rna cap structure analog  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    G 5 ppp 5 RNA Cap Structure Analog
    Description:
    G 5 ppp 5 RNA Cap Structure Analog 5 umol
    Catalog Number:
    s1407l
    Price:
    487
    Size:
    5 umol
    Category:
    Capping Reagents for DNA RNA Synthesis
    Buy from Supplier


    Structured Review

    New England Biolabs rna cap structure analog
    G 5 ppp 5 RNA Cap Structure Analog
    G 5 ppp 5 RNA Cap Structure Analog 5 umol
    https://www.bioz.com/result/rna cap structure analog/product/New England Biolabs
    Average 93 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    rna cap structure analog - by Bioz Stars, 2020-07
    93/100 stars

    Images

    1) Product Images from "The PBDE metabolite 6-OH-BDE 47 affects melanin pigmentation and THRβ MRNA expression in the eye of zebrafish embryos"

    Article Title: The PBDE metabolite 6-OH-BDE 47 affects melanin pigmentation and THRβ MRNA expression in the eye of zebrafish embryos

    Journal: Endocrine disruptors (Austin, Tex.)

    doi: 10.4161/23273739.2014.969072

    Effect of T3 on THRβ mRNA expression in the periventricular zone of zebrafish embryonic brain. Embryos were exposed from 4- to 22- hpf to T3. Note the prominent blue coloration in control, ( A ) localized to fore- and midbrain regions (red arrow). By comparison, panels B,C and E show less blue coloration (red arrows) upon exposure to a range of T3 from 0.1 nM to 100 nM. The average intensity of THRβ expression recorded in brain at 22 somite stage showed dose dependent reduction (histogram, E ). ( F ) Bar chart of THRβ expression based on quantitative PCR (qRT-PCR, total RNA from whole embryos) at 22 somite stage. The 10 and 100 nM T3 was significantly different from the control (*, P
    Figure Legend Snippet: Effect of T3 on THRβ mRNA expression in the periventricular zone of zebrafish embryonic brain. Embryos were exposed from 4- to 22- hpf to T3. Note the prominent blue coloration in control, ( A ) localized to fore- and midbrain regions (red arrow). By comparison, panels B,C and E show less blue coloration (red arrows) upon exposure to a range of T3 from 0.1 nM to 100 nM. The average intensity of THRβ expression recorded in brain at 22 somite stage showed dose dependent reduction (histogram, E ). ( F ) Bar chart of THRβ expression based on quantitative PCR (qRT-PCR, total RNA from whole embryos) at 22 somite stage. The 10 and 100 nM T3 was significantly different from the control (*, P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    Related Articles

    Sequencing:

    Article Title: RNA Cap Methyltransferase Activity Assay
    Article Snippet: .. Polyethylenimine (PEI) cellulose TLC plates (Macherey-Nagel, catalog number: 801053; see Note ) Immobilon-FL polyvinylidene difluoride (PVDF) membrane (Merck, catalog number: IPFL00010) Scintillation vials compatible with liquid scintillation counter ( e.g ., DWK Life Sciences, WHEATON, catalog number: 225414) U2OS cells (ATCC, catalog number: HTB-96) or HEK293 cells (ATCC, catalog number: CRL-1573) P1 nuclease (United States Biological, catalog number: N7000), resuspended in RNase-free water to 0.625 U/μl Cap analog GpppG (New England Biolabs, catalog number: S1407), resuspended in RNase-free water to 10 mM Cap analog m7 GpppG (New England Biolabs, catalog number: S1404), resuspended in RNase-free water to 10 mM RNase-free water ( e.g. , from a Millipore Synergy water purification system, 18.2 MΩ cm) Single-stranded DNA sense oligo Single-stranded DNA antisense oligo 5′ CATGCA AATTAACCCTCACTAAA GGGAGA CCGGAATTCGAGCTCGCCCGGGGATC 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by Integrated DNA Technologies (IDT); underlined is a T3 promoter sequence, bold sequence matches the transcribed 32-nucleotide (nt) pppRNA) 5′ GATCCCCGGGCGAGCTCGAATTCCGGTCTCCCTTTAGTGAGGGTTAATTTGCATG 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by IDT) MEGAscript T3 Transcription Kit (Thermo Fisher Scientific, Ambion, catalog number: AM1138) Pre-cast polyacrylamide mini-gels for urea polyacrylamide gel electrophoresis (urea-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4566053) Pre-cast polyacrylamide mini-gels for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4568094) 2× Laemmli Sample Buffer (Bio-Rad Laboratories, catalog number: 1610737) SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, Invitrogen™, catalog number: S11494) RNA size marker ( e.g. , Thermo Fisher Scientific, Invitrogen™, catalog number: AM7778) 2× RNA loading dye ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: R0641) 40 U/μl RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific, Invitrogen™, catalog number: 10777019) Recombinant triphosphatase-guanylyltransferase capping enzyme (see Note ) [α-32 P]GTP (3,000 Ci/mmol, PerkinElmer, catalog number: BLU506H250UC) RNA Clean & Concentrator-5 kit (Zymo Research, catalog number: R1016) ScintiSafe Econo 1 scintillation fluid (Fisher Scientific, catalog number: SX20-5) Note: This product has been discontinued. .. Eye protection NanoDrop spectrophotometer (Thermo Fisher, model: NanoDrop™ 1000, catalog number: ND-1000) Lucite/Plexiglass acrylic benchtop shielding for handling 32 P ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: 6700-2418) Geiger counter Metric (centimeter) ruler Scissors ( e.g. , Westcott, catalog number: ) Graphite pencil Long (at least 18 cm) forceps or tongs ( e.g. , Fisher Scientific, catalog number: 15-186) P10, P20, P100, and P1000 pipets Thermal cycler ( e.g. , MJ Research, model: PTC-200) Heating block ( e.g. , Bioer, model: MB 101) −80 °C freezer Handheld 254 nm UV light ( e.g. , UVP, model: 95-0016-14) Liquid scintillation counter ( e.g. , Beckman Coulter, model: LS 6000IC) Water-jacketed incubator ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, model: Forma® Series II) set to 37 °C with 5% CO2 Refrigerated centrifuge (Eppendorf, model: 5415 R) Programmable rotator-mixer (Grant Instruments, model: PTR-30) at 4 °C and set to 10 rpm orbital rotation UV-vis spectrophotometer ( e.g. , Beckman Coulter, model: DU 640) set to 595 nm Electrophoresis system for PAGE and membrane transfer ( e.g. , Bio-Rad Laboratories, catalog number: 1660828EDU) Opaque western blot incubation boxes ( e.g. , LI-COR, catalog number: 929-97205) Western blot imaging system ( e.g. , LI-COR, model: Odyssey Imaging Systems) Rectangular glass TLC chamber ( e.g. , Miles Scientific, model: A70-22, formerly Analtech) Electric hair dryer (optional) Storage phosphor screen ( e.g. , GE/Amersham Biosciences) Light eraser for storage phosphor screen ( e.g. , Molecular Dynamics Image Eraser) Typhoon imaging system ( e.g. , GE Healthcare, Amersham Biosciences, model: Typhoon 9200)

