lna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Random Primer 9
    Description:
    Random Primer 9 1 0 A260 units
    Catalog Number:
    s1254s
    Price:
    99
    Size:
    1 0 A260 units
    Category:
    Probes and Primers
    Buy from Supplier


    Structured Review

    New England Biolabs lna
    Random Primer 9
    Random Primer 9 1 0 A260 units
    https://www.bioz.com/result/lna/product/New England Biolabs
    Average 95 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    lna - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Sexual and asexual oogenesis require the expression of unique and shared sets of genes in the insect Acyrthosiphon pisum
    Article Snippet: Riboprobe synthesis for in situ hybridization Templates for synthesis of riboprobes were obtained from full-length cDNAs collection (ACYPI003103, ACYPI010052 [ ]) or amplified by RT-PCR and cloned (Additional file ). .. First strand cDNAs were produced from 1 μg of total RNAs by using random primer 9 (New England BioLabs) and SuperScript® III Reverse Transcriptase (Invitrogen) following the supplier's instructions. cDNAs were used as a matrix for PCR amplification with specific primers (Additional file ).

    Amplification:

    Article Title: Human Guanylate Binding Proteins Potentiate the Anti-Chlamydia Effects of Interferon-?
    Article Snippet: Real time PCR Expression of human Guanylate Binding Protein (GBP)-1, GBP2 and β-actin was assessed by isolating total RNA from 1×106 HeLa cells using the TRIZOL reagent per the manufacturer's instructions, followed by reverse transcription ( 500 ng total RNA, Superscript III Reverse Transcriptase system (Invitrogen cat #18080-044), nonamer Random Primer 9 (New England Biolabs cat #S1254S)) and quantitative real-time polymerase chain reaction PCR. .. The QuantiTect primers for the gene GBP-1 (NM_002053; cat #QT01669885 or #QT00011641) with a predicted amplicon length of 96 bp and custom designed primers for GBP2 (FWD 5′-GAC CAA ATG TTC CAG AGG AAA TTA GGG GC-3′ , REV 5′-AAT GTT CCC TGC TTG ACA TCT TCT TCT AAA GG-3′ ) were used.

    Article Title: Structural divergence creates new functional features in alphavirus genomes
    Article Snippet: Total purified RNAs were then incubated with 500 ng Random Primer 9 (NEB) at 65°C for 5 min, cooled to 0°C, and mixed with 10 mM dNTPs, 0.1 M DTT, 500 mM Tris pH 8.0, 750 KCl and 500 mM MnCl2 . .. The double stranded cDNA was then fragmented, tagged, amplified and barcoded using Nextera XT DNA Library Preparation Kit (Illumina) following the manufacturer's directions.

    Article Title: Sexual and asexual oogenesis require the expression of unique and shared sets of genes in the insect Acyrthosiphon pisum
    Article Snippet: .. First strand cDNAs were produced from 1 μg of total RNAs by using random primer 9 (New England BioLabs) and SuperScript® III Reverse Transcriptase (Invitrogen) following the supplier's instructions. cDNAs were used as a matrix for PCR amplification with specific primers (Additional file ). .. Amplified fragments were cloned into the StrataClone PCR Cloning Vector pSC-A-amp/kan (StrataClone) or pENTR Directional TOPO (Invitrogen) and sequenced (Genoscreen).

    Article Title: Selective 2′-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile, and accurate RNA structure analysis
    Article Snippet: The 5 μM concentration is convenient for in vitro studies; however, much lower concentrations of RNA can be probed using the Small RNA and Amplicon workflows. .. Dithiothreitol (DTT; Fisher Bioreagents, cat. no. BP172-5) Turbo DNase Reaction Buffer (10×, Life Technologies, cat. no. AM2238) Turbo DNase (2 U/μl, Life Technologies, cat. no. AM2238) RNeasy Mini Kit (Qiagen, cat. no. 74104) Deoxynucleotide triphosphates (dNTPs; 10 mM each nucleotide, New England Biolabs, cat. no. N0447S) SuperScript II reverse transcriptase (200 U/μl, Life Technologies, cat. no. 18064-014) Reverse transcription primer (custom synthesis) Random nonamers (New England Biolabs, cat. no. S1254S) LNA+ primers (custom synthesis) Q5 Reaction Buffer (5×, New England Biolabs, cat. no. M0493S) Q5 Hot Start High-Fidelity DNA Polymerase (2,000 U/ml, New England Biolabs, cat. no. M0493S) Step 1 PCR primers; (Integrated DNA Technologies, custom synthesis; see Reagent Setup and – )

    DNA Synthesis:

    Article Title: Transcriptional profiles of drought-responsive genes in modulating transcription signal transduction, and biochemical pathways in tomato
    Article Snippet: Total RNA (5 μg) along with T7 -Oligo (dT)15 (Boya, China) was used for reverse transcription of double-stranded cDNA using the DNA Synthesis Kit (Promega, USA), then transcribed to cRNA in vitro using T7 RiboMAX Express Large Scale RNA Production System (Promega, USA). .. 2 μg of cRNA plus Random Primer 9 (New England Biolabs, USA) was used to produce cDNA by M-MLV (200 μ/μl, Invitrogen, USA).

    Synthesized:

    Article Title: RsmV, a Small Noncoding Regulatory RNA in Pseudomonas aeruginosa That Sequesters RsmA and RsmF from Target mRNAs
    Article Snippet: .. First-strand cDNA was synthesized using Superscript II (Thermo Fisher) according to the manufacturer's protocol with Random Primer 9 (NEB). .. The copy number of the indicated genes was determined by qPCR using SYBR green master mix (Bio-Rad).

    Quantitative RT-PCR:

    Article Title: Pseudomonas aeruginosa exoproducts determine antibiotic efficacy against Staphylococcus aureus
    Article Snippet: Paragraph title: qRT-PCR ... Five hundred nanograms of total RNA were used to generate cDNA using SuperScript II Reverse Transcriptase (ThermoFisher) and Random Primer 9 (NEB) following manufacturer’s protocol.

    Article Title: A Novel Zinc Binding System, ZevAB, Is Critical for Survival of Nontypeable Haemophilus influenzae in a Murine Lung Infection Model ▿ in a Murine Lung Infection Model ▿ †
    Article Snippet: Paragraph title: qRT-PCR. ... The RNA samples (5 μg) were used as templates for cDNA synthesis with Random Primer 9 (New England BioLabs, Beverley, MA) and SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA).

    SYBR Green Assay:

    Article Title: Ablation of SUN2-containing LINC complexes drives cardiac hypertrophy without interstitial fibrosis
    Article Snippet: To generate cDNA, equal amounts of digested total RNA (1 μg) were added to SuperScript III Reverse Transcriptase (Invitrogen) reactions using Random Primer 9 (New England Biolabs). .. Quantitative real-time PCR was conducted with a Bio-Rad CFX96 Real-Time System using the iQ SYBR Green Supermix (Bio-Rad) for 39 cycles.

    Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
    Article Snippet: Five hundred nanograms of total RNA were added to mixtures of 2.5 µM random primer 9 (NewEngland Biolabs, Beverly, MA), 500 µM dNTPs, 40 U RNase inhibitor (Takara Bio. .. The mRNA expression values of ESR1 , PGR , and HER2 were measured by a Quanti Tect SYBR Green PCR kit (Qiagen) with a Rotor-gene 6000 (Qiagen) at 95 °C for 15 min, followed by 45 cycles of 94 °C for 15 sec, 55 °C for 30 sec and 72 °C for 30 sec.

    Article Title: Blood-induced bone loss in murine hemophilic arthropathy is prevented by blocking the iRhom2/ADAM17/TNF-α pathway
    Article Snippet: Total RNA (600 ng per sample) was reverse transcribed into cDNA using 2.5 mM deoxynucleotide triphosphates, RNasin Plus (Promega, Madison, WI), and M-MuLV Reverse Transcriptase and Random Primer 9 (NEB, Ipswich, MA). .. Real-time quantitative polymerase chain reaction (qPCR) was performed on a StepOnePlus (Applied Biosystems, Foster City, CA) using SYBR Green (Thermo Scientific) and gapdh or trap primers (QuantiTect assay; QIAGEN).

    Article Title: RsmV, a Small Noncoding Regulatory RNA in Pseudomonas aeruginosa That Sequesters RsmA and RsmF from Target mRNAs
    Article Snippet: First-strand cDNA was synthesized using Superscript II (Thermo Fisher) according to the manufacturer's protocol with Random Primer 9 (NEB). .. The copy number of the indicated genes was determined by qPCR using SYBR green master mix (Bio-Rad).

    Article Title: Pseudomonas aeruginosa exoproducts determine antibiotic efficacy against Staphylococcus aureus
    Article Snippet: Five hundred nanograms of total RNA were used to generate cDNA using SuperScript II Reverse Transcriptase (ThermoFisher) and Random Primer 9 (NEB) following manufacturer’s protocol. .. Copy number of lasA and gyrA were quantified using iTaq Universal Sybr Green master mix (Bio-Rad) in 20 ul reaction volumes on a Roche LightCycler 96, using the following primer pairs: lasA_RT_5 5’-CCTGTTCCTCTACGGTCGCG-3’, lasA_RT_3 5’-GGTTGATGCTGTAGTAGCCG-3’, gyrA_5_RT 5’-GAAGCTGCTCTCCGAATACC-3’, gyrA_3_RT 5’-CAGTTCCTCACGGATCACCT-3’.

    Article Title: A Novel Zinc Binding System, ZevAB, Is Critical for Survival of Nontypeable Haemophilus influenzae in a Murine Lung Infection Model ▿ in a Murine Lung Infection Model ▿ †
    Article Snippet: The RNA samples (5 μg) were used as templates for cDNA synthesis with Random Primer 9 (New England BioLabs, Beverley, MA) and SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA). .. Quantitative reverse transcription-PCR (qRT-PCR) was performed with iQ SYBR green supermix (Bio-Rad Laboratories, Hercules, CA), and fluorescence was measured over time using the DNA Engine Opticon II system (MJ Research, Waltham, MA).

    Incubation:

    Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
    Article Snippet: Five hundred nanograms of total RNA were added to mixtures of 2.5 µM random primer 9 (NewEngland Biolabs, Beverly, MA), 500 µM dNTPs, 40 U RNase inhibitor (Takara Bio. .. Inc., Shiga, Japan) and 10 U M-MuLV reverse transcriptase (NewEngland Biolabs), and incubated at 42 °C for 60 min and then at 90 °C for 10 min.

    Article Title: RsmV, a Small Noncoding Regulatory RNA in Pseudomonas aeruginosa That Sequesters RsmA and RsmF from Target mRNAs
    Article Snippet: An aliquot was removed from the cleared lysate for total RNA isolation and preserved in TRIzol, and the remaining lysate was incubated with nickel-nitrilotriacetic acid (Ni-NTA)–agarose at 4°C for 1 h under nondenaturing binding conditions. .. First-strand cDNA was synthesized using Superscript II (Thermo Fisher) according to the manufacturer's protocol with Random Primer 9 (NEB).

    Article Title: Structural divergence creates new functional features in alphavirus genomes
    Article Snippet: .. Total purified RNAs were then incubated with 500 ng Random Primer 9 (NEB) at 65°C for 5 min, cooled to 0°C, and mixed with 10 mM dNTPs, 0.1 M DTT, 500 mM Tris pH 8.0, 750 KCl and 500 mM MnCl2 . .. The mix was then incubated at 42°C for 2 min, followed by the addition of 200 units of SuperScript II (Thermo Fisher Scientific) and a further incubation at 42°C for 180 min, heat inactivated at 70°C for 15 min, and then purified using illustra MicroSpin G-50 columns.

    Expressing:

    Article Title: Human Guanylate Binding Proteins Potentiate the Anti-Chlamydia Effects of Interferon-?
    Article Snippet: .. Real time PCR Expression of human Guanylate Binding Protein (GBP)-1, GBP2 and β-actin was assessed by isolating total RNA from 1×106 HeLa cells using the TRIZOL reagent per the manufacturer's instructions, followed by reverse transcription ( 500 ng total RNA, Superscript III Reverse Transcriptase system (Invitrogen cat #18080-044), nonamer Random Primer 9 (New England Biolabs cat #S1254S)) and quantitative real-time polymerase chain reaction PCR. .. The QuantiTect primers for the gene GBP-1 (NM_002053; cat #QT01669885 or #QT00011641) with a predicted amplicon length of 96 bp and custom designed primers for GBP2 (FWD 5′-GAC CAA ATG TTC CAG AGG AAA TTA GGG GC-3′ , REV 5′-AAT GTT CCC TGC TTG ACA TCT TCT TCT AAA GG-3′ ) were used.

    Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
    Article Snippet: Five hundred nanograms of total RNA were added to mixtures of 2.5 µM random primer 9 (NewEngland Biolabs, Beverly, MA), 500 µM dNTPs, 40 U RNase inhibitor (Takara Bio. .. The mRNA expression values of ESR1 , PGR , and HER2 were measured by a Quanti Tect SYBR Green PCR kit (Qiagen) with a Rotor-gene 6000 (Qiagen) at 95 °C for 15 min, followed by 45 cycles of 94 °C for 15 sec, 55 °C for 30 sec and 72 °C for 30 sec.

    Article Title: RsmV, a Small Noncoding Regulatory RNA in Pseudomonas aeruginosa That Sequesters RsmA and RsmF from Target mRNAs
    Article Snippet: Protein-containing fractions from the RsmAHis6 - or RsmFHis6 -expressing strains and an equivalent volume from the vector control strain were treated with TRIzol (Thermo Fisher), and RNA was extracted according to the manufacturer's protocol. .. First-strand cDNA was synthesized using Superscript II (Thermo Fisher) according to the manufacturer's protocol with Random Primer 9 (NEB).

    Article Title: Transcriptional profiles of drought-responsive genes in modulating transcription signal transduction, and biochemical pathways in tomato
    Article Snippet: Fluorescent probe preparation and hybridization Gene expression profiles of two selected drought-tolerant lines and M82 under drought stress and normal irrigated conditions were determined using tomato TOM2 arrays. .. 2 μg of cRNA plus Random Primer 9 (New England Biolabs, USA) was used to produce cDNA by M-MLV (200 μ/μl, Invitrogen, USA).

    Article Title: Gene-Silencing Screen for Mammalian Axon Regeneration Identifies Inpp5f (Sac2) as an Endogenous Suppressor of Repair after Spinal Cord Injury
    Article Snippet: Paragraph title: Characterization of INPP5F/Inpp5f mRNA expression. ... Total RNA was prepared according to the TRIzol reagent protocol. cDNA was then produced by assembling the following reverse transcription PCR: 1 μg of total RNA, 0.5 μl M-MuLV Reverse Transcriptase and 2.5 μl 10× buffer (enzyme at 200,000 U/ml stock concentration; catalog #M0253S; New England BioLabs), 1.5 μl Random Primer 9 (50 μ m stock; catalog #S1254S; New England BioLabs), 1 μl dNTP (10 m m stock' catalog #U151A; Promega), and brought to 25 μl total reaction volume with DEPC water.

    Modification:

    Article Title: Structural divergence creates new functional features in alphavirus genomes
    Article Snippet: Modified RNA was obtained by incubation of 2 μg of total RNA at 37°C for 15 min in the presence of 10 mM MgCl2 and 111 mM KCl, then treated with 100 nM of 1-methyl-7-nitroisatoicanhydride (1M7) for 5 min at 37°C. .. Total purified RNAs were then incubated with 500 ng Random Primer 9 (NEB) at 65°C for 5 min, cooled to 0°C, and mixed with 10 mM dNTPs, 0.1 M DTT, 500 mM Tris pH 8.0, 750 KCl and 500 mM MnCl2 .

    Hybridization:

    Article Title: Transcriptional profiles of drought-responsive genes in modulating transcription signal transduction, and biochemical pathways in tomato
    Article Snippet: Paragraph title: Fluorescent probe preparation and hybridization ... 2 μg of cRNA plus Random Primer 9 (New England Biolabs, USA) was used to produce cDNA by M-MLV (200 μ/μl, Invitrogen, USA).

    Countercurrent Chromatography:

    Article Title: Human Guanylate Binding Proteins Potentiate the Anti-Chlamydia Effects of Interferon-?
    Article Snippet: Real time PCR Expression of human Guanylate Binding Protein (GBP)-1, GBP2 and β-actin was assessed by isolating total RNA from 1×106 HeLa cells using the TRIZOL reagent per the manufacturer's instructions, followed by reverse transcription ( 500 ng total RNA, Superscript III Reverse Transcriptase system (Invitrogen cat #18080-044), nonamer Random Primer 9 (New England Biolabs cat #S1254S)) and quantitative real-time polymerase chain reaction PCR. .. The QuantiTect primers for the gene GBP-1 (NM_002053; cat #QT01669885 or #QT00011641) with a predicted amplicon length of 96 bp and custom designed primers for GBP2 (FWD 5′-GAC CAA ATG TTC CAG AGG AAA TTA GGG GC-3′ , REV 5′-AAT GTT CCC TGC TTG ACA TCT TCT TCT AAA GG-3′ ) were used.

    Polymerase Chain Reaction:

    Article Title: Human Guanylate Binding Proteins Potentiate the Anti-Chlamydia Effects of Interferon-?
    Article Snippet: .. Real time PCR Expression of human Guanylate Binding Protein (GBP)-1, GBP2 and β-actin was assessed by isolating total RNA from 1×106 HeLa cells using the TRIZOL reagent per the manufacturer's instructions, followed by reverse transcription ( 500 ng total RNA, Superscript III Reverse Transcriptase system (Invitrogen cat #18080-044), nonamer Random Primer 9 (New England Biolabs cat #S1254S)) and quantitative real-time polymerase chain reaction PCR. .. The QuantiTect primers for the gene GBP-1 (NM_002053; cat #QT01669885 or #QT00011641) with a predicted amplicon length of 96 bp and custom designed primers for GBP2 (FWD 5′-GAC CAA ATG TTC CAG AGG AAA TTA GGG GC-3′ , REV 5′-AAT GTT CCC TGC TTG ACA TCT TCT TCT AAA GG-3′ ) were used.

    Article Title: Ablation of SUN2-containing LINC complexes drives cardiac hypertrophy without interstitial fibrosis
    Article Snippet: To generate cDNA, equal amounts of digested total RNA (1 μg) were added to SuperScript III Reverse Transcriptase (Invitrogen) reactions using Random Primer 9 (New England Biolabs). .. PCR product levels were normalized to peptidylprolyl isomerase A (PPIA) or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA levels.

    Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
    Article Snippet: Five hundred nanograms of total RNA were added to mixtures of 2.5 µM random primer 9 (NewEngland Biolabs, Beverly, MA), 500 µM dNTPs, 40 U RNase inhibitor (Takara Bio. .. The mRNA expression values of ESR1 , PGR , and HER2 were measured by a Quanti Tect SYBR Green PCR kit (Qiagen) with a Rotor-gene 6000 (Qiagen) at 95 °C for 15 min, followed by 45 cycles of 94 °C for 15 sec, 55 °C for 30 sec and 72 °C for 30 sec.

    Article Title: Sexual and asexual oogenesis require the expression of unique and shared sets of genes in the insect Acyrthosiphon pisum
    Article Snippet: .. First strand cDNAs were produced from 1 μg of total RNAs by using random primer 9 (New England BioLabs) and SuperScript® III Reverse Transcriptase (Invitrogen) following the supplier's instructions. cDNAs were used as a matrix for PCR amplification with specific primers (Additional file ). .. Amplified fragments were cloned into the StrataClone PCR Cloning Vector pSC-A-amp/kan (StrataClone) or pENTR Directional TOPO (Invitrogen) and sequenced (Genoscreen).

    Article Title: Ferroptosis as a p53-mediated activity during tumour suppression
    Article Snippet: One microgram of total RNA was reverse transcribed by M-MuLV reverse transcriptase and Random Primer 9 (NEB) following manufacturer's protocol. .. Semi-quantitative RT–PCR was performed using Advantage 2 PCR kit (Clontech) within the linear range of PCR cycles for each primer pair.

    Article Title: Selective 2′-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile, and accurate RNA structure analysis
    Article Snippet: .. Dithiothreitol (DTT; Fisher Bioreagents, cat. no. BP172-5) Turbo DNase Reaction Buffer (10×, Life Technologies, cat. no. AM2238) Turbo DNase (2 U/μl, Life Technologies, cat. no. AM2238) RNeasy Mini Kit (Qiagen, cat. no. 74104) Deoxynucleotide triphosphates (dNTPs; 10 mM each nucleotide, New England Biolabs, cat. no. N0447S) SuperScript II reverse transcriptase (200 U/μl, Life Technologies, cat. no. 18064-014) Reverse transcription primer (custom synthesis) Random nonamers (New England Biolabs, cat. no. S1254S) LNA+ primers (custom synthesis) Q5 Reaction Buffer (5×, New England Biolabs, cat. no. M0493S) Q5 Hot Start High-Fidelity DNA Polymerase (2,000 U/ml, New England Biolabs, cat. no. M0493S) Step 1 PCR primers; (Integrated DNA Technologies, custom synthesis; see Reagent Setup and – ) .. (333 mM HEPES, pH 8.0; 333 mM NaCl; 33 mM MgCl2 ) This solution is suitable for refolding many in vitro -transcribed RNAs.

    Article Title: Gene-Silencing Screen for Mammalian Axon Regeneration Identifies Inpp5f (Sac2) as an Endogenous Suppressor of Repair after Spinal Cord Injury
    Article Snippet: .. Total RNA was prepared according to the TRIzol reagent protocol. cDNA was then produced by assembling the following reverse transcription PCR: 1 μg of total RNA, 0.5 μl M-MuLV Reverse Transcriptase and 2.5 μl 10× buffer (enzyme at 200,000 U/ml stock concentration; catalog #M0253S; New England BioLabs), 1.5 μl Random Primer 9 (50 μ m stock; catalog #S1254S; New England BioLabs), 1 μl dNTP (10 m m stock' catalog #U151A; Promega), and brought to 25 μl total reaction volume with DEPC water. .. PCR program is 30°C for 10 min, 42°C for 40 min, and 99°C for 5 min. cDNA of each sample was then used for real-time qPCR in the following reaction: 1 μl cDNA, 5 μl iQ master mix (catalog #170-8860; Bio-Rad), 3.5 μl ddH2 O, and 0.5 μl gene expression assay targeting mouse Inpp5f (20× stock, Mm00724391 m1p Life Technologies). qPCR was performed on a Bio-Rad CFX Connect Real-Time PCR Detection System using standard cycles.

    Negative Control:

    Article Title: Structural divergence creates new functional features in alphavirus genomes
    Article Snippet: Negative control RNA was obtained by incubation of 2 μg total RNA at 37°C for 15 min, then incubated with 5 μl DMSO for 5 min at 37°C. .. Total purified RNAs were then incubated with 500 ng Random Primer 9 (NEB) at 65°C for 5 min, cooled to 0°C, and mixed with 10 mM dNTPs, 0.1 M DTT, 500 mM Tris pH 8.0, 750 KCl and 500 mM MnCl2 .

    Isolation:

    Article Title: Ablation of SUN2-containing LINC complexes drives cardiac hypertrophy without interstitial fibrosis
    Article Snippet: Total RNA was isolated using the RNeasy kit (QIAGEN) according to manufacturer’s instructions. .. To generate cDNA, equal amounts of digested total RNA (1 μg) were added to SuperScript III Reverse Transcriptase (Invitrogen) reactions using Random Primer 9 (New England Biolabs).

    Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
    Article Snippet: Total RNA was isolated using the RNeasy mini kit (Qiagen) as described previously . .. Five hundred nanograms of total RNA were added to mixtures of 2.5 µM random primer 9 (NewEngland Biolabs, Beverly, MA), 500 µM dNTPs, 40 U RNase inhibitor (Takara Bio.

    Article Title: Blood-induced bone loss in murine hemophilic arthropathy is prevented by blocking the iRhom2/ADAM17/TNF-α pathway
    Article Snippet: Total RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA). .. Total RNA (600 ng per sample) was reverse transcribed into cDNA using 2.5 mM deoxynucleotide triphosphates, RNasin Plus (Promega, Madison, WI), and M-MuLV Reverse Transcriptase and Random Primer 9 (NEB, Ipswich, MA).

    Article Title: RsmV, a Small Noncoding Regulatory RNA in Pseudomonas aeruginosa That Sequesters RsmA and RsmF from Target mRNAs
    Article Snippet: An aliquot was removed from the cleared lysate for total RNA isolation and preserved in TRIzol, and the remaining lysate was incubated with nickel-nitrilotriacetic acid (Ni-NTA)–agarose at 4°C for 1 h under nondenaturing binding conditions. .. First-strand cDNA was synthesized using Superscript II (Thermo Fisher) according to the manufacturer's protocol with Random Primer 9 (NEB).

    Article Title: Ferroptosis as a p53-mediated activity during tumour suppression
    Article Snippet: Total RNA was isolated using TRIzol (Invitrogen) according to the manufacturer's protocol. .. One microgram of total RNA was reverse transcribed by M-MuLV reverse transcriptase and Random Primer 9 (NEB) following manufacturer's protocol.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Sexual and asexual oogenesis require the expression of unique and shared sets of genes in the insect Acyrthosiphon pisum
    Article Snippet: Riboprobe synthesis for in situ hybridization Templates for synthesis of riboprobes were obtained from full-length cDNAs collection (ACYPI003103, ACYPI010052 [ ]) or amplified by RT-PCR and cloned (Additional file ). .. First strand cDNAs were produced from 1 μg of total RNAs by using random primer 9 (New England BioLabs) and SuperScript® III Reverse Transcriptase (Invitrogen) following the supplier's instructions. cDNAs were used as a matrix for PCR amplification with specific primers (Additional file ).

    Article Title: Ferroptosis as a p53-mediated activity during tumour suppression
    Article Snippet: Paragraph title: RNA extraction, RT–PCR and sequencing of tumour samples ... One microgram of total RNA was reverse transcribed by M-MuLV reverse transcriptase and Random Primer 9 (NEB) following manufacturer's protocol.

    Binding Assay:

    Article Title: Human Guanylate Binding Proteins Potentiate the Anti-Chlamydia Effects of Interferon-?
    Article Snippet: .. Real time PCR Expression of human Guanylate Binding Protein (GBP)-1, GBP2 and β-actin was assessed by isolating total RNA from 1×106 HeLa cells using the TRIZOL reagent per the manufacturer's instructions, followed by reverse transcription ( 500 ng total RNA, Superscript III Reverse Transcriptase system (Invitrogen cat #18080-044), nonamer Random Primer 9 (New England Biolabs cat #S1254S)) and quantitative real-time polymerase chain reaction PCR. .. The QuantiTect primers for the gene GBP-1 (NM_002053; cat #QT01669885 or #QT00011641) with a predicted amplicon length of 96 bp and custom designed primers for GBP2 (FWD 5′-GAC CAA ATG TTC CAG AGG AAA TTA GGG GC-3′ , REV 5′-AAT GTT CCC TGC TTG ACA TCT TCT TCT AAA GG-3′ ) were used.

    Article Title: RsmV, a Small Noncoding Regulatory RNA in Pseudomonas aeruginosa That Sequesters RsmA and RsmF from Target mRNAs
    Article Snippet: Ni-NTA–agarose was then loaded into a column and washed 3 times with nondenaturing binding buffer containing 10 mM imidazole. .. First-strand cDNA was synthesized using Superscript II (Thermo Fisher) according to the manufacturer's protocol with Random Primer 9 (NEB).

    Cellular Antioxidant Activity Assay:

    Article Title: Human Guanylate Binding Proteins Potentiate the Anti-Chlamydia Effects of Interferon-?
    Article Snippet: Real time PCR Expression of human Guanylate Binding Protein (GBP)-1, GBP2 and β-actin was assessed by isolating total RNA from 1×106 HeLa cells using the TRIZOL reagent per the manufacturer's instructions, followed by reverse transcription ( 500 ng total RNA, Superscript III Reverse Transcriptase system (Invitrogen cat #18080-044), nonamer Random Primer 9 (New England Biolabs cat #S1254S)) and quantitative real-time polymerase chain reaction PCR. .. The QuantiTect primers for the gene GBP-1 (NM_002053; cat #QT01669885 or #QT00011641) with a predicted amplicon length of 96 bp and custom designed primers for GBP2 (FWD 5′-GAC CAA ATG TTC CAG AGG AAA TTA GGG GC-3′ , REV 5′-AAT GTT CCC TGC TTG ACA TCT TCT TCT AAA GG-3′ ) were used.

    Fluorescence:

    Article Title: A Novel Zinc Binding System, ZevAB, Is Critical for Survival of Nontypeable Haemophilus influenzae in a Murine Lung Infection Model ▿ in a Murine Lung Infection Model ▿ †
    Article Snippet: The RNA samples (5 μg) were used as templates for cDNA synthesis with Random Primer 9 (New England BioLabs, Beverley, MA) and SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA). .. Quantitative reverse transcription-PCR (qRT-PCR) was performed with iQ SYBR green supermix (Bio-Rad Laboratories, Hercules, CA), and fluorescence was measured over time using the DNA Engine Opticon II system (MJ Research, Waltham, MA).

    Aqueous Normal-phase Chromatography:

    Article Title: Ablation of SUN2-containing LINC complexes drives cardiac hypertrophy without interstitial fibrosis
    Article Snippet: To generate cDNA, equal amounts of digested total RNA (1 μg) were added to SuperScript III Reverse Transcriptase (Invitrogen) reactions using Random Primer 9 (New England Biolabs). .. Primers used in these experiments were ANP forward: CAAGATGCAG­AAGCTGCTGG and reverse: GTGCTGCCTTGAGACCGAAGG; BNP forward: GTTTGGG­CTGTAACGCACTGA and reverse: GAAAGAGACCCAGGCAGA­GTCA; Skeletal α-actin forward: CATGAAGATCAAGATCATCGC and reverse: CTGGAAGGTGGACAGCGAGGC; Serca2 forward: GTGTGGCAGGAAAGAAATGC and reverse: CCAGGAACTATGTCTTTAGC; FN1 forward: TTCA­AGTGTGATCCCCATGAAG and reverse: CAGGTCTACGGCAGTTGTCA; COL1A1 forward: CTGGCGGTTCAGGT­CