oligo  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    Oligo d T 23VN
    Description:
    Oligo d T 23VN 1 0 A260 units
    Catalog Number:
    s1327s
    Price:
    99
    Size:
    1 0 A260 units
    Category:
    Probes and Primers
    Buy from Supplier


    Structured Review

    New England Biolabs oligo
    Oligo d T 23VN
    Oligo d T 23VN 1 0 A260 units
    https://www.bioz.com/result/oligo/product/New England Biolabs
    Average 93 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-02
    93/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Degradation of a Novel DNA Damage Response Protein, Tankyrase 1 Binding Protein 1, following Adenovirus Infection
    Article Snippet: Paragraph title: Cloning of Tab182. ... Total cellular RNA was isolated from a lymphoblastoid cell line from a normal individual (cell line provided by the Coriell Institute for Medical Research) by using the Qiagen RNeasy minikit and was reverse transcribed into cDNA by using oligo(dT) primer d(T)23VN and the ProtoScript II first-strand cDNA synthesis kit (New England BioLabs).

    Sequencing:

    Article Title: Degradation of a Novel DNA Damage Response Protein, Tankyrase 1 Binding Protein 1, following Adenovirus Infection
    Article Snippet: Total cellular RNA was isolated from a lymphoblastoid cell line from a normal individual (cell line provided by the Coriell Institute for Medical Research) by using the Qiagen RNeasy minikit and was reverse transcribed into cDNA by using oligo(dT) primer d(T)23VN and the ProtoScript II first-strand cDNA synthesis kit (New England BioLabs). .. PCR was used to amplify the complete Tab182 cDNA sequence by using the forward primer 5′-GAGCGG GTCGAC G ATG AAAGTGTCTACTCTCAGG-3′ (For 1) and the reverse primer 5′-CGTGAT GTCGAC TCA GACCTTCTTCTTCTTCAGTTT-3′ (Rev13).

    RNA HS Assay:

    Article Title: Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing
    Article Snippet: mRNA extraction and double-stranded cDNA synthesis Total RNA was extracted from the venom glands of two Echis coloratus (snap-frozen after removal and stored at −80 °C ( ; )) using TriReagent (Sigma T9424; Sigma Aldrich, St. Louis, MO, USA) and mRNA purified using the polyA Spin mRNA Isolation Kit (New England BioLabs S1560; New England BioLabs, Ipswich, MA, USA). mRNA was quantified using a Qubit fluorometer (Qubit RNA HS Assay Kit Q32852; Thermo Scientific, Waltham, MA, USA) and reverse transcription carried out using 120 ng (Eco6) or 240 ng of mRNA (Eco8). .. Primer annealing was performed at 65 °C for 5 min in a 13 µl reaction comprising the required amount of mRNA, 2 µl of 1 µM Oligo d(T)23 VN primer (New England BioLabs S1327S; New England BioLabs, Ipswich, MA, USA), 1 µl of 10 mM dNTPs and the appropriate volume of Rnase-free water.

    Polymerase Chain Reaction:

    Article Title: Degradation of a Novel DNA Damage Response Protein, Tankyrase 1 Binding Protein 1, following Adenovirus Infection
    Article Snippet: Total cellular RNA was isolated from a lymphoblastoid cell line from a normal individual (cell line provided by the Coriell Institute for Medical Research) by using the Qiagen RNeasy minikit and was reverse transcribed into cDNA by using oligo(dT) primer d(T)23VN and the ProtoScript II first-strand cDNA synthesis kit (New England BioLabs). .. PCR was used to amplify the complete Tab182 cDNA sequence by using the forward primer 5′-GAGCGG GTCGAC G ATG AAAGTGTCTACTCTCAGG-3′ (For 1) and the reverse primer 5′-CGTGAT GTCGAC TCA GACCTTCTTCTTCTTCAGTTT-3′ (Rev13).

    Isolation:

    Article Title: Degradation of a Novel DNA Damage Response Protein, Tankyrase 1 Binding Protein 1, following Adenovirus Infection
    Article Snippet: .. Total cellular RNA was isolated from a lymphoblastoid cell line from a normal individual (cell line provided by the Coriell Institute for Medical Research) by using the Qiagen RNeasy minikit and was reverse transcribed into cDNA by using oligo(dT) primer d(T)23VN and the ProtoScript II first-strand cDNA synthesis kit (New England BioLabs). .. PCR was used to amplify the complete Tab182 cDNA sequence by using the forward primer 5′-GAGCGG GTCGAC G ATG AAAGTGTCTACTCTCAGG-3′ (For 1) and the reverse primer 5′-CGTGAT GTCGAC TCA GACCTTCTTCTTCTTCAGTTT-3′ (Rev13).