    In Vitro:

    Article Title: Structure of human IFIT1 with capped RNA reveals adaptable mRNA binding and mechanisms for sensing N1 and N2 ribose 2′-O methylations
    Article Snippet: .. In vitro transcriptions were performed with SP6 RNA polymerase in the presence of m7G(5′)ppp(5′)G, G(5′)ppp(5′)G or A(5′)ppp(5′)G RNA Cap Analog (New England Biolabs). .. N1 and N2 methylations were performed post transcriptionally using mRNA Cap1 2′-O-Methyltransferase (New England Biolabs) or purified TbMTr2.

    Article Title: Drosophila Xpd Regulates Cdk7 Localization, Mitotic Kinase Activity, Spindle Dynamics, and Chromosome Segregation
    Article Snippet: .. 1 µg of these DNA templates were used for in vitro transcription with an Ampliscribe T3 High Yield Transcription Kit (Epicentre Biotechnologies, Madison, WI), using an RNA Cap Structure analog from New England Biolabs (Ipswich, MA). .. This was followed by a DNaseI (Epicentre Biotech.) digest.

    Article Title: Poly(A)-Binding Protein Facilitates Translation of an Uncapped/Nonpolyadenylated Viral RNA by Binding to the 3? Untranslated Region
    Article Snippet: .. Other RNA transcripts were synthesized in vitro from XmaI-linearized plasmids with T7 RNA polymerase in the presence or absence of ApppG cap structure analog (New England Biolabs). ..

    Synthesized:

    Article Title: RNA Cap Methyltransferase Activity Assay
    Article Snippet: .. Polyethylenimine (PEI) cellulose TLC plates (Macherey-Nagel, catalog number: 801053; see Note ) Immobilon-FL polyvinylidene difluoride (PVDF) membrane (Merck, catalog number: IPFL00010) Scintillation vials compatible with liquid scintillation counter ( e.g ., DWK Life Sciences, WHEATON, catalog number: 225414) U2OS cells (ATCC, catalog number: HTB-96) or HEK293 cells (ATCC, catalog number: CRL-1573) P1 nuclease (United States Biological, catalog number: N7000), resuspended in RNase-free water to 0.625 U/μl Cap analog GpppG (New England Biolabs, catalog number: S1407), resuspended in RNase-free water to 10 mM Cap analog m7 GpppG (New England Biolabs, catalog number: S1404), resuspended in RNase-free water to 10 mM RNase-free water ( e.g. , from a Millipore Synergy water purification system, 18.2 MΩ cm) Single-stranded DNA sense oligo Single-stranded DNA antisense oligo 5′ CATGCA AATTAACCCTCACTAAA GGGAGA CCGGAATTCGAGCTCGCCCGGGGATC 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by Integrated DNA Technologies (IDT); underlined is a T3 promoter sequence, bold sequence matches the transcribed 32-nucleotide (nt) pppRNA) 5′ GATCCCCGGGCGAGCTCGAATTCCGGTCTCCCTTTAGTGAGGGTTAATTTGCATG 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by IDT) MEGAscript T3 Transcription Kit (Thermo Fisher Scientific, Ambion, catalog number: AM1138) Pre-cast polyacrylamide mini-gels for urea polyacrylamide gel electrophoresis (urea-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4566053) Pre-cast polyacrylamide mini-gels for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4568094) 2× Laemmli Sample Buffer (Bio-Rad Laboratories, catalog number: 1610737) SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, Invitrogen™, catalog number: S11494) RNA size marker ( e.g. , Thermo Fisher Scientific, Invitrogen™, catalog number: AM7778) 2× RNA loading dye ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: R0641) 40 U/μl RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific, Invitrogen™, catalog number: 10777019) Recombinant triphosphatase-guanylyltransferase capping enzyme (see Note ) [α-32 P]GTP (3,000 Ci/mmol, PerkinElmer, catalog number: BLU506H250UC) RNA Clean & Concentrator-5 kit (Zymo Research, catalog number: R1016) ScintiSafe Econo 1 scintillation fluid (Fisher Scientific, catalog number: SX20-5) Note: This product has been discontinued. .. Eye protection NanoDrop spectrophotometer (Thermo Fisher, model: NanoDrop™ 1000, catalog number: ND-1000) Lucite/Plexiglass acrylic benchtop shielding for handling 32 P ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: 6700-2418) Geiger counter Metric (centimeter) ruler Scissors ( e.g. , Westcott, catalog number: ) Graphite pencil Long (at least 18 cm) forceps or tongs ( e.g. , Fisher Scientific, catalog number: 15-186) P10, P20, P100, and P1000 pipets Thermal cycler ( e.g. , MJ Research, model: PTC-200) Heating block ( e.g. , Bioer, model: MB 101) −80 °C freezer Handheld 254 nm UV light ( e.g. , UVP, model: 95-0016-14) Liquid scintillation counter ( e.g. , Beckman Coulter, model: LS 6000IC) Water-jacketed incubator ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, model: Forma® Series II) set to 37 °C with 5% CO2 Refrigerated centrifuge (Eppendorf, model: 5415 R) Programmable rotator-mixer (Grant Instruments, model: PTR-30) at 4 °C and set to 10 rpm orbital rotation UV-vis spectrophotometer ( e.g. , Beckman Coulter, model: DU 640) set to 595 nm Electrophoresis system for PAGE and membrane transfer ( e.g. , Bio-Rad Laboratories, catalog number: 1660828EDU) Opaque western blot incubation boxes ( e.g. , LI-COR, catalog number: 929-97205) Western blot imaging system ( e.g. , LI-COR, model: Odyssey Imaging Systems) Rectangular glass TLC chamber ( e.g. , Miles Scientific, model: A70-22, formerly Analtech) Electric hair dryer (optional) Storage phosphor screen ( e.g. , GE/Amersham Biosciences) Light eraser for storage phosphor screen ( e.g. , Molecular Dynamics Image Eraser) Typhoon imaging system ( e.g. , GE Healthcare, Amersham Biosciences, model: Typhoon 9200)

