cmv gb  (Sino Biological)


Bioz Verified Symbol Sino Biological is a verified supplier
Bioz Manufacturer Symbol Sino Biological manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    Human cytomegalovirus gB Gene ORF cDNA clone expression plasmid C GFPSpark tag
    Description:
    Full length Clone DNA of Homo cytomegalovirus gB with C terminal GFPSpark tag
    Catalog Number:
    VG10202-ACG
    Price:
    425.0
    Category:
    cDNA Clone
    Applications:
    Stable or Transient mammalian expression
    Size:
    1Unit
    Molecule Name:
    gB,Glycoprotein B,CMV Glycoprotein B,
    Buy from Supplier


    Structured Review

    Sino Biological cmv gb
    Human cytomegalovirus gB Gene ORF cDNA clone expression plasmid C GFPSpark tag
    Full length Clone DNA of Homo cytomegalovirus gB with C terminal GFPSpark tag
    https://www.bioz.com/result/cmv gb/product/Sino Biological
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cmv gb - by Bioz Stars, 2021-05
    93/100 stars

    Images

    Related Articles

    Magnetic Beads:

    Article Title: Genetic markers of immunoglobulin G and immunity to cytomegalovirus in patients with breast cancer
    Article Snippet: .. CMV gB (Sino Biological) was coupled to Pierce™ NHS-activated magnetic beads according to the manufacturer’s protocol. ..

    Generated:

    Article Title: The Bacterial and Viral Complexity of Postinfectious Hydrocephalus in Uganda
    Article Snippet: The reverse primer gB4 was modified to 5’- GGTGGTTGCCCAACAGGATT3’ due to off target human amplification and Quantitect SybrGreen Mastermix (Qiagen, USA) was used following manufacturers protocol for 10 μL reaction volumes and 2 μL DNA input with PCR and cycling conditions recommended by (87). .. A standard curve was generated from 10 million to 1 million copies using a full length clone DNA of Homo cytomegalovirus gB (Sino Biologicals, Beijing, China) (88, 89). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Sino Biological cmv gb
    Cmv Gb, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cmv gb/product/Sino Biological
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cmv gb - by Bioz Stars, 2021-05
    93/100 stars
      Buy from Supplier

    Image Search Results