    Article Title: Targeting EZH2 reactivates a breast cancer subtype-specific anti-metastatic transcriptional program
    Article Snippet: .. RNA isolation, cDNA synthesis and qRT-PCR Total RNA was extracted from flash frozen mammary tumour or cell lines using an RNeasy Midi Kit (Qiagen). cDNA was prepared by reverse transcribing isolated RNA using M-Mulv Reverse Transcriptase, Oligo-dT(23VN) and murine RNase inhibitor (New England Biolabs). .. Real time quantitative PCR was performed using SYBR Green Master Mix (Roche) and Light Cycler 480 instrument.

    Article Title: Targeting EZH2 reactivates a breast cancer subtype-specific anti-metastatic transcriptional program
    Article Snippet: .. Total RNA was extracted from flash frozen mammary tumour or cell lines using an RNeasy Midi Kit (Qiagen). cDNA was prepared by reverse transcribing isolated RNA using M-Mulv Reverse Transcriptase, Oligo-dT(23VN) and murine RNase inhibitor (New England Biolabs). .. Real time quantitative PCR was performed using SYBR Green Master Mix (Roche) and Light Cycler 480 instrument.

    Article Title: Inducible and coupled expression of the polyomavirus middle T antigen and Cre recombinase in transgenic mice: an in vivo model for synthetic viability in mammary tumour progression
    Article Snippet: .. qRT-PCR Total RNA was extracted from flash frozen mammary tumours and lung lesions using a Qiagen AllPrep DNA/RNA Mini Kit (Qiagen Inc., Toronto, ON, Canada; #80204). cDNA was prepared by reverse transcribing the isolated RNA using M-Mulv Reverse Transcriptase (#M0253S), Oligo-dT(23VN) (#S1327S) and a murine RNase inhibitor (#M0314S) (all purchased from New England Biolabs). .. Real-time quantitative PCR was performed on the cDNA using LightCycler 480 SYBR Green I Master (Roche, Missisauga, ON, Canada; #04707516001) and run on a Roche LightCycler 480 instrument.

    Article Title: An ErbB2/c-Src axis links bioenergetics with PRC2 translation to drive epigenetic reprogramming and mammary tumorigenesis
    Article Snippet: .. Quantitative Reverse Transcriptase-Polymerase Chain Reaction Total RNA was extracted from flash frozen mammary tumors using an RNeasy Mini Kit (Qiagen, 74106). cDNA was prepared by reverse transcribing the isolated RNA using M-Mulv Reverse Transcriptase, Oligo-dT(23VN) and murine RNase inhibitor (ProtoScript First Strand cDNA Synthesis Kit, New England Biolabs, E6300). .. Real-time quantitative PCR was performed using LightCycler 480 SYBR Green I MasterMix (Roche, 04887352001) and LightCycler 480 instrument (Roche) and analyzed using associated software.

    Article Title: Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing
    Article Snippet: mRNA extraction and double-stranded cDNA synthesis Total RNA was extracted from the venom glands of two Echis coloratus (snap-frozen after removal and stored at −80 °C ( ; )) using TriReagent (Sigma T9424; Sigma Aldrich, St. Louis, MO, USA) and mRNA purified using the polyA Spin mRNA Isolation Kit (New England BioLabs S1560; New England BioLabs, Ipswich, MA, USA). mRNA was quantified using a Qubit fluorometer (Qubit RNA HS Assay Kit Q32852; Thermo Scientific, Waltham, MA, USA) and reverse transcription carried out using 120 ng (Eco6) or 240 ng of mRNA (Eco8). .. Primer annealing was performed at 65 °C for 5 min in a 13 µl reaction comprising the required amount of mRNA, 2 µl of 1 µM Oligo d(T)23 VN primer (New England BioLabs S1327S; New England BioLabs, Ipswich, MA, USA), 1 µl of 10 mM dNTPs and the appropriate volume of Rnase-free water.

    Generated:

    Article Title: ErbB2-positive mammary tumors can escape PI3K-p110α loss through downregulation of the Pten tumor suppressor
    Article Snippet: .. qRTPCR cDNA was generated from 1ug of tumor RNA using the M-Mulv Reverse Transcriptase (#M0253S, New England Biolabs, Ipswich, Massachusetts, United States) Oligo-dT(23VN) and a murine RNase inhibitor (New England Biolabs). .. Real-time PCR was performed using the Roche lightcycler master mix on a Roche lightcycler 480.