    Article Title: Poly(A)-Binding Protein Facilitates Translation of an Uncapped/Nonpolyadenylated Viral RNA by Binding to the 3? Untranslated Region
    Article Snippet: .. Other RNA transcripts were synthesized in vitro from XmaI-linearized plasmids with T7 RNA polymerase in the presence or absence of ApppG cap structure analog (New England Biolabs). ..

    Article Title: The PBDE metabolite 6-OH-BDE 47 affects melanin pigmentation and THRβ MRNA expression in the eye of zebrafish embryos
    Article Snippet: .. THRβ mRNA was synthesized with SP6 polymerase and capped using a G(5’)ppp(5’)A RNA cap structure analog (New England Biolabs). .. Injection mRNA concentration was ~265 ng/uL.

    Purification:

    Article Title: RNA Cap Methyltransferase Activity Assay
    Article Snippet: .. Polyethylenimine (PEI) cellulose TLC plates (Macherey-Nagel, catalog number: 801053; see Note ) Immobilon-FL polyvinylidene difluoride (PVDF) membrane (Merck, catalog number: IPFL00010) Scintillation vials compatible with liquid scintillation counter ( e.g ., DWK Life Sciences, WHEATON, catalog number: 225414) U2OS cells (ATCC, catalog number: HTB-96) or HEK293 cells (ATCC, catalog number: CRL-1573) P1 nuclease (United States Biological, catalog number: N7000), resuspended in RNase-free water to 0.625 U/μl Cap analog GpppG (New England Biolabs, catalog number: S1407), resuspended in RNase-free water to 10 mM Cap analog m7 GpppG (New England Biolabs, catalog number: S1404), resuspended in RNase-free water to 10 mM RNase-free water ( e.g. , from a Millipore Synergy water purification system, 18.2 MΩ cm) Single-stranded DNA sense oligo Single-stranded DNA antisense oligo 5′ CATGCA AATTAACCCTCACTAAA GGGAGA CCGGAATTCGAGCTCGCCCGGGGATC 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by Integrated DNA Technologies (IDT); underlined is a T3 promoter sequence, bold sequence matches the transcribed 32-nucleotide (nt) pppRNA) 5′ GATCCCCGGGCGAGCTCGAATTCCGGTCTCCCTTTAGTGAGGGTTAATTTGCATG 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by IDT) MEGAscript T3 Transcription Kit (Thermo Fisher Scientific, Ambion, catalog number: AM1138) Pre-cast polyacrylamide mini-gels for urea polyacrylamide gel electrophoresis (urea-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4566053) Pre-cast polyacrylamide mini-gels for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4568094) 2× Laemmli Sample Buffer (Bio-Rad Laboratories, catalog number: 1610737) SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, Invitrogen™, catalog number: S11494) RNA size marker ( e.g. , Thermo Fisher Scientific, Invitrogen™, catalog number: AM7778) 2× RNA loading dye ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: R0641) 40 U/μl RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific, Invitrogen™, catalog number: 10777019) Recombinant triphosphatase-guanylyltransferase capping enzyme (see Note ) [α-32 P]GTP (3,000 Ci/mmol, PerkinElmer, catalog number: BLU506H250UC) RNA Clean & Concentrator-5 kit (Zymo Research, catalog number: R1016) ScintiSafe Econo 1 scintillation fluid (Fisher Scientific, catalog number: SX20-5) Note: This product has been discontinued. .. Eye protection NanoDrop spectrophotometer (Thermo Fisher, model: NanoDrop™ 1000, catalog number: ND-1000) Lucite/Plexiglass acrylic benchtop shielding for handling 32 P ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: 6700-2418) Geiger counter Metric (centimeter) ruler Scissors ( e.g. , Westcott, catalog number: ) Graphite pencil Long (at least 18 cm) forceps or tongs ( e.g. , Fisher Scientific, catalog number: 15-186) P10, P20, P100, and P1000 pipets Thermal cycler ( e.g. , MJ Research, model: PTC-200) Heating block ( e.g. , Bioer, model: MB 101) −80 °C freezer Handheld 254 nm UV light ( e.g. , UVP, model: 95-0016-14) Liquid scintillation counter ( e.g. , Beckman Coulter, model: LS 6000IC) Water-jacketed incubator ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, model: Forma® Series II) set to 37 °C with 5% CO2 Refrigerated centrifuge (Eppendorf, model: 5415 R) Programmable rotator-mixer (Grant Instruments, model: PTR-30) at 4 °C and set to 10 rpm orbital rotation UV-vis spectrophotometer ( e.g. , Beckman Coulter, model: DU 640) set to 595 nm Electrophoresis system for PAGE and membrane transfer ( e.g. , Bio-Rad Laboratories, catalog number: 1660828EDU) Opaque western blot incubation boxes ( e.g. , LI-COR, catalog number: 929-97205) Western blot imaging system ( e.g. , LI-COR, model: Odyssey Imaging Systems) Rectangular glass TLC chamber ( e.g. , Miles Scientific, model: A70-22, formerly Analtech) Electric hair dryer (optional) Storage phosphor screen ( e.g. , GE/Amersham Biosciences) Light eraser for storage phosphor screen ( e.g. , Molecular Dynamics Image Eraser) Typhoon imaging system ( e.g. , GE Healthcare, Amersham Biosciences, model: Typhoon 9200)

    Concentration Assay:

    Article Title: The insulin receptor cellular IRES confers resistance to eIF4A inhibition
    Article Snippet: .. For assays containing excess m7G cap, cap structure analogue (New England Biolabs, #S1407S) was added to a final concentration of 1 mM. .. Cell culture, total RNA extraction, and RT-qPCR Drosophila S2 cells with a stable transfection of constitutively active Foxo under the control of the metallothionein A promoter were maintained in Schneider’s Insect Media supplemented with 10% fetal bovine serum ( ).

    Thin Layer Chromatography:

    Article Title: RNA Cap Methyltransferase Activity Assay
    Article Snippet: .. Polyethylenimine (PEI) cellulose TLC plates (Macherey-Nagel, catalog number: 801053; see Note ) Immobilon-FL polyvinylidene difluoride (PVDF) membrane (Merck, catalog number: IPFL00010) Scintillation vials compatible with liquid scintillation counter ( e.g ., DWK Life Sciences, WHEATON, catalog number: 225414) U2OS cells (ATCC, catalog number: HTB-96) or HEK293 cells (ATCC, catalog number: CRL-1573) P1 nuclease (United States Biological, catalog number: N7000), resuspended in RNase-free water to 0.625 U/μl Cap analog GpppG (New England Biolabs, catalog number: S1407), resuspended in RNase-free water to 10 mM Cap analog m7 GpppG (New England Biolabs, catalog number: S1404), resuspended in RNase-free water to 10 mM RNase-free water ( e.g. , from a Millipore Synergy water purification system, 18.2 MΩ cm) Single-stranded DNA sense oligo Single-stranded DNA antisense oligo 5′ CATGCA AATTAACCCTCACTAAA GGGAGA CCGGAATTCGAGCTCGCCCGGGGATC 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by Integrated DNA Technologies (IDT); underlined is a T3 promoter sequence, bold sequence matches the transcribed 32-nucleotide (nt) pppRNA) 5′ GATCCCCGGGCGAGCTCGAATTCCGGTCTCCCTTTAGTGAGGGTTAATTTGCATG 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by IDT) MEGAscript T3 Transcription Kit (Thermo Fisher Scientific, Ambion, catalog number: AM1138) Pre-cast polyacrylamide mini-gels for urea polyacrylamide gel electrophoresis (urea-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4566053) Pre-cast polyacrylamide mini-gels for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4568094) 2× Laemmli Sample Buffer (Bio-Rad Laboratories, catalog number: 1610737) SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, Invitrogen™, catalog number: S11494) RNA size marker ( e.g. , Thermo Fisher Scientific, Invitrogen™, catalog number: AM7778) 2× RNA loading dye ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: R0641) 40 U/μl RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific, Invitrogen™, catalog number: 10777019) Recombinant triphosphatase-guanylyltransferase capping enzyme (see Note ) [α-32 P]GTP (3,000 Ci/mmol, PerkinElmer, catalog number: BLU506H250UC) RNA Clean & Concentrator-5 kit (Zymo Research, catalog number: R1016) ScintiSafe Econo 1 scintillation fluid (Fisher Scientific, catalog number: SX20-5) Note: This product has been discontinued. .. Eye protection NanoDrop spectrophotometer (Thermo Fisher, model: NanoDrop™ 1000, catalog number: ND-1000) Lucite/Plexiglass acrylic benchtop shielding for handling 32 P ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: 6700-2418) Geiger counter Metric (centimeter) ruler Scissors ( e.g. , Westcott, catalog number: ) Graphite pencil Long (at least 18 cm) forceps or tongs ( e.g. , Fisher Scientific, catalog number: 15-186) P10, P20, P100, and P1000 pipets Thermal cycler ( e.g. , MJ Research, model: PTC-200) Heating block ( e.g. , Bioer, model: MB 101) −80 °C freezer Handheld 254 nm UV light ( e.g. , UVP, model: 95-0016-14) Liquid scintillation counter ( e.g. , Beckman Coulter, model: LS 6000IC) Water-jacketed incubator ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, model: Forma® Series II) set to 37 °C with 5% CO2 Refrigerated centrifuge (Eppendorf, model: 5415 R) Programmable rotator-mixer (Grant Instruments, model: PTR-30) at 4 °C and set to 10 rpm orbital rotation UV-vis spectrophotometer ( e.g. , Beckman Coulter, model: DU 640) set to 595 nm Electrophoresis system for PAGE and membrane transfer ( e.g. , Bio-Rad Laboratories, catalog number: 1660828EDU) Opaque western blot incubation boxes ( e.g. , LI-COR, catalog number: 929-97205) Western blot imaging system ( e.g. , LI-COR, model: Odyssey Imaging Systems) Rectangular glass TLC chamber ( e.g. , Miles Scientific, model: A70-22, formerly Analtech) Electric hair dryer (optional) Storage phosphor screen ( e.g. , GE/Amersham Biosciences) Light eraser for storage phosphor screen ( e.g. , Molecular Dynamics Image Eraser) Typhoon imaging system ( e.g. , GE Healthcare, Amersham Biosciences, model: Typhoon 9200)

    Polyacrylamide Gel Electrophoresis:

    Article Title: RNA Cap Methyltransferase Activity Assay
    Article Snippet: .. Polyethylenimine (PEI) cellulose TLC plates (Macherey-Nagel, catalog number: 801053; see Note ) Immobilon-FL polyvinylidene difluoride (PVDF) membrane (Merck, catalog number: IPFL00010) Scintillation vials compatible with liquid scintillation counter ( e.g ., DWK Life Sciences, WHEATON, catalog number: 225414) U2OS cells (ATCC, catalog number: HTB-96) or HEK293 cells (ATCC, catalog number: CRL-1573) P1 nuclease (United States Biological, catalog number: N7000), resuspended in RNase-free water to 0.625 U/μl Cap analog GpppG (New England Biolabs, catalog number: S1407), resuspended in RNase-free water to 10 mM Cap analog m7 GpppG (New England Biolabs, catalog number: S1404), resuspended in RNase-free water to 10 mM RNase-free water ( e.g. , from a Millipore Synergy water purification system, 18.2 MΩ cm) Single-stranded DNA sense oligo Single-stranded DNA antisense oligo 5′ CATGCA AATTAACCCTCACTAAA GGGAGA CCGGAATTCGAGCTCGCCCGGGGATC 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by Integrated DNA Technologies (IDT); underlined is a T3 promoter sequence, bold sequence matches the transcribed 32-nucleotide (nt) pppRNA) 5′ GATCCCCGGGCGAGCTCGAATTCCGGTCTCCCTTTAGTGAGGGTTAATTTGCATG 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by IDT) MEGAscript T3 Transcription Kit (Thermo Fisher Scientific, Ambion, catalog number: AM1138) Pre-cast polyacrylamide mini-gels for urea polyacrylamide gel electrophoresis (urea-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4566053) Pre-cast polyacrylamide mini-gels for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4568094) 2× Laemmli Sample Buffer (Bio-Rad Laboratories, catalog number: 1610737) SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, Invitrogen™, catalog number: S11494) RNA size marker ( e.g. , Thermo Fisher Scientific, Invitrogen™, catalog number: AM7778) 2× RNA loading dye ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: R0641) 40 U/μl RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific, Invitrogen™, catalog number: 10777019) Recombinant triphosphatase-guanylyltransferase capping enzyme (see Note ) [α-32 P]GTP (3,000 Ci/mmol, PerkinElmer, catalog number: BLU506H250UC) RNA Clean & Concentrator-5 kit (Zymo Research, catalog number: R1016) ScintiSafe Econo 1 scintillation fluid (Fisher Scientific, catalog number: SX20-5) Note: This product has been discontinued. .. Eye protection NanoDrop spectrophotometer (Thermo Fisher, model: NanoDrop™ 1000, catalog number: ND-1000) Lucite/Plexiglass acrylic benchtop shielding for handling 32 P ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: 6700-2418) Geiger counter Metric (centimeter) ruler Scissors ( e.g. , Westcott, catalog number: ) Graphite pencil Long (at least 18 cm) forceps or tongs ( e.g. , Fisher Scientific, catalog number: 15-186) P10, P20, P100, and P1000 pipets Thermal cycler ( e.g. , MJ Research, model: PTC-200) Heating block ( e.g. , Bioer, model: MB 101) −80 °C freezer Handheld 254 nm UV light ( e.g. , UVP, model: 95-0016-14) Liquid scintillation counter ( e.g. , Beckman Coulter, model: LS 6000IC) Water-jacketed incubator ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, model: Forma® Series II) set to 37 °C with 5% CO2 Refrigerated centrifuge (Eppendorf, model: 5415 R) Programmable rotator-mixer (Grant Instruments, model: PTR-30) at 4 °C and set to 10 rpm orbital rotation UV-vis spectrophotometer ( e.g. , Beckman Coulter, model: DU 640) set to 595 nm Electrophoresis system for PAGE and membrane transfer ( e.g. , Bio-Rad Laboratories, catalog number: 1660828EDU) Opaque western blot incubation boxes ( e.g. , LI-COR, catalog number: 929-97205) Western blot imaging system ( e.g. , LI-COR, model: Odyssey Imaging Systems) Rectangular glass TLC chamber ( e.g. , Miles Scientific, model: A70-22, formerly Analtech) Electric hair dryer (optional) Storage phosphor screen ( e.g. , GE/Amersham Biosciences) Light eraser for storage phosphor screen ( e.g. , Molecular Dynamics Image Eraser) Typhoon imaging system ( e.g. , GE Healthcare, Amersham Biosciences, model: Typhoon 9200)

    Marker:

    Article Title: RNA Cap Methyltransferase Activity Assay
    Article Snippet: .. Polyethylenimine (PEI) cellulose TLC plates (Macherey-Nagel, catalog number: 801053; see Note ) Immobilon-FL polyvinylidene difluoride (PVDF) membrane (Merck, catalog number: IPFL00010) Scintillation vials compatible with liquid scintillation counter ( e.g ., DWK Life Sciences, WHEATON, catalog number: 225414) U2OS cells (ATCC, catalog number: HTB-96) or HEK293 cells (ATCC, catalog number: CRL-1573) P1 nuclease (United States Biological, catalog number: N7000), resuspended in RNase-free water to 0.625 U/μl Cap analog GpppG (New England Biolabs, catalog number: S1407), resuspended in RNase-free water to 10 mM Cap analog m7 GpppG (New England Biolabs, catalog number: S1404), resuspended in RNase-free water to 10 mM RNase-free water ( e.g. , from a Millipore Synergy water purification system, 18.2 MΩ cm) Single-stranded DNA sense oligo Single-stranded DNA antisense oligo 5′ CATGCA AATTAACCCTCACTAAA GGGAGA CCGGAATTCGAGCTCGCCCGGGGATC 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by Integrated DNA Technologies (IDT); underlined is a T3 promoter sequence, bold sequence matches the transcribed 32-nucleotide (nt) pppRNA) 5′ GATCCCCGGGCGAGCTCGAATTCCGGTCTCCCTTTAGTGAGGGTTAATTTGCATG 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by IDT) MEGAscript T3 Transcription Kit (Thermo Fisher Scientific, Ambion, catalog number: AM1138) Pre-cast polyacrylamide mini-gels for urea polyacrylamide gel electrophoresis (urea-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4566053) Pre-cast polyacrylamide mini-gels for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4568094) 2× Laemmli Sample Buffer (Bio-Rad Laboratories, catalog number: 1610737) SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, Invitrogen™, catalog number: S11494) RNA size marker ( e.g. , Thermo Fisher Scientific, Invitrogen™, catalog number: AM7778) 2× RNA loading dye ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: R0641) 40 U/μl RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific, Invitrogen™, catalog number: 10777019) Recombinant triphosphatase-guanylyltransferase capping enzyme (see Note ) [α-32 P]GTP (3,000 Ci/mmol, PerkinElmer, catalog number: BLU506H250UC) RNA Clean & Concentrator-5 kit (Zymo Research, catalog number: R1016) ScintiSafe Econo 1 scintillation fluid (Fisher Scientific, catalog number: SX20-5) Note: This product has been discontinued. .. Eye protection NanoDrop spectrophotometer (Thermo Fisher, model: NanoDrop™ 1000, catalog number: ND-1000) Lucite/Plexiglass acrylic benchtop shielding for handling 32 P ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: 6700-2418) Geiger counter Metric (centimeter) ruler Scissors ( e.g. , Westcott, catalog number: ) Graphite pencil Long (at least 18 cm) forceps or tongs ( e.g. , Fisher Scientific, catalog number: 15-186) P10, P20, P100, and P1000 pipets Thermal cycler ( e.g. , MJ Research, model: PTC-200) Heating block ( e.g. , Bioer, model: MB 101) −80 °C freezer Handheld 254 nm UV light ( e.g. , UVP, model: 95-0016-14) Liquid scintillation counter ( e.g. , Beckman Coulter, model: LS 6000IC) Water-jacketed incubator ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, model: Forma® Series II) set to 37 °C with 5% CO2 Refrigerated centrifuge (Eppendorf, model: 5415 R) Programmable rotator-mixer (Grant Instruments, model: PTR-30) at 4 °C and set to 10 rpm orbital rotation UV-vis spectrophotometer ( e.g. , Beckman Coulter, model: DU 640) set to 595 nm Electrophoresis system for PAGE and membrane transfer ( e.g. , Bio-Rad Laboratories, catalog number: 1660828EDU) Opaque western blot incubation boxes ( e.g. , LI-COR, catalog number: 929-97205) Western blot imaging system ( e.g. , LI-COR, model: Odyssey Imaging Systems) Rectangular glass TLC chamber ( e.g. , Miles Scientific, model: A70-22, formerly Analtech) Electric hair dryer (optional) Storage phosphor screen ( e.g. , GE/Amersham Biosciences) Light eraser for storage phosphor screen ( e.g. , Molecular Dynamics Image Eraser) Typhoon imaging system ( e.g. , GE Healthcare, Amersham Biosciences, model: Typhoon 9200)

    Staining:

    Article Title: RNA Cap Methyltransferase Activity Assay
    Article Snippet: .. Polyethylenimine (PEI) cellulose TLC plates (Macherey-Nagel, catalog number: 801053; see Note ) Immobilon-FL polyvinylidene difluoride (PVDF) membrane (Merck, catalog number: IPFL00010) Scintillation vials compatible with liquid scintillation counter ( e.g ., DWK Life Sciences, WHEATON, catalog number: 225414) U2OS cells (ATCC, catalog number: HTB-96) or HEK293 cells (ATCC, catalog number: CRL-1573) P1 nuclease (United States Biological, catalog number: N7000), resuspended in RNase-free water to 0.625 U/μl Cap analog GpppG (New England Biolabs, catalog number: S1407), resuspended in RNase-free water to 10 mM Cap analog m7 GpppG (New England Biolabs, catalog number: S1404), resuspended in RNase-free water to 10 mM RNase-free water ( e.g. , from a Millipore Synergy water purification system, 18.2 MΩ cm) Single-stranded DNA sense oligo Single-stranded DNA antisense oligo 5′ CATGCA AATTAACCCTCACTAAA GGGAGA CCGGAATTCGAGCTCGCCCGGGGATC 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by Integrated DNA Technologies (IDT); underlined is a T3 promoter sequence, bold sequence matches the transcribed 32-nucleotide (nt) pppRNA) 5′ GATCCCCGGGCGAGCTCGAATTCCGGTCTCCCTTTAGTGAGGGTTAATTTGCATG 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by IDT) MEGAscript T3 Transcription Kit (Thermo Fisher Scientific, Ambion, catalog number: AM1138) Pre-cast polyacrylamide mini-gels for urea polyacrylamide gel electrophoresis (urea-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4566053) Pre-cast polyacrylamide mini-gels for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4568094) 2× Laemmli Sample Buffer (Bio-Rad Laboratories, catalog number: 1610737) SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, Invitrogen™, catalog number: S11494) RNA size marker ( e.g. , Thermo Fisher Scientific, Invitrogen™, catalog number: AM7778) 2× RNA loading dye ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: R0641) 40 U/μl RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific, Invitrogen™, catalog number: 10777019) Recombinant triphosphatase-guanylyltransferase capping enzyme (see Note ) [α-32 P]GTP (3,000 Ci/mmol, PerkinElmer, catalog number: BLU506H250UC) RNA Clean & Concentrator-5 kit (Zymo Research, catalog number: R1016) ScintiSafe Econo 1 scintillation fluid (Fisher Scientific, catalog number: SX20-5) Note: This product has been discontinued. .. Eye protection NanoDrop spectrophotometer (Thermo Fisher, model: NanoDrop™ 1000, catalog number: ND-1000) Lucite/Plexiglass acrylic benchtop shielding for handling 32 P ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: 6700-2418) Geiger counter Metric (centimeter) ruler Scissors ( e.g. , Westcott, catalog number: ) Graphite pencil Long (at least 18 cm) forceps or tongs ( e.g. , Fisher Scientific, catalog number: 15-186) P10, P20, P100, and P1000 pipets Thermal cycler ( e.g. , MJ Research, model: PTC-200) Heating block ( e.g. , Bioer, model: MB 101) −80 °C freezer Handheld 254 nm UV light ( e.g. , UVP, model: 95-0016-14) Liquid scintillation counter ( e.g. , Beckman Coulter, model: LS 6000IC) Water-jacketed incubator ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, model: Forma® Series II) set to 37 °C with 5% CO2 Refrigerated centrifuge (Eppendorf, model: 5415 R) Programmable rotator-mixer (Grant Instruments, model: PTR-30) at 4 °C and set to 10 rpm orbital rotation UV-vis spectrophotometer ( e.g. , Beckman Coulter, model: DU 640) set to 595 nm Electrophoresis system for PAGE and membrane transfer ( e.g. , Bio-Rad Laboratories, catalog number: 1660828EDU) Opaque western blot incubation boxes ( e.g. , LI-COR, catalog number: 929-97205) Western blot imaging system ( e.g. , LI-COR, model: Odyssey Imaging Systems) Rectangular glass TLC chamber ( e.g. , Miles Scientific, model: A70-22, formerly Analtech) Electric hair dryer (optional) Storage phosphor screen ( e.g. , GE/Amersham Biosciences) Light eraser for storage phosphor screen ( e.g. , Molecular Dynamics Image Eraser) Typhoon imaging system ( e.g. , GE Healthcare, Amersham Biosciences, model: Typhoon 9200)

    Recombinant:

    Article Title: RNA Cap Methyltransferase Activity Assay
    Article Snippet: .. Polyethylenimine (PEI) cellulose TLC plates (Macherey-Nagel, catalog number: 801053; see Note ) Immobilon-FL polyvinylidene difluoride (PVDF) membrane (Merck, catalog number: IPFL00010) Scintillation vials compatible with liquid scintillation counter ( e.g ., DWK Life Sciences, WHEATON, catalog number: 225414) U2OS cells (ATCC, catalog number: HTB-96) or HEK293 cells (ATCC, catalog number: CRL-1573) P1 nuclease (United States Biological, catalog number: N7000), resuspended in RNase-free water to 0.625 U/μl Cap analog GpppG (New England Biolabs, catalog number: S1407), resuspended in RNase-free water to 10 mM Cap analog m7 GpppG (New England Biolabs, catalog number: S1404), resuspended in RNase-free water to 10 mM RNase-free water ( e.g. , from a Millipore Synergy water purification system, 18.2 MΩ cm) Single-stranded DNA sense oligo Single-stranded DNA antisense oligo 5′ CATGCA AATTAACCCTCACTAAA GGGAGA CCGGAATTCGAGCTCGCCCGGGGATC 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by Integrated DNA Technologies (IDT); underlined is a T3 promoter sequence, bold sequence matches the transcribed 32-nucleotide (nt) pppRNA) 5′ GATCCCCGGGCGAGCTCGAATTCCGGTCTCCCTTTAGTGAGGGTTAATTTGCATG 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by IDT) MEGAscript T3 Transcription Kit (Thermo Fisher Scientific, Ambion, catalog number: AM1138) Pre-cast polyacrylamide mini-gels for urea polyacrylamide gel electrophoresis (urea-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4566053) Pre-cast polyacrylamide mini-gels for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4568094) 2× Laemmli Sample Buffer (Bio-Rad Laboratories, catalog number: 1610737) SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, Invitrogen™, catalog number: S11494) RNA size marker ( e.g. , Thermo Fisher Scientific, Invitrogen™, catalog number: AM7778) 2× RNA loading dye ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: R0641) 40 U/μl RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific, Invitrogen™, catalog number: 10777019) Recombinant triphosphatase-guanylyltransferase capping enzyme (see Note ) [α-32 P]GTP (3,000 Ci/mmol, PerkinElmer, catalog number: BLU506H250UC) RNA Clean & Concentrator-5 kit (Zymo Research, catalog number: R1016) ScintiSafe Econo 1 scintillation fluid (Fisher Scientific, catalog number: SX20-5) Note: This product has been discontinued. .. Eye protection NanoDrop spectrophotometer (Thermo Fisher, model: NanoDrop™ 1000, catalog number: ND-1000) Lucite/Plexiglass acrylic benchtop shielding for handling 32 P ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: 6700-2418) Geiger counter Metric (centimeter) ruler Scissors ( e.g. , Westcott, catalog number: ) Graphite pencil Long (at least 18 cm) forceps or tongs ( e.g. , Fisher Scientific, catalog number: 15-186) P10, P20, P100, and P1000 pipets Thermal cycler ( e.g. , MJ Research, model: PTC-200) Heating block ( e.g. , Bioer, model: MB 101) −80 °C freezer Handheld 254 nm UV light ( e.g. , UVP, model: 95-0016-14) Liquid scintillation counter ( e.g. , Beckman Coulter, model: LS 6000IC) Water-jacketed incubator ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, model: Forma® Series II) set to 37 °C with 5% CO2 Refrigerated centrifuge (Eppendorf, model: 5415 R) Programmable rotator-mixer (Grant Instruments, model: PTR-30) at 4 °C and set to 10 rpm orbital rotation UV-vis spectrophotometer ( e.g. , Beckman Coulter, model: DU 640) set to 595 nm Electrophoresis system for PAGE and membrane transfer ( e.g. , Bio-Rad Laboratories, catalog number: 1660828EDU) Opaque western blot incubation boxes ( e.g. , LI-COR, catalog number: 929-97205) Western blot imaging system ( e.g. , LI-COR, model: Odyssey Imaging Systems) Rectangular glass TLC chamber ( e.g. , Miles Scientific, model: A70-22, formerly Analtech) Electric hair dryer (optional) Storage phosphor screen ( e.g. , GE/Amersham Biosciences) Light eraser for storage phosphor screen ( e.g. , Molecular Dynamics Image Eraser) Typhoon imaging system ( e.g. , GE Healthcare, Amersham Biosciences, model: Typhoon 9200)

    SDS Page:

    Article Title: RNA Cap Methyltransferase Activity Assay
    Article Snippet: .. Polyethylenimine (PEI) cellulose TLC plates (Macherey-Nagel, catalog number: 801053; see Note ) Immobilon-FL polyvinylidene difluoride (PVDF) membrane (Merck, catalog number: IPFL00010) Scintillation vials compatible with liquid scintillation counter ( e.g ., DWK Life Sciences, WHEATON, catalog number: 225414) U2OS cells (ATCC, catalog number: HTB-96) or HEK293 cells (ATCC, catalog number: CRL-1573) P1 nuclease (United States Biological, catalog number: N7000), resuspended in RNase-free water to 0.625 U/μl Cap analog GpppG (New England Biolabs, catalog number: S1407), resuspended in RNase-free water to 10 mM Cap analog m7 GpppG (New England Biolabs, catalog number: S1404), resuspended in RNase-free water to 10 mM RNase-free water ( e.g. , from a Millipore Synergy water purification system, 18.2 MΩ cm) Single-stranded DNA sense oligo Single-stranded DNA antisense oligo 5′ CATGCA AATTAACCCTCACTAAA GGGAGA CCGGAATTCGAGCTCGCCCGGGGATC 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by Integrated DNA Technologies (IDT); underlined is a T3 promoter sequence, bold sequence matches the transcribed 32-nucleotide (nt) pppRNA) 5′ GATCCCCGGGCGAGCTCGAATTCCGGTCTCCCTTTAGTGAGGGTTAATTTGCATG 3′ for T3 transcription template, resuspended in RNase-free water to 100 μM ( e.g. , synthesized by IDT) MEGAscript T3 Transcription Kit (Thermo Fisher Scientific, Ambion, catalog number: AM1138) Pre-cast polyacrylamide mini-gels for urea polyacrylamide gel electrophoresis (urea-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4566053) Pre-cast polyacrylamide mini-gels for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; e.g. , Bio-Rad Laboratories, catalog number: 4568094) 2× Laemmli Sample Buffer (Bio-Rad Laboratories, catalog number: 1610737) SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, Invitrogen™, catalog number: S11494) RNA size marker ( e.g. , Thermo Fisher Scientific, Invitrogen™, catalog number: AM7778) 2× RNA loading dye ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: R0641) 40 U/μl RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific, Invitrogen™, catalog number: 10777019) Recombinant triphosphatase-guanylyltransferase capping enzyme (see Note ) [α-32 P]GTP (3,000 Ci/mmol, PerkinElmer, catalog number: BLU506H250UC) RNA Clean & Concentrator-5 kit (Zymo Research, catalog number: R1016) ScintiSafe Econo 1 scintillation fluid (Fisher Scientific, catalog number: SX20-5) Note: This product has been discontinued. .. Eye protection NanoDrop spectrophotometer (Thermo Fisher, model: NanoDrop™ 1000, catalog number: ND-1000) Lucite/Plexiglass acrylic benchtop shielding for handling 32 P ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, catalog number: 6700-2418) Geiger counter Metric (centimeter) ruler Scissors ( e.g. , Westcott, catalog number: ) Graphite pencil Long (at least 18 cm) forceps or tongs ( e.g. , Fisher Scientific, catalog number: 15-186) P10, P20, P100, and P1000 pipets Thermal cycler ( e.g. , MJ Research, model: PTC-200) Heating block ( e.g. , Bioer, model: MB 101) −80 °C freezer Handheld 254 nm UV light ( e.g. , UVP, model: 95-0016-14) Liquid scintillation counter ( e.g. , Beckman Coulter, model: LS 6000IC) Water-jacketed incubator ( e.g. , Thermo Fisher Scientific, Thermo Scientific™, model: Forma® Series II) set to 37 °C with 5% CO2 Refrigerated centrifuge (Eppendorf, model: 5415 R) Programmable rotator-mixer (Grant Instruments, model: PTR-30) at 4 °C and set to 10 rpm orbital rotation UV-vis spectrophotometer ( e.g. , Beckman Coulter, model: DU 640) set to 595 nm Electrophoresis system for PAGE and membrane transfer ( e.g. , Bio-Rad Laboratories, catalog number: 1660828EDU) Opaque western blot incubation boxes ( e.g. , LI-COR, catalog number: 929-97205) Western blot imaging system ( e.g. , LI-COR, model: Odyssey Imaging Systems) Rectangular glass TLC chamber ( e.g. , Miles Scientific, model: A70-22, formerly Analtech) Electric hair dryer (optional) Storage phosphor screen ( e.g. , GE/Amersham Biosciences) Light eraser for storage phosphor screen ( e.g. , Molecular Dynamics Image Eraser) Typhoon imaging system ( e.g. , GE Healthcare, Amersham Biosciences, model: Typhoon 9200)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs rna cap structure analog
    Effect of T3 on <t>THRβ</t> mRNA expression in the periventricular zone of zebrafish embryonic brain. Embryos were exposed from 4- to 22- hpf to T3. Note the prominent blue coloration in control, ( A ) localized to fore- and midbrain regions (red arrow). By comparison, panels B,C and E show less blue coloration (red arrows) upon exposure to a range of T3 from 0.1 nM to 100 nM. The average intensity of THRβ expression recorded in brain at 22 somite stage showed dose dependent reduction (histogram, E ). ( F ) Bar chart of THRβ expression based on quantitative PCR (qRT-PCR, total <t>RNA</t> from whole embryos) at 22 somite stage. The 10 and 100 nM T3 was significantly different from the control (*, P
    Rna Cap Structure Analog, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna cap structure analog/product/New England Biolabs
    Average 93 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    rna cap structure analog - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    Effect of T3 on THRβ mRNA expression in the periventricular zone of zebrafish embryonic brain. Embryos were exposed from 4- to 22- hpf to T3. Note the prominent blue coloration in control, ( A ) localized to fore- and midbrain regions (red arrow). By comparison, panels B,C and E show less blue coloration (red arrows) upon exposure to a range of T3 from 0.1 nM to 100 nM. The average intensity of THRβ expression recorded in brain at 22 somite stage showed dose dependent reduction (histogram, E ). ( F ) Bar chart of THRβ expression based on quantitative PCR (qRT-PCR, total RNA from whole embryos) at 22 somite stage. The 10 and 100 nM T3 was significantly different from the control (*, P

    Journal: Endocrine disruptors (Austin, Tex.)

    Article Title: The PBDE metabolite 6-OH-BDE 47 affects melanin pigmentation and THRβ MRNA expression in the eye of zebrafish embryos

    doi: 10.4161/23273739.2014.969072

    Figure Lengend Snippet: Effect of T3 on THRβ mRNA expression in the periventricular zone of zebrafish embryonic brain. Embryos were exposed from 4- to 22- hpf to T3. Note the prominent blue coloration in control, ( A ) localized to fore- and midbrain regions (red arrow). By comparison, panels B,C and E show less blue coloration (red arrows) upon exposure to a range of T3 from 0.1 nM to 100 nM. The average intensity of THRβ expression recorded in brain at 22 somite stage showed dose dependent reduction (histogram, E ). ( F ) Bar chart of THRβ expression based on quantitative PCR (qRT-PCR, total RNA from whole embryos) at 22 somite stage. The 10 and 100 nM T3 was significantly different from the control (*, P

    Article Snippet: THRβ mRNA was synthesized with SP6 polymerase and capped using a G(5’)ppp(5’)A RNA cap structure analog (New England Biolabs).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR