gst pull down  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs gst pull down
    Gst Pull Down, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gst pull down/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gst pull down - by Bioz Stars, 2023-01
    94/100 stars

    Images

    gst pull down  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs gst pull down
    Gst Pull Down, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gst pull down/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gst pull down - by Bioz Stars, 2023-01
    94/100 stars

    Images

    bg conjugated agarose resin  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs bg conjugated agarose resin
    Bg Conjugated Agarose Resin, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bg conjugated agarose resin/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bg conjugated agarose resin - by Bioz Stars, 2023-01
    94/100 stars

    Images

    maltose resin  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs maltose resin
    Maltose Resin, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maltose resin/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    maltose resin - by Bioz Stars, 2023-01
    94/100 stars

    Images

    amylase resin  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs amylase resin
    Amylase Resin, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amylase resin/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    amylase resin - by Bioz Stars, 2023-01
    94/100 stars

    Images

    dra  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs dra
    Primer sequences used for the nested PCR and restriction enzymes used for the RLFP
    Dra, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dra/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dra - by Bioz Stars, 2023-01
    94/100 stars

    Images

    1) Product Images from "Prevalence and factors associated with carriage of Pfmdr1 polymorphisms among pregnant women receiving intermittent preventive treatment with sulfadoxine-pyrimethamine (IPTp-SP) and artemether-lumefantrine for malaria treatment in Burkina Faso"

    Article Title: Prevalence and factors associated with carriage of Pfmdr1 polymorphisms among pregnant women receiving intermittent preventive treatment with sulfadoxine-pyrimethamine (IPTp-SP) and artemether-lumefantrine for malaria treatment in Burkina Faso

    Journal: Malaria Journal

    doi: 10.1186/s12936-020-03473-5

    Primer sequences used for the nested PCR and restriction enzymes used for the RLFP
    Figure Legend Snippet: Primer sequences used for the nested PCR and restriction enzymes used for the RLFP

    Techniques Used: Nested PCR, Sequencing

    dna protein pull  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs dna protein pull
    Dna Protein Pull, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna protein pull/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dna protein pull - by Bioz Stars, 2023-01
    94/100 stars

    Images

    maltose resin  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs maltose resin
    Maltose Resin, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maltose resin/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    maltose resin - by Bioz Stars, 2023-01
    94/100 stars

    Images

    glutathione resin column  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs glutathione resin column
    Glutathione Resin Column, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glutathione resin column/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    glutathione resin column - by Bioz Stars, 2023-01
    94/100 stars

    Images

    dra  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs dra
    Loss of Cdc5 from CEN correlates with the reduction in CEN -associated Cse4 and defects in structural integrity of kinetochores. (A) Expression of Cdc5 is not affected in cdc5-99 mutant grown at the nonpermissive <t>temperature</t> <t>(37°C).</t> Wild-type (YMB9431) and cdc5-99 (YMB9432) were grown to logarithmic phase at 25°C and shifted to the nonpermissive temperature (37°C) for 2.5 h. Whole cell extracts were prepared and Western blots were done using α-Cdc5 and α-Tub2 (loading control) antibodies. (B) Cdc5-99 does not associate with CEN at the nonpermissive temperature (37°C) in cdc5-99 strain. ChIP was performed in strains as described in A using α-Cdc5 antibodies. Enrichment of Cdc5 at CEN1 , CEN3 , CEN5 , and a negative control (6K120) was determined by qPCR and is presented as the percentage of input. The average from three biological replicates ± SE is shown. **, p value < 0.01; ns = statistically not significant; Student’s t test. (C) Cdc5 regulates the levels of Cse4 at the CEN . Wild-type (YMB9383) and cdc5-99 (YMB9175) were grown in YPD to logarithmic phase at 25°C and shifted to the nonpermissive temperature (37°C) for 6 h. ChIP for HA-tagged Cse4 was performed using α-HA agarose antibodies. Enrichment of Cse4 at CEN1 , CEN3 , CEN5 , and a negative control ( HML ) was determined by qPCR and is presented as the percentage of input. The average from three biological replicates ± SE is shown. *, p value < 0.05; ns = statistically not significant; Student’s t test. (D) Cdc5 is required for the structural integrity of kinetochores. Wild-type (KBY2012) and cdc5-99 (YMB9367) were grown in YPD to logarithmic phase at 25°C and shifted to nonpermissive temperature (37°C) for 6 h. Nuclei were extracted and incubated with 100 units of <t>Dra</t> I restriction endonuclease at 37°C for 30 min as described in Materials and Methods . Dra I accessibility at CEN3 and ADP1 (control) chromatin is shown. The average from three biological experiments ± SE is shown. *, p value < 0.05; ns = statistically not significant; Student’s t test. Right inset: schematic modified from our previous study ( Mishra et al. , 2013 ) for CEN3 and ADP1 regions examined for Dra I accessibility.
    Dra, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dra/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dra - by Bioz Stars, 2023-01
    94/100 stars

    Images

    1) Product Images from "Cell cycle–dependent association of polo kinase Cdc5 with CENP-A contributes to faithful chromosome segregation in budding yeast"

    Article Title: Cell cycle–dependent association of polo kinase Cdc5 with CENP-A contributes to faithful chromosome segregation in budding yeast

    Journal: Molecular Biology of the Cell

    doi: 10.1091/mbc.E18-09-0584

    Loss of Cdc5 from CEN correlates with the reduction in CEN -associated Cse4 and defects in structural integrity of kinetochores. (A) Expression of Cdc5 is not affected in cdc5-99 mutant grown at the nonpermissive temperature (37°C). Wild-type (YMB9431) and cdc5-99 (YMB9432) were grown to logarithmic phase at 25°C and shifted to the nonpermissive temperature (37°C) for 2.5 h. Whole cell extracts were prepared and Western blots were done using α-Cdc5 and α-Tub2 (loading control) antibodies. (B) Cdc5-99 does not associate with CEN at the nonpermissive temperature (37°C) in cdc5-99 strain. ChIP was performed in strains as described in A using α-Cdc5 antibodies. Enrichment of Cdc5 at CEN1 , CEN3 , CEN5 , and a negative control (6K120) was determined by qPCR and is presented as the percentage of input. The average from three biological replicates ± SE is shown. **, p value < 0.01; ns = statistically not significant; Student’s t test. (C) Cdc5 regulates the levels of Cse4 at the CEN . Wild-type (YMB9383) and cdc5-99 (YMB9175) were grown in YPD to logarithmic phase at 25°C and shifted to the nonpermissive temperature (37°C) for 6 h. ChIP for HA-tagged Cse4 was performed using α-HA agarose antibodies. Enrichment of Cse4 at CEN1 , CEN3 , CEN5 , and a negative control ( HML ) was determined by qPCR and is presented as the percentage of input. The average from three biological replicates ± SE is shown. *, p value < 0.05; ns = statistically not significant; Student’s t test. (D) Cdc5 is required for the structural integrity of kinetochores. Wild-type (KBY2012) and cdc5-99 (YMB9367) were grown in YPD to logarithmic phase at 25°C and shifted to nonpermissive temperature (37°C) for 6 h. Nuclei were extracted and incubated with 100 units of Dra I restriction endonuclease at 37°C for 30 min as described in Materials and Methods . Dra I accessibility at CEN3 and ADP1 (control) chromatin is shown. The average from three biological experiments ± SE is shown. *, p value < 0.05; ns = statistically not significant; Student’s t test. Right inset: schematic modified from our previous study ( Mishra et al. , 2013 ) for CEN3 and ADP1 regions examined for Dra I accessibility.
    Figure Legend Snippet: Loss of Cdc5 from CEN correlates with the reduction in CEN -associated Cse4 and defects in structural integrity of kinetochores. (A) Expression of Cdc5 is not affected in cdc5-99 mutant grown at the nonpermissive temperature (37°C). Wild-type (YMB9431) and cdc5-99 (YMB9432) were grown to logarithmic phase at 25°C and shifted to the nonpermissive temperature (37°C) for 2.5 h. Whole cell extracts were prepared and Western blots were done using α-Cdc5 and α-Tub2 (loading control) antibodies. (B) Cdc5-99 does not associate with CEN at the nonpermissive temperature (37°C) in cdc5-99 strain. ChIP was performed in strains as described in A using α-Cdc5 antibodies. Enrichment of Cdc5 at CEN1 , CEN3 , CEN5 , and a negative control (6K120) was determined by qPCR and is presented as the percentage of input. The average from three biological replicates ± SE is shown. **, p value < 0.01; ns = statistically not significant; Student’s t test. (C) Cdc5 regulates the levels of Cse4 at the CEN . Wild-type (YMB9383) and cdc5-99 (YMB9175) were grown in YPD to logarithmic phase at 25°C and shifted to the nonpermissive temperature (37°C) for 6 h. ChIP for HA-tagged Cse4 was performed using α-HA agarose antibodies. Enrichment of Cse4 at CEN1 , CEN3 , CEN5 , and a negative control ( HML ) was determined by qPCR and is presented as the percentage of input. The average from three biological replicates ± SE is shown. *, p value < 0.05; ns = statistically not significant; Student’s t test. (D) Cdc5 is required for the structural integrity of kinetochores. Wild-type (KBY2012) and cdc5-99 (YMB9367) were grown in YPD to logarithmic phase at 25°C and shifted to nonpermissive temperature (37°C) for 6 h. Nuclei were extracted and incubated with 100 units of Dra I restriction endonuclease at 37°C for 30 min as described in Materials and Methods . Dra I accessibility at CEN3 and ADP1 (control) chromatin is shown. The average from three biological experiments ± SE is shown. *, p value < 0.05; ns = statistically not significant; Student’s t test. Right inset: schematic modified from our previous study ( Mishra et al. , 2013 ) for CEN3 and ADP1 regions examined for Dra I accessibility.

    Techniques Used: Expressing, Mutagenesis, Western Blot, Negative Control, Incubation, Modification

    resin column  (New England Biolabs)


    Bioz Verified Symbol New England Biolabs is a verified supplier
    Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs resin column
    Resin Column, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/resin column/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    resin column - by Bioz Stars, 2023-01
    94/100 stars

    Images

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    New England Biolabs gst pull down
    Gst Pull Down, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gst pull down/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gst pull down - by Bioz Stars, 2023-01
    94/100 stars
      Buy from Supplier

    94
    New England Biolabs bg conjugated agarose resin
    Bg Conjugated Agarose Resin, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bg conjugated agarose resin/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bg conjugated agarose resin - by Bioz Stars, 2023-01
    94/100 stars
      Buy from Supplier

    94
    New England Biolabs maltose resin
    Maltose Resin, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maltose resin/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    maltose resin - by Bioz Stars, 2023-01
    94/100 stars
      Buy from Supplier

    94
    New England Biolabs amylase resin
    Amylase Resin, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amylase resin/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    amylase resin - by Bioz Stars, 2023-01
    94/100 stars
      Buy from Supplier

    94
    New England Biolabs dra
    Primer sequences used for the nested PCR and restriction enzymes used for the RLFP
    Dra, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dra/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dra - by Bioz Stars, 2023-01
    94/100 stars
      Buy from Supplier

    94
    New England Biolabs dna protein pull
    Primer sequences used for the nested PCR and restriction enzymes used for the RLFP
    Dna Protein Pull, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna protein pull/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dna protein pull - by Bioz Stars, 2023-01
    94/100 stars
      Buy from Supplier

    94
    New England Biolabs glutathione resin column
    Primer sequences used for the nested PCR and restriction enzymes used for the RLFP
    Glutathione Resin Column, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glutathione resin column/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    glutathione resin column - by Bioz Stars, 2023-01
    94/100 stars
      Buy from Supplier

    94
    New England Biolabs resin column
    Primer sequences used for the nested PCR and restriction enzymes used for the RLFP
    Resin Column, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/resin column/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    resin column - by Bioz Stars, 2023-01
    94/100 stars
      Buy from Supplier

    Image Search Results


    Primer sequences used for the nested PCR and restriction enzymes used for the RLFP

    Journal: Malaria Journal

    Article Title: Prevalence and factors associated with carriage of Pfmdr1 polymorphisms among pregnant women receiving intermittent preventive treatment with sulfadoxine-pyrimethamine (IPTp-SP) and artemether-lumefantrine for malaria treatment in Burkina Faso

    doi: 10.1186/s12936-020-03473-5

    Figure Lengend Snippet: Primer sequences used for the nested PCR and restriction enzymes used for the RLFP

    Article Snippet: Nested1 forward Pfmdr1 184 (MDR-A1) , TGTTGAAAGATGGGTAAAGAGCAGAAAGAG , , Dra I (NEB).

    Techniques: Nested PCR, Sequencing