    Blocking Assay:

    Article Title: Kappa Opioid Receptors Drive a Tonic Aversive Component of Chronic Pain
    Article Snippet: RNA was converted to cDNA using 100 U of M-MulV Reverse Transcriptase, 1 μ m Oligo d(T)23VN, and 2 m m dNTP mix (New England Biolabs), annealed at 70°C and inactivated at 95°C. .. Using, 96-well optical plates (Applied Biosystems), cDNA and PerfeCTa SYBR Green FastMix containing the primer sets (Quanta Biosciences) were loaded and run on ABI ViiA7 fast block qPCR machine using cycling conditions in the PerfeCTa SYBR Green FastMix manual.

    Article Title: Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing
    Article Snippet: Primer annealing was performed at 65 °C for 5 min in a 13 µl reaction comprising the required amount of mRNA, 2 µl of 1 µM Oligo d(T)23 VN primer (New England BioLabs S1327S; New England BioLabs, Ipswich, MA, USA), 1 µl of 10 mM dNTPs and the appropriate volume of Rnase-free water. .. The reaction was then snap-cooled on a pre-chilled freezer block.

    Purification:

    Article Title: Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing
    Article Snippet: mRNA extraction and double-stranded cDNA synthesis Total RNA was extracted from the venom glands of two Echis coloratus (snap-frozen after removal and stored at −80 °C ( ; )) using TriReagent (Sigma T9424; Sigma Aldrich, St. Louis, MO, USA) and mRNA purified using the polyA Spin mRNA Isolation Kit (New England BioLabs S1560; New England BioLabs, Ipswich, MA, USA). mRNA was quantified using a Qubit fluorometer (Qubit RNA HS Assay Kit Q32852; Thermo Scientific, Waltham, MA, USA) and reverse transcription carried out using 120 ng (Eco6) or 240 ng of mRNA (Eco8). .. Primer annealing was performed at 65 °C for 5 min in a 13 µl reaction comprising the required amount of mRNA, 2 µl of 1 µM Oligo d(T)23 VN primer (New England BioLabs S1327S; New England BioLabs, Ipswich, MA, USA), 1 µl of 10 mM dNTPs and the appropriate volume of Rnase-free water.

    SYBR Green Assay:

    Article Title: Kappa Opioid Receptors Drive a Tonic Aversive Component of Chronic Pain
    Article Snippet: RNA was converted to cDNA using 100 U of M-MulV Reverse Transcriptase, 1 μ m Oligo d(T)23VN, and 2 m m dNTP mix (New England Biolabs), annealed at 70°C and inactivated at 95°C. .. Using, 96-well optical plates (Applied Biosystems), cDNA and PerfeCTa SYBR Green FastMix containing the primer sets (Quanta Biosciences) were loaded and run on ABI ViiA7 fast block qPCR machine using cycling conditions in the PerfeCTa SYBR Green FastMix manual.

    Article Title: Targeting EZH2 reactivates a breast cancer subtype-specific anti-metastatic transcriptional program
    Article Snippet: RNA isolation, cDNA synthesis and qRT-PCR Total RNA was extracted from flash frozen mammary tumour or cell lines using an RNeasy Midi Kit (Qiagen). cDNA was prepared by reverse transcribing isolated RNA using M-Mulv Reverse Transcriptase, Oligo-dT(23VN) and murine RNase inhibitor (New England Biolabs). .. Real time quantitative PCR was performed using SYBR Green Master Mix (Roche) and Light Cycler 480 instrument.

    Article Title: Targeting EZH2 reactivates a breast cancer subtype-specific anti-metastatic transcriptional program
    Article Snippet: Total RNA was extracted from flash frozen mammary tumour or cell lines using an RNeasy Midi Kit (Qiagen). cDNA was prepared by reverse transcribing isolated RNA using M-Mulv Reverse Transcriptase, Oligo-dT(23VN) and murine RNase inhibitor (New England Biolabs). .. Real time quantitative PCR was performed using SYBR Green Master Mix (Roche) and Light Cycler 480 instrument.

    Article Title: Inducible and coupled expression of the polyomavirus middle T antigen and Cre recombinase in transgenic mice: an in vivo model for synthetic viability in mammary tumour progression
    Article Snippet: qRT-PCR Total RNA was extracted from flash frozen mammary tumours and lung lesions using a Qiagen AllPrep DNA/RNA Mini Kit (Qiagen Inc., Toronto, ON, Canada; #80204). cDNA was prepared by reverse transcribing the isolated RNA using M-Mulv Reverse Transcriptase (#M0253S), Oligo-dT(23VN) (#S1327S) and a murine RNase inhibitor (#M0314S) (all purchased from New England Biolabs). .. Real-time quantitative PCR was performed on the cDNA using LightCycler 480 SYBR Green I Master (Roche, Missisauga, ON, Canada; #04707516001) and run on a Roche LightCycler 480 instrument.

    Article Title: An ErbB2/c-Src axis links bioenergetics with PRC2 translation to drive epigenetic reprogramming and mammary tumorigenesis
    Article Snippet: Quantitative Reverse Transcriptase-Polymerase Chain Reaction Total RNA was extracted from flash frozen mammary tumors using an RNeasy Mini Kit (Qiagen, 74106). cDNA was prepared by reverse transcribing the isolated RNA using M-Mulv Reverse Transcriptase, Oligo-dT(23VN) and murine RNase inhibitor (ProtoScript First Strand cDNA Synthesis Kit, New England Biolabs, E6300). .. Real-time quantitative PCR was performed using LightCycler 480 SYBR Green I MasterMix (Roche, 04887352001) and LightCycler 480 instrument (Roche) and analyzed using associated software.

    Concentration Assay:

    Article Title: Microfluidic platform combining droplets and magnetic tweezers: application to HER2 expression in cancer diagnosis
    Article Snippet: Desired total RNA quantities were diluted into Binding Buffer provided with the DynabeadsOligo(dT)25 Kit (61002, Life Technologies) and BSA (B14, Thermo Scientific) was added to a final concentration of 0.4%. .. CellsDirect™ One-Step qRT-PCR kits (11732, Life Technologies) was used to prepare the Reverse transcription mix as follow: 12.5 μL of 2X Reaction Mix, 1 μL of anchored Oligo(dT)23VN (S1327S, NEB), 1 μL of each Forward and Reverse primers (custom primers to study HER2 or TBP or Actin b from IDT), 1 μL of SuperScript® III RT/Platinum® Taq Mix with RNaseOUT™ Ribonuclease Inhibitor and qsp to 25 μL with DEPC-treated water.

    Incubation:

    Article Title: Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing
    Article Snippet: Primer annealing was performed at 65 °C for 5 min in a 13 µl reaction comprising the required amount of mRNA, 2 µl of 1 µM Oligo d(T)23 VN primer (New England BioLabs S1327S; New England BioLabs, Ipswich, MA, USA), 1 µl of 10 mM dNTPs and the appropriate volume of Rnase-free water. .. 4 µl of 5× First Strand buffer and 2 µl 100 mM DTT (part of Life Technologies 18064-014; Life Technologies, Carlsbad, CA, USA) were then added to the primer/mRNA mix, which was briefly vortexed, spun down in a microcentrifuge and incubated at 42 °C for 2 min.

    Binding Assay:

    Article Title: Microfluidic platform combining droplets and magnetic tweezers: application to HER2 expression in cancer diagnosis
    Article Snippet: The supernatant was discarded and Dynabeads were resuspended into a 25 μL mix composed of 23.5 μL Binding Buffer, 0.5 μL 20% BSA, 1 μL SUPERase In™ RNase Inhibitor (AM2694, Life Technologies). .. CellsDirect™ One-Step qRT-PCR kits (11732, Life Technologies) was used to prepare the Reverse transcription mix as follow: 12.5 μL of 2X Reaction Mix, 1 μL of anchored Oligo(dT)23VN (S1327S, NEB), 1 μL of each Forward and Reverse primers (custom primers to study HER2 or TBP or Actin b from IDT), 1 μL of SuperScript® III RT/Platinum® Taq Mix with RNaseOUT™ Ribonuclease Inhibitor and qsp to 25 μL with DEPC-treated water.

    Cell Culture:

    Article Title: Fatostatin blocks ER exit of SCAP but inhibits cell growth in a SCAP-independent manner
    Article Snippet: .. We obtained fatostatin (341329), compactin (mevastatin, 474705), and N -acetyl-leucinyl-leucinyl-norleucinal (ALLN, 208719) from Millipore; FBS (heat-inactivated) from Atlanta Biologicals; RNA-STAT 60 from Tel-Test, Inc.; mevalonolactone (M4667), puromycin dihydrochloride (P8833), oleic acid-albumin (O3008), crystal violet (C3886), cholesterol (C3045), 25-hydroxycholesterol (H1015), and lipoprotein-deficient serum (LPDS; S5394) from Sigma-Aldrich; site-1 protease inhibitor PF-429242 from Shanghai API Chemicals (947303-87-9); cell culture medium high glucose DMEM (10-013), DMEM/F12 (10-092), and penicillin-streptomycin (30-002) from Corning Cellgro; FuGENE 6 and RNase-free DNase I (10104159001) from Roche Applied Science; random primer mix (S1330), M-MuLV reverse transcriptase (M0253L), murine RNase inhibitor (M0314L), and oligo d(T)23VN (S1327S) from New England Biolabs; GoTaq real-time PCR mix (A6002) and CellTiter 96 NonRadioactive cell proliferation kit (G4000) from Promega. .. Stock solutions of fatostatin (20 mM) and PF-429242 (50 mM) were made by dissolving chemicals in DMSO.

    Article Title: Sterol Regulatory Element-binding Protein (SREBP) Cleavage Regulates Golgi-to-Endoplasmic Reticulum Recycling of SREBP Cleavage-activating Protein (SCAP) *
    Article Snippet: .. We obtained yeast extract, peptone, and agar from BD Biosciences; S1P inhibitor PF-429242 from Shanghai APIs Chemical Co.; proteasome inhibitor MG132 (C2211), lysosome inhibitor ammonium chloride (A9434), mevalonolactone (M4667, for sodium mevalonate preparation), puromycin dihydrochloride (P8833), oleic acid-albumin (O3008), doxycycline (D9891), crystal violet (C3886), soybean trypsin inhibitor (T9003), glass beads (G8772, for yeast cell lysis), trypsin (T8003), and lipoprotein-deficient serum (LPDS; S5394) from Sigma-Aldrich (catalogue numbers in parentheses); cell culture media DMEM (10-013), DMEM/F12 (10-092), and penicillin-streptomycin (30-002) from Corning Cellgro; FuGENE 6 and RNase-free DNase I (10104159001) from Roche Applied Science; random primer mix (S1330), M-MuLV reverse transcriptase (M0253L), murine RNase inhibitor (M0314L), oligo d(T)23 VN (S1327S), and endoglycosidase Hf (P0703) from New England Biolabs; GoTaq real-time PCR mix (A6002) from Promega; SCAP trafficking inhibitor fatostatin (341329) and compactin (mevastatin, 474705) from Millipore; and BioCoatTM collagen-coated culture dish (VWR 62405-617) from BD Biosciences. .. We obtained wild-type haploid S. pombe KGY425 from ATCC.

    Quantitative RT-PCR:

    Article Title: Targeting EZH2 reactivates a breast cancer subtype-specific anti-metastatic transcriptional program
    Article Snippet: .. RNA isolation, cDNA synthesis and qRT-PCR Total RNA was extracted from flash frozen mammary tumour or cell lines using an RNeasy Midi Kit (Qiagen). cDNA was prepared by reverse transcribing isolated RNA using M-Mulv Reverse Transcriptase, Oligo-dT(23VN) and murine RNase inhibitor (New England Biolabs). .. Real time quantitative PCR was performed using SYBR Green Master Mix (Roche) and Light Cycler 480 instrument.

    Article Title: Targeting EZH2 reactivates a breast cancer subtype-specific anti-metastatic transcriptional program
    Article Snippet: Paragraph title: RNA isolation, cDNA synthesis and qRT-PCR ... Total RNA was extracted from flash frozen mammary tumour or cell lines using an RNeasy Midi Kit (Qiagen). cDNA was prepared by reverse transcribing isolated RNA using M-Mulv Reverse Transcriptase, Oligo-dT(23VN) and murine RNase inhibitor (New England Biolabs).

    Article Title: Microfluidic platform combining droplets and magnetic tweezers: application to HER2 expression in cancer diagnosis
    Article Snippet: .. CellsDirect™ One-Step qRT-PCR kits (11732, Life Technologies) was used to prepare the Reverse transcription mix as follow: 12.5 μL of 2X Reaction Mix, 1 μL of anchored Oligo(dT)23VN (S1327S, NEB), 1 μL of each Forward and Reverse primers (custom primers to study HER2 or TBP or Actin b from IDT), 1 μL of SuperScript® III RT/Platinum® Taq Mix with RNaseOUT™ Ribonuclease Inhibitor and qsp to 25 μL with DEPC-treated water. ..

    Article Title: Inducible and coupled expression of the polyomavirus middle T antigen and Cre recombinase in transgenic mice: an in vivo model for synthetic viability in mammary tumour progression
    Article Snippet: .. qRT-PCR Total RNA was extracted from flash frozen mammary tumours and lung lesions using a Qiagen AllPrep DNA/RNA Mini Kit (Qiagen Inc., Toronto, ON, Canada; #80204). cDNA was prepared by reverse transcribing the isolated RNA using M-Mulv Reverse Transcriptase (#M0253S), Oligo-dT(23VN) (#S1327S) and a murine RNase inhibitor (#M0314S) (all purchased from New England Biolabs). .. Real-time quantitative PCR was performed on the cDNA using LightCycler 480 SYBR Green I Master (Roche, Missisauga, ON, Canada; #04707516001) and run on a Roche LightCycler 480 instrument.

    Protease Inhibitor:

    Article Title: Fatostatin blocks ER exit of SCAP but inhibits cell growth in a SCAP-independent manner
    Article Snippet: .. We obtained fatostatin (341329), compactin (mevastatin, 474705), and N -acetyl-leucinyl-leucinyl-norleucinal (ALLN, 208719) from Millipore; FBS (heat-inactivated) from Atlanta Biologicals; RNA-STAT 60 from Tel-Test, Inc.; mevalonolactone (M4667), puromycin dihydrochloride (P8833), oleic acid-albumin (O3008), crystal violet (C3886), cholesterol (C3045), 25-hydroxycholesterol (H1015), and lipoprotein-deficient serum (LPDS; S5394) from Sigma-Aldrich; site-1 protease inhibitor PF-429242 from Shanghai API Chemicals (947303-87-9); cell culture medium high glucose DMEM (10-013), DMEM/F12 (10-092), and penicillin-streptomycin (30-002) from Corning Cellgro; FuGENE 6 and RNase-free DNase I (10104159001) from Roche Applied Science; random primer mix (S1330), M-MuLV reverse transcriptase (M0253L), murine RNase inhibitor (M0314L), and oligo d(T)23VN (S1327S) from New England Biolabs; GoTaq real-time PCR mix (A6002) and CellTiter 96 NonRadioactive cell proliferation kit (G4000) from Promega. .. Stock solutions of fatostatin (20 mM) and PF-429242 (50 mM) were made by dissolving chemicals in DMSO.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: ErbB2-positive mammary tumors can escape PI3K-p110α loss through downregulation of the Pten tumor suppressor
    Article Snippet: qRTPCR cDNA was generated from 1ug of tumor RNA using the M-Mulv Reverse Transcriptase (#M0253S, New England Biolabs, Ipswich, Massachusetts, United States) Oligo-dT(23VN) and a murine RNase inhibitor (New England Biolabs). .. Primers using for RTPCR: Gapdh: F : CATCAAGAAGGTGGTGAAGC, R: GGGAGTTGCTGTTGAAGTCG, p110α F: TCCATCAGCTTCTGCAAGAC R: CTTCCCTTTCTGCTTCTTGG, PTEN: F: CATTGCCTGTGTGTGGTGATA R: AGGTTTCCTCTGGTCCTGGTA

    Lysis:

    Article Title: Sterol Regulatory Element-binding Protein (SREBP) Cleavage Regulates Golgi-to-Endoplasmic Reticulum Recycling of SREBP Cleavage-activating Protein (SCAP) *
    Article Snippet: .. We obtained yeast extract, peptone, and agar from BD Biosciences; S1P inhibitor PF-429242 from Shanghai APIs Chemical Co.; proteasome inhibitor MG132 (C2211), lysosome inhibitor ammonium chloride (A9434), mevalonolactone (M4667, for sodium mevalonate preparation), puromycin dihydrochloride (P8833), oleic acid-albumin (O3008), doxycycline (D9891), crystal violet (C3886), soybean trypsin inhibitor (T9003), glass beads (G8772, for yeast cell lysis), trypsin (T8003), and lipoprotein-deficient serum (LPDS; S5394) from Sigma-Aldrich (catalogue numbers in parentheses); cell culture media DMEM (10-013), DMEM/F12 (10-092), and penicillin-streptomycin (30-002) from Corning Cellgro; FuGENE 6 and RNase-free DNase I (10104159001) from Roche Applied Science; random primer mix (S1330), M-MuLV reverse transcriptase (M0253L), murine RNase inhibitor (M0314L), oligo d(T)23 VN (S1327S), and endoglycosidase Hf (P0703) from New England Biolabs; GoTaq real-time PCR mix (A6002) from Promega; SCAP trafficking inhibitor fatostatin (341329) and compactin (mevastatin, 474705) from Millipore; and BioCoatTM collagen-coated culture dish (VWR 62405-617) from BD Biosciences. .. We obtained wild-type haploid S. pombe KGY425 from ATCC.

    Real-time Polymerase Chain Reaction:

    Article Title: Kappa Opioid Receptors Drive a Tonic Aversive Component of Chronic Pain
    Article Snippet: Paragraph title: Real-time quantitative PCR. ... RNA was converted to cDNA using 100 U of M-MulV Reverse Transcriptase, 1 μ m Oligo d(T)23VN, and 2 m m dNTP mix (New England Biolabs), annealed at 70°C and inactivated at 95°C.

    Article Title: ErbB2-positive mammary tumors can escape PI3K-p110α loss through downregulation of the Pten tumor suppressor
    Article Snippet: qRTPCR cDNA was generated from 1ug of tumor RNA using the M-Mulv Reverse Transcriptase (#M0253S, New England Biolabs, Ipswich, Massachusetts, United States) Oligo-dT(23VN) and a murine RNase inhibitor (New England Biolabs). .. Real-time PCR was performed using the Roche lightcycler master mix on a Roche lightcycler 480.

    Article Title: Fatostatin blocks ER exit of SCAP but inhibits cell growth in a SCAP-independent manner
    Article Snippet: .. We obtained fatostatin (341329), compactin (mevastatin, 474705), and N -acetyl-leucinyl-leucinyl-norleucinal (ALLN, 208719) from Millipore; FBS (heat-inactivated) from Atlanta Biologicals; RNA-STAT 60 from Tel-Test, Inc.; mevalonolactone (M4667), puromycin dihydrochloride (P8833), oleic acid-albumin (O3008), crystal violet (C3886), cholesterol (C3045), 25-hydroxycholesterol (H1015), and lipoprotein-deficient serum (LPDS; S5394) from Sigma-Aldrich; site-1 protease inhibitor PF-429242 from Shanghai API Chemicals (947303-87-9); cell culture medium high glucose DMEM (10-013), DMEM/F12 (10-092), and penicillin-streptomycin (30-002) from Corning Cellgro; FuGENE 6 and RNase-free DNase I (10104159001) from Roche Applied Science; random primer mix (S1330), M-MuLV reverse transcriptase (M0253L), murine RNase inhibitor (M0314L), and oligo d(T)23VN (S1327S) from New England Biolabs; GoTaq real-time PCR mix (A6002) and CellTiter 96 NonRadioactive cell proliferation kit (G4000) from Promega. .. Stock solutions of fatostatin (20 mM) and PF-429242 (50 mM) were made by dissolving chemicals in DMSO.

    Article Title: Targeting EZH2 reactivates a breast cancer subtype-specific anti-metastatic transcriptional program
    Article Snippet: RNA isolation, cDNA synthesis and qRT-PCR Total RNA was extracted from flash frozen mammary tumour or cell lines using an RNeasy Midi Kit (Qiagen). cDNA was prepared by reverse transcribing isolated RNA using M-Mulv Reverse Transcriptase, Oligo-dT(23VN) and murine RNase inhibitor (New England Biolabs). .. Real time quantitative PCR was performed using SYBR Green Master Mix (Roche) and Light Cycler 480 instrument.

    Article Title: Targeting EZH2 reactivates a breast cancer subtype-specific anti-metastatic transcriptional program
    Article Snippet: Total RNA was extracted from flash frozen mammary tumour or cell lines using an RNeasy Midi Kit (Qiagen). cDNA was prepared by reverse transcribing isolated RNA using M-Mulv Reverse Transcriptase, Oligo-dT(23VN) and murine RNase inhibitor (New England Biolabs). .. Real time quantitative PCR was performed using SYBR Green Master Mix (Roche) and Light Cycler 480 instrument.

    Article Title: Microfluidic platform combining droplets and magnetic tweezers: application to HER2 expression in cancer diagnosis
    Article Snippet: CellsDirect™ One-Step qRT-PCR kits (11732, Life Technologies) was used to prepare the Reverse transcription mix as follow: 12.5 μL of 2X Reaction Mix, 1 μL of anchored Oligo(dT)23VN (S1327S, NEB), 1 μL of each Forward and Reverse primers (custom primers to study HER2 or TBP or Actin b from IDT), 1 μL of SuperScript® III RT/Platinum® Taq Mix with RNaseOUT™ Ribonuclease Inhibitor and qsp to 25 μL with DEPC-treated water. .. After the microfluidic process (mRNA capture, washing, Reverse transcription), droplets containing cDNA were recovered into 1.5 mL tubes with 5 μL of DEPC-treated water. qPCR reactions were performed in the SmartCycler instrument (by Cepheid), with a mix composed of: 12.5 μL of 2X Reaction Mix, 1 μL of each Forward and Reverse primers (custom primers to study HER2 or TBP or Actin b from IDT), 0.5 μL of TaqMan™ Probe (custom probes to study HER2 or TBP or Actin b from IDT) 1 μL of SuperScript® III RT/Platinum® Taq Mix with RNaseOUT™ Ribonuclease Inhibitor, 5 μL of cDNA output and qsp to 25 μL with DEPC-treated water.

    Article Title: Inducible and coupled expression of the polyomavirus middle T antigen and Cre recombinase in transgenic mice: an in vivo model for synthetic viability in mammary tumour progression
    Article Snippet: qRT-PCR Total RNA was extracted from flash frozen mammary tumours and lung lesions using a Qiagen AllPrep DNA/RNA Mini Kit (Qiagen Inc., Toronto, ON, Canada; #80204). cDNA was prepared by reverse transcribing the isolated RNA using M-Mulv Reverse Transcriptase (#M0253S), Oligo-dT(23VN) (#S1327S) and a murine RNase inhibitor (#M0314S) (all purchased from New England Biolabs). .. Real-time quantitative PCR was performed on the cDNA using LightCycler 480 SYBR Green I Master (Roche, Missisauga, ON, Canada; #04707516001) and run on a Roche LightCycler 480 instrument.

    Article Title: Sterol Regulatory Element-binding Protein (SREBP) Cleavage Regulates Golgi-to-Endoplasmic Reticulum Recycling of SREBP Cleavage-activating Protein (SCAP) *
    Article Snippet: .. We obtained yeast extract, peptone, and agar from BD Biosciences; S1P inhibitor PF-429242 from Shanghai APIs Chemical Co.; proteasome inhibitor MG132 (C2211), lysosome inhibitor ammonium chloride (A9434), mevalonolactone (M4667, for sodium mevalonate preparation), puromycin dihydrochloride (P8833), oleic acid-albumin (O3008), doxycycline (D9891), crystal violet (C3886), soybean trypsin inhibitor (T9003), glass beads (G8772, for yeast cell lysis), trypsin (T8003), and lipoprotein-deficient serum (LPDS; S5394) from Sigma-Aldrich (catalogue numbers in parentheses); cell culture media DMEM (10-013), DMEM/F12 (10-092), and penicillin-streptomycin (30-002) from Corning Cellgro; FuGENE 6 and RNase-free DNase I (10104159001) from Roche Applied Science; random primer mix (S1330), M-MuLV reverse transcriptase (M0253L), murine RNase inhibitor (M0314L), oligo d(T)23 VN (S1327S), and endoglycosidase Hf (P0703) from New England Biolabs; GoTaq real-time PCR mix (A6002) from Promega; SCAP trafficking inhibitor fatostatin (341329) and compactin (mevastatin, 474705) from Millipore; and BioCoatTM collagen-coated culture dish (VWR 62405-617) from BD Biosciences. .. We obtained wild-type haploid S. pombe KGY425 from ATCC.

    Article Title: An ErbB2/c-Src axis links bioenergetics with PRC2 translation to drive epigenetic reprogramming and mammary tumorigenesis
    Article Snippet: Quantitative Reverse Transcriptase-Polymerase Chain Reaction Total RNA was extracted from flash frozen mammary tumors using an RNeasy Mini Kit (Qiagen, 74106). cDNA was prepared by reverse transcribing the isolated RNA using M-Mulv Reverse Transcriptase, Oligo-dT(23VN) and murine RNase inhibitor (ProtoScript First Strand cDNA Synthesis Kit, New England Biolabs, E6300). .. Real-time quantitative PCR was performed using LightCycler 480 SYBR Green I MasterMix (Roche, 04887352001) and LightCycler 480 instrument (Roche) and analyzed using associated software.

    Mouse Assay:

    Article Title: Kappa Opioid Receptors Drive a Tonic Aversive Component of Chronic Pain
    Article Snippet: Brains were collected from sham and PNI mice 8 weeks postsurgery and were coronal-sectioned via cryostat (150 μm thick) at −20°C and mounted on Superfrost charged slides (Fisher Scientific). .. RNA was converted to cDNA using 100 U of M-MulV Reverse Transcriptase, 1 μ m Oligo d(T)23VN, and 2 m m dNTP mix (New England Biolabs), annealed at 70°C and inactivated at 95°C.

    Software:

    Article Title: An ErbB2/c-Src axis links bioenergetics with PRC2 translation to drive epigenetic reprogramming and mammary tumorigenesis
    Article Snippet: Quantitative Reverse Transcriptase-Polymerase Chain Reaction Total RNA was extracted from flash frozen mammary tumors using an RNeasy Mini Kit (Qiagen, 74106). cDNA was prepared by reverse transcribing the isolated RNA using M-Mulv Reverse Transcriptase, Oligo-dT(23VN) and murine RNase inhibitor (ProtoScript First Strand cDNA Synthesis Kit, New England Biolabs, E6300). .. Real-time quantitative PCR was performed using LightCycler 480 SYBR Green I MasterMix (Roche, 04887352001) and LightCycler 480 instrument (Roche) and analyzed using associated software.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs oligo d t 23vn
    Oligo D T 23vn, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo d t 23vn/product/New England Biolabs
    Average 93 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    oligo d t 23vn - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    Image Search Results