP kit (Zymo Research) as per manufacturer’s instructions. .. Briefly, after cell isolation by ED, nuclear lysate was prepared as per the protocol and sonicated using Omni Sonic Ruptor 400 Ultrasonic Homogenizer (OMNI International, GA, USA) to make small DNA fragments ranging from 100 to 1000 base pairs and then incubated with ChIP grade anti-Histone H3 (tri methyl K9) rabbit mAb (Abcam, Cambridge, United Kingdom) and anti-Histone H3 (tri methyl K27) rabbit mAb (Abcam).

    Article Title: Activation of STAT3 signaling is mediated by TFF1 silencing in gastric neoplasia
    Article Snippet: ChIP assay AGS cells were fixed with 1% formaldehyde final concentration (Sigma-Aldrich) and chromatin fragmentation was done by sonication on ice for four cycles (30 s “ON”, 30 s “OFF” at 40% amplitude) to yield an average length of 235 bp. .. ChIP assay was performed using the Zymo-Spin ChIP Kit (Irvine, California, USA) following the manufacturer’s protocol.

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: AGS cells were fixed with formaldehyde (1% final concentration, Sigma–Aldrich) and chromatin fragmentation was done by sonication on ice for four cycles (30 s ‘ON’, 30s ‘OFF’ at 40% amplitude) to yield an average length of < 500 bp. .. Chromatin immunoprecipitation (ChIP) assay was performed using Zymo-Spin ChIP Kit (Irvine, California, USA) following the manufacturer’s protocol.

    Article Title: Genome-wide (ChIP-seq) identification of target genes regulated by BdbZIP10 during paraquat-induced oxidative stress
    Article Snippet: Chromatin was prepared using the Zymo-Spin™ ChIP kit (Zymo Research Corp., Irvine, CA) following their modified protocol for isolation of plant chromatin. .. Sonication was performed at high power setting for 40 cycles (30 s on, 30 s off) using a Bioruptor Plus™ (Diagenode Inc., Denville, NJ), yielding a DNA fragment-size range of 200–700 bp.

    Article Title: miR-425 reduction causes aberrant proliferation and collagen synthesis through modulating TGF-β/Smad signaling in acute respiratory distress syndrome
    Article Snippet: Nuclear lysates were sonicated to make small DNA fragments ranging from 100 to 1000 base pairs and then incubated with ChIP grade anti-H3K27me3 or H3K4me3 or H3K9me3 rabbit antibody (Abcam). .. Immune complexes containing DNA fragments were precipitated using Magna A/G beads supplied within Zymo-Spin ChIP kit (Zymo Research).

    Article Title: Epigenetic Activation of ASCT2 in the Hippocampus Contributes to Depression-Like Behavior by Regulating D-Serine in Mice
    Article Snippet: .. Cell samples were treated using the Zymo-Spin™ ChIP Kit (ZymoResearch, Irvine, CA) according to the manufacturer's protocol and sonicated for 10 min (30 s, on; 30 s, off; 10 cycles). .. Cross-linked chromatin was immunoprecipitated with antibodies against acetylated chromatin: anti-H3K9 (ab10812; Abcam, Hong Kong, China), anti-H3K27 (ab3350; Abcam), and anti-H3k4 (#ABE223; Millipore); normal rabbit IgG-B (sc-2763; Santa Cruz Biotechnology, Dallas, TX) was used as a negative control antibody.

    ChIP-sequencing:

    Article Title: The Translesion Polymerase Pol η Is Required for Efficient Epstein-Barr Virus Infectivity and Is Regulated by the Viral Deubiquitinating Enzyme BPLF1
    Article Snippet: Paragraph title: ChIP-seq. ... Chromatin immunoprecipitations were performed using a Zymo-Spin ChIP kit (Zymo Research) essentially following the manufacturer's guidelines.

    Article Title: Genome-wide (ChIP-seq) identification of target genes regulated by BdbZIP10 during paraquat-induced oxidative stress
    Article Snippet: Paragraph title: ChIP-sequencing and ChIP-qPCR ... Chromatin was prepared using the Zymo-Spin™ ChIP kit (Zymo Research Corp., Irvine, CA) following their modified protocol for isolation of plant chromatin.

    Article Title: Comprehensive epigenetic landscape of rheumatoid arthritis fibroblast-like synoviocytes
    Article Snippet: .. The sample preparation for ChIP-seq was performed using the Zymo-spin ChIP kit (Zymo Research, Irvine, CA) according to the manufacturer’s instructions. .. Raw ChIP-seq reads of 11 RA and 11 OA samples, each with six histone modifications (H3K4me1, H3K4me3, H3K9me3, H3K27ac, H3K27me3, and H3K36me3) and input data, were mapped to hg19 genome using bwa (0.7.7-r441).

    Magnetic Beads:

    Article Title: Role for Chromatin Remodeling Factor Chd1 in Learning and Memory
    Article Snippet: Hippocampi from each mouse were processed separately for crosslinking and chromatin preparation using the Zymo-Spin ChIP Kit (Zymo Research) exactly following the manufacturer’s ChIP protocol for mouse tissue. .. Before the IP, sheared chromatin from the four mice of each group was pooled to obtain enough material, the samples were precleared for 60 min at 4°C with ZymoMag Protein A magnetic beads (Zymo Research), followed by incubation of 15 μg chromatin with 5 μl α-CHD1 antibody or no antibody (NA) over night at 4°C.

    Isolation:

    Article Title: DNA methylation and repressive H3K9 and H3K27 trimethylation in the promoter regions of PD-1, CTLA-4, TIM-3, LAG-3, TIGIT, and PD-L1 genes in human primary breast cancer
    Article Snippet: .. Cells isolated from NT and TT through ED were subjected to ChIP analysis using Zymo-Spin ChIP kit (Zymo Research) as per manufacturer’s instructions. .. Briefly, after cell isolation by ED, nuclear lysate was prepared as per the protocol and sonicated using Omni Sonic Ruptor 400 Ultrasonic Homogenizer (OMNI International, GA, USA) to make small DNA fragments ranging from 100 to 1000 base pairs and then incubated with ChIP grade anti-Histone H3 (tri methyl K9) rabbit mAb (Abcam, Cambridge, United Kingdom) and anti-Histone H3 (tri methyl K27) rabbit mAb (Abcam).

    Article Title: Genome-wide (ChIP-seq) identification of target genes regulated by BdbZIP10 during paraquat-induced oxidative stress
    Article Snippet: .. Chromatin was prepared using the Zymo-Spin™ ChIP kit (Zymo Research Corp., Irvine, CA) following their modified protocol for isolation of plant chromatin. .. Sonication was performed at high power setting for 40 cycles (30 s on, 30 s off) using a Bioruptor Plus™ (Diagenode Inc., Denville, NJ), yielding a DNA fragment-size range of 200–700 bp.

    Article Title: miR-425 reduction causes aberrant proliferation and collagen synthesis through modulating TGF-β/Smad signaling in acute respiratory distress syndrome
    Article Snippet: miR-425 mimic or inhibitor treated cells were collected and the cell nuclei were isolated. .. Immune complexes containing DNA fragments were precipitated using Magna A/G beads supplied within Zymo-Spin ChIP kit (Zymo Research).

    Mouse Assay:

    Article Title: Role for Chromatin Remodeling Factor Chd1 in Learning and Memory
    Article Snippet: For ChIP from hippocampus, C57BL/6N male mice were either taken directly from the home cage (n = 4) or subjected to the training session for the OLM test (n = 4). .. Hippocampi from each mouse were processed separately for crosslinking and chromatin preparation using the Zymo-Spin ChIP Kit (Zymo Research) exactly following the manufacturer’s ChIP protocol for mouse tissue.

    Article Title: Satb2 determines miRNA expression and long-term memory in the adult central nervous system
    Article Snippet: .. ChIP ChIP was performed on microdissected adult mouse CA1 tissue (a pool of 8–10 mice) by using the Zymo-Spin ChIP kit (Zymo Research) following manufacturer’s instructions. .. Briefly, 100 mg of CA1 tissue were cross-linked with 1% formaldehyde (Sigma) for 10 min at RT and neutralized with 0.125M glycine.

    Sequencing:

    Article Title: FOXA1 overexpression mediates endocrine resistance by altering the ER transcriptome and IL-8 expression in ER-positive breast cancer
    Article Snippet: ChIP assay was performed using the Zymo-Spin ChIP kit (Zymo Research) following the manufacturer’s protocol. .. The intergenic control sequence was amplified using the following primers: forward, GGAACAGGCAACACATAA and reverse, CTCATACATATCTCTTAGGTCAG.

    Purification:

    Article Title: HBZ Stimulates Brain-Derived Neurotrophic Factor/TrkB Autocrine/Paracrine Signaling To Promote Survival of Human T-Cell Leukemia Virus Type 1-Infected T Cells
    Article Snippet: Chromatin immunoprecipitation (ChIP) assays were performed as described previously , but using a Zymo-Spin ChIP kit (Zymo Research). .. Purified input and ChIP DNA samples were suspended in 50 μl of water.

    Chromatin Immunoprecipitation:

    Article Title: Limb Bud and Heart Development Gene Transcription is Regulated by the Interplay of an Enhancer Risk Allele and DNA Methylation in Rheumatoid Arthritis
    Article Snippet: .. ChIP assay was performed using Zymo-Spin ChIP kit according to the manufacturer’s protocol (Zymo Research, Irvine, CA). ..

    Article Title: Role for Chromatin Remodeling Factor Chd1 in Learning and Memory
    Article Snippet: .. Hippocampi from each mouse were processed separately for crosslinking and chromatin preparation using the Zymo-Spin ChIP Kit (Zymo Research) exactly following the manufacturer’s ChIP protocol for mouse tissue. .. Before the IP, sheared chromatin from the four mice of each group was pooled to obtain enough material, the samples were precleared for 60 min at 4°C with ZymoMag Protein A magnetic beads (Zymo Research), followed by incubation of 15 μg chromatin with 5 μl α-CHD1 antibody or no antibody (NA) over night at 4°C.

    Article Title: Satb2 determines miRNA expression and long-term memory in the adult central nervous system
    Article Snippet: .. ChIP ChIP was performed on microdissected adult mouse CA1 tissue (a pool of 8–10 mice) by using the Zymo-Spin ChIP kit (Zymo Research) following manufacturer’s instructions. .. Briefly, 100 mg of CA1 tissue were cross-linked with 1% formaldehyde (Sigma) for 10 min at RT and neutralized with 0.125M glycine.

    Article Title: DNA methylation regulates transcriptional homeostasis of algal endosymbiosis in the coral model Aiptasia
    Article Snippet: .. We used the Zymo-Spin ChIP Kit (Zymo Research) to conduct histone bound chromatin extraction, with minor adjustments to the manufacturer’s protocol. ..

    Article Title: DNA methylation and repressive H3K9 and H3K27 trimethylation in the promoter regions of PD-1, CTLA-4, TIM-3, LAG-3, TIGIT, and PD-L1 genes in human primary breast cancer
    Article Snippet: .. Cells isolated from NT and TT through ED were subjected to ChIP analysis using Zymo-Spin ChIP kit (Zymo Research) as per manufacturer’s instructions. .. Briefly, after cell isolation by ED, nuclear lysate was prepared as per the protocol and sonicated using Omni Sonic Ruptor 400 Ultrasonic Homogenizer (OMNI International, GA, USA) to make small DNA fragments ranging from 100 to 1000 base pairs and then incubated with ChIP grade anti-Histone H3 (tri methyl K9) rabbit mAb (Abcam, Cambridge, United Kingdom) and anti-Histone H3 (tri methyl K27) rabbit mAb (Abcam).

    Article Title: Activation of STAT3 signaling is mediated by TFF1 silencing in gastric neoplasia
    Article Snippet: .. ChIP assay was performed using the Zymo-Spin ChIP Kit (Irvine, California, USA) following the manufacturer’s protocol. .. Chromatin solutions were immunoprecipitated with STAT3 antibody from cell signaling at 4 °C overnight.

    Article Title: DNA methylation regulates transcriptional homeostasis of algal endosymbiosis in the coral model Aiptasia
    Article Snippet: .. Chromatin immunoprecipitation We used the Zymo-Spin ChIP Kit (Zymo Research) to conduct histone bound chromatin extraction, with minor adjustments to the manufacturer’s protocol. ..

    Article Title: HBZ Stimulates Brain-Derived Neurotrophic Factor/TrkB Autocrine/Paracrine Signaling To Promote Survival of Human T-Cell Leukemia Virus Type 1-Infected T Cells
    Article Snippet: .. Chromatin immunoprecipitation (ChIP) assays were performed as described previously , but using a Zymo-Spin ChIP kit (Zymo Research). .. For each antibody, 200 μg (100 μl) of formaldehyde-cross-linked chromatin was diluted to 1 ml with ChIP dilution buffer; a 10-μl aliquot of undiluted chromatin served as the input.

    Article Title: The Translesion Polymerase Pol η Is Required for Efficient Epstein-Barr Virus Infectivity and Is Regulated by the Viral Deubiquitinating Enzyme BPLF1
    Article Snippet: .. Chromatin immunoprecipitations were performed using a Zymo-Spin ChIP kit (Zymo Research) essentially following the manufacturer's guidelines. .. 293EBV+ cells were transfected with BZLF1 and FLAG-tagged Pol η. Twenty-four hours after transfection, the cells were harvested, washed, and resuspended in 1 ml phosphate-buffered saline (PBS).

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: .. Chromatin immunoprecipitation (ChIP) assay was performed using Zymo-Spin ChIP Kit (Irvine, California, USA) following the manufacturer’s protocol. .. Chromatin solutions were immunoprecipitated with P65 antibody at 4°C overnight.

    Article Title: Genome-wide (ChIP-seq) identification of target genes regulated by BdbZIP10 during paraquat-induced oxidative stress
    Article Snippet: .. Chromatin was prepared using the Zymo-Spin™ ChIP kit (Zymo Research Corp., Irvine, CA) following their modified protocol for isolation of plant chromatin. .. Sonication was performed at high power setting for 40 cycles (30 s on, 30 s off) using a Bioruptor Plus™ (Diagenode Inc., Denville, NJ), yielding a DNA fragment-size range of 200–700 bp.

    Article Title: miR-425 reduction causes aberrant proliferation and collagen synthesis through modulating TGF-β/Smad signaling in acute respiratory distress syndrome
    Article Snippet: .. Immune complexes containing DNA fragments were precipitated using Magna A/G beads supplied within Zymo-Spin ChIP kit (Zymo Research). .. Relative enrichment of the target regions in the pellets were detected by qPCR using Fast SYBER Green Master Mix (Applied Biosystems).

    Article Title: Comprehensive epigenetic landscape of rheumatoid arthritis fibroblast-like synoviocytes
    Article Snippet: .. The sample preparation for ChIP-seq was performed using the Zymo-spin ChIP kit (Zymo Research, Irvine, CA) according to the manufacturer’s instructions. .. Raw ChIP-seq reads of 11 RA and 11 OA samples, each with six histone modifications (H3K4me1, H3K4me3, H3K9me3, H3K27ac, H3K27me3, and H3K36me3) and input data, were mapped to hg19 genome using bwa (0.7.7-r441).

    Article Title: Epigenetic Activation of ASCT2 in the Hippocampus Contributes to Depression-Like Behavior by Regulating D-Serine in Mice
    Article Snippet: .. Cell samples were treated using the Zymo-Spin™ ChIP Kit (ZymoResearch, Irvine, CA) according to the manufacturer's protocol and sonicated for 10 min (30 s, on; 30 s, off; 10 cycles). .. Cross-linked chromatin was immunoprecipitated with antibodies against acetylated chromatin: anti-H3K9 (ab10812; Abcam, Hong Kong, China), anti-H3K27 (ab3350; Abcam), and anti-H3k4 (#ABE223; Millipore); normal rabbit IgG-B (sc-2763; Santa Cruz Biotechnology, Dallas, TX) was used as a negative control antibody.

    Article Title: FOXA1 overexpression mediates endocrine resistance by altering the ER transcriptome and IL-8 expression in ER-positive breast cancer
    Article Snippet: .. ChIP assay was performed using the Zymo-Spin ChIP kit (Zymo Research) following the manufacturer’s protocol. .. The antibodies used for ChIP assay were anti-FOXA1 (ab23738) from Abcam and anti-ER (sc-543) from Santa Cruz Biotechnology.

    Plasmid Preparation:

    Article Title: HBZ Stimulates Brain-Derived Neurotrophic Factor/TrkB Autocrine/Paracrine Signaling To Promote Survival of Human T-Cell Leukemia Virus Type 1-Infected T Cells
    Article Snippet: HeLa clonal cells expressing HBZ or carrying the empty vector were analyzed. .. Chromatin immunoprecipitation (ChIP) assays were performed as described previously , but using a Zymo-Spin ChIP kit (Zymo Research).

    Real-time Polymerase Chain Reaction:

    Article Title: Role for Chromatin Remodeling Factor Chd1 in Learning and Memory
    Article Snippet: ChIP analyses as well as the qPCR amplification of the DNA recovered from the immunoprecipitates were carried out essentially as described by Riffo-Campos et al. , with the primers shown in Table . .. Hippocampi from each mouse were processed separately for crosslinking and chromatin preparation using the Zymo-Spin ChIP Kit (Zymo Research) exactly following the manufacturer’s ChIP protocol for mouse tissue.

    Article Title: miR-425 reduction causes aberrant proliferation and collagen synthesis through modulating TGF-β/Smad signaling in acute respiratory distress syndrome
    Article Snippet: Immune complexes containing DNA fragments were precipitated using Magna A/G beads supplied within Zymo-Spin ChIP kit (Zymo Research). .. Relative enrichment of the target regions in the pellets were detected by qPCR using Fast SYBER Green Master Mix (Applied Biosystems).

    Article Title: FOXA1 overexpression mediates endocrine resistance by altering the ER transcriptome and IL-8 expression in ER-positive breast cancer
    Article Snippet: ChIP assay was performed using the Zymo-Spin ChIP kit (Zymo Research) following the manufacturer’s protocol. .. The occupancy of FOXA1 and ER on the IL8 gene locus was analyzed by real-time qPCR using SYBR Green master mixes (Life Technologies) with the following primers: dis. forward AAGCCCTGGACAAATATACT, reverse CTATTCAATGACATCTGTGGTT; and pro. forward ATAAGTTCTCTAGTAGGGTGATGA, reverse TGCTCTGCTGTCTCTGAA.

    Negative Control:

    Article Title: DNA methylation and repressive H3K9 and H3K27 trimethylation in the promoter regions of PD-1, CTLA-4, TIM-3, LAG-3, TIGIT, and PD-L1 genes in human primary breast cancer
    Article Snippet: Cells isolated from NT and TT through ED were subjected to ChIP analysis using Zymo-Spin ChIP kit (Zymo Research) as per manufacturer’s instructions. .. Isotype-matched control Ab was used as negative control.

    Article Title: Genome-wide (ChIP-seq) identification of target genes regulated by BdbZIP10 during paraquat-induced oxidative stress
    Article Snippet: Chromatin was prepared using the Zymo-Spin™ ChIP kit (Zymo Research Corp., Irvine, CA) following their modified protocol for isolation of plant chromatin. .. Anti-IgG (Millipore, PP64B; Lot 2,565,474) at a concentration of 10 μg was included as a negative control.

    Article Title: miR-425 reduction causes aberrant proliferation and collagen synthesis through modulating TGF-β/Smad signaling in acute respiratory distress syndrome
    Article Snippet: Isotype-matched control Ab was used as negative control. .. Immune complexes containing DNA fragments were precipitated using Magna A/G beads supplied within Zymo-Spin ChIP kit (Zymo Research).

    Article Title: Epigenetic Activation of ASCT2 in the Hippocampus Contributes to Depression-Like Behavior by Regulating D-Serine in Mice
    Article Snippet: Cell samples were treated using the Zymo-Spin™ ChIP Kit (ZymoResearch, Irvine, CA) according to the manufacturer's protocol and sonicated for 10 min (30 s, on; 30 s, off; 10 cycles). .. Cross-linked chromatin was immunoprecipitated with antibodies against acetylated chromatin: anti-H3K9 (ab10812; Abcam, Hong Kong, China), anti-H3K27 (ab3350; Abcam), and anti-H3k4 (#ABE223; Millipore); normal rabbit IgG-B (sc-2763; Santa Cruz Biotechnology, Dallas, TX) was used as a negative control antibody.

    Sample Prep:

    Article Title: Comprehensive epigenetic landscape of rheumatoid arthritis fibroblast-like synoviocytes
    Article Snippet: .. The sample preparation for ChIP-seq was performed using the Zymo-spin ChIP kit (Zymo Research, Irvine, CA) according to the manufacturer’s instructions. .. Raw ChIP-seq reads of 11 RA and 11 OA samples, each with six histone modifications (H3K4me1, H3K4me3, H3K9me3, H3K27ac, H3K27me3, and H3K36me3) and input data, were mapped to hg19 genome using bwa (0.7.7-r441).

    Homogenization:

    Article Title: DNA methylation regulates transcriptional homeostasis of algal endosymbiosis in the coral model Aiptasia
    Article Snippet: We used the Zymo-Spin ChIP Kit (Zymo Research) to conduct histone bound chromatin extraction, with minor adjustments to the manufacturer’s protocol. .. We prepared the Nuclei Prep Buffer according to the protocol and crushed the two anemones of each replicate together using a douncer for homogenization.

    Article Title: DNA methylation regulates transcriptional homeostasis of algal endosymbiosis in the coral model Aiptasia
    Article Snippet: Chromatin immunoprecipitation We used the Zymo-Spin ChIP Kit (Zymo Research) to conduct histone bound chromatin extraction, with minor adjustments to the manufacturer’s protocol. .. We prepared the Nuclei Prep Buffer according to the protocol and crushed the two anemones of each replicate together using a douncer for homogenization.

    Immunoprecipitation:

    Article Title: Activation of STAT3 signaling is mediated by TFF1 silencing in gastric neoplasia
    Article Snippet: ChIP assay was performed using the Zymo-Spin ChIP Kit (Irvine, California, USA) following the manufacturer’s protocol. .. Chromatin solutions were immunoprecipitated with STAT3 antibody from cell signaling at 4 °C overnight.

    Article Title: Helicobacter pylori-induced cell death is counteracted by NF-κB-mediated transcription of DARPP-32
    Article Snippet: Chromatin immunoprecipitation (ChIP) assay was performed using Zymo-Spin ChIP Kit (Irvine, California, USA) following the manufacturer’s protocol. .. Chromatin solutions were immunoprecipitated with P65 antibody at 4°C overnight.

    Article Title: Epigenetic Activation of ASCT2 in the Hippocampus Contributes to Depression-Like Behavior by Regulating D-Serine in Mice
    Article Snippet: Cell samples were treated using the Zymo-Spin™ ChIP Kit (ZymoResearch, Irvine, CA) according to the manufacturer's protocol and sonicated for 10 min (30 s, on; 30 s, off; 10 cycles). .. Cross-linked chromatin was immunoprecipitated with antibodies against acetylated chromatin: anti-H3K9 (ab10812; Abcam, Hong Kong, China), anti-H3K27 (ab3350; Abcam), and anti-H3k4 (#ABE223; Millipore); normal rabbit IgG-B (sc-2763; Santa Cruz Biotechnology, Dallas, TX) was used as a negative control antibody.

    DNA Purification:

    Article Title: Role for Chromatin Remodeling Factor Chd1 in Learning and Memory
    Article Snippet: Hippocampi from each mouse were processed separately for crosslinking and chromatin preparation using the Zymo-Spin ChIP Kit (Zymo Research) exactly following the manufacturer’s ChIP protocol for mouse tissue. .. Incubation of antibody and NA IP samples with magnetic beads, stringency washes and DNA purification was performed according to the Zymo-Spin ChIP Kit protocol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Zymo Research zymo spin chip kit
    Zymo Spin Chip Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/zymo spin chip kit/product/Zymo Research
    Average 95 stars, based on 43 article reviews
    Price from $9.99 to $1999.99
    zymo spin chip kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results