dna elution buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    Monarch DNA Elution Buffer
    Description:
    Monarch DNA Elution Buffer 25 ml
    Catalog Number:
    t1016l
    Price:
    35
    Size:
    25 ml
    Category:
    Plasmid Purification Kit Components
    Buy from Supplier


    Structured Review

    New England Biolabs dna elution buffer
    Monarch DNA Elution Buffer
    Monarch DNA Elution Buffer 25 ml
    https://www.bioz.com/result/dna elution buffer/product/New England Biolabs
    Average 93 stars, based on 54 article reviews
    Price from $9.99 to $1999.99
    dna elution buffer - by Bioz Stars, 2021-02
    93/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Pseudouridine profiling reveals regulated mRNA pseudouridylation in yeast and human cells
    Article Snippet: .. Truncated cDNAs were size selected and purified on an 8% urea-TBE PAGE gel, followed by precipitation. cDNAs were eluted from gel slices overnight at room temperature with gentle rocking in 400 μl DNA Elution Buffer (300 mM NaCl, 10 mM Tris, pH 8.0). cDNAs were circularized with circLigase (Epicentre; CL4115K), and amplified by PCR with Phusion (NEB; M0530) with the forward primer (IDT; AATGATACGGCGACCACCGA), and a barcoded reverse primer (IDT; CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA). .. PCR products were gel purified, precipitated, and sequenced on an Illumina HiSeq 2000.

    Article Title: A Unique Epigenomic Landscape Defines Human Erythropoiesis
    Article Snippet: .. Adenylation was performed in 32 μL of DNA solution in elution buffer, 15U Klenow fragment and 10 μL of dATP at 1mM in Klenow buffer added (All reagents, New England Biolabs) for total reaction volume of 50 μl, with incubation at 37°C for 30 min. DNA was purified using MinElute PCR columns per manufacturer’s instructions (QIAGEN) into 10 μL of elution buffer. .. Adaptor ligation was performed in a total volume of 50 μL, 2000U T4 DNA ligase (New England Biolabs) and the Methylated Illumina adapters at a final concentration of 1.2mM with incubation for 16 h at 16°C.

    Incubation:

    Article Title: A Unique Epigenomic Landscape Defines Human Erythropoiesis
    Article Snippet: .. Adenylation was performed in 32 μL of DNA solution in elution buffer, 15U Klenow fragment and 10 μL of dATP at 1mM in Klenow buffer added (All reagents, New England Biolabs) for total reaction volume of 50 μl, with incubation at 37°C for 30 min. DNA was purified using MinElute PCR columns per manufacturer’s instructions (QIAGEN) into 10 μL of elution buffer. .. Adaptor ligation was performed in a total volume of 50 μL, 2000U T4 DNA ligase (New England Biolabs) and the Methylated Illumina adapters at a final concentration of 1.2mM with incubation for 16 h at 16°C.

    Amplification:

    Article Title: Pseudouridine profiling reveals regulated mRNA pseudouridylation in yeast and human cells
    Article Snippet: .. Truncated cDNAs were size selected and purified on an 8% urea-TBE PAGE gel, followed by precipitation. cDNAs were eluted from gel slices overnight at room temperature with gentle rocking in 400 μl DNA Elution Buffer (300 mM NaCl, 10 mM Tris, pH 8.0). cDNAs were circularized with circLigase (Epicentre; CL4115K), and amplified by PCR with Phusion (NEB; M0530) with the forward primer (IDT; AATGATACGGCGACCACCGA), and a barcoded reverse primer (IDT; CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA). .. PCR products were gel purified, precipitated, and sequenced on an Illumina HiSeq 2000.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Pseudouridine profiling reveals regulated mRNA pseudouridylation in yeast and human cells
    Article Snippet: .. Truncated cDNAs were size selected and purified on an 8% urea-TBE PAGE gel, followed by precipitation. cDNAs were eluted from gel slices overnight at room temperature with gentle rocking in 400 μl DNA Elution Buffer (300 mM NaCl, 10 mM Tris, pH 8.0). cDNAs were circularized with circLigase (Epicentre; CL4115K), and amplified by PCR with Phusion (NEB; M0530) with the forward primer (IDT; AATGATACGGCGACCACCGA), and a barcoded reverse primer (IDT; CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA). .. PCR products were gel purified, precipitated, and sequenced on an Illumina HiSeq 2000.

    Purification:

    Article Title: The receptor PTPRU is a redox sensitive pseudophosphatase
    Article Snippet: .. Beads were collected using a magnetic stand and washed 3 times in ice-cold purification buffer, followed by two washes with ice-cold 150 mM NaCl wash buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 10% [v/v] glycerol, 1% [v/v] Triton X-100, 1 mM EDTA). ..

    Article Title: Pseudouridine profiling reveals regulated mRNA pseudouridylation in yeast and human cells
    Article Snippet: .. Truncated cDNAs were size selected and purified on an 8% urea-TBE PAGE gel, followed by precipitation. cDNAs were eluted from gel slices overnight at room temperature with gentle rocking in 400 μl DNA Elution Buffer (300 mM NaCl, 10 mM Tris, pH 8.0). cDNAs were circularized with circLigase (Epicentre; CL4115K), and amplified by PCR with Phusion (NEB; M0530) with the forward primer (IDT; AATGATACGGCGACCACCGA), and a barcoded reverse primer (IDT; CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA). .. PCR products were gel purified, precipitated, and sequenced on an Illumina HiSeq 2000.

    Article Title: A Unique Epigenomic Landscape Defines Human Erythropoiesis
    Article Snippet: .. Adenylation was performed in 32 μL of DNA solution in elution buffer, 15U Klenow fragment and 10 μL of dATP at 1mM in Klenow buffer added (All reagents, New England Biolabs) for total reaction volume of 50 μl, with incubation at 37°C for 30 min. DNA was purified using MinElute PCR columns per manufacturer’s instructions (QIAGEN) into 10 μL of elution buffer. .. Adaptor ligation was performed in a total volume of 50 μL, 2000U T4 DNA ligase (New England Biolabs) and the Methylated Illumina adapters at a final concentration of 1.2mM with incubation for 16 h at 16°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs dna elution buffer
    Dna Elution Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna elution buffer/product/New England Biolabs
    Average 93 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    dna elution buffer - by Bioz Stars, 2021-02
    93/100 stars
      Buy from Supplier

    Image Search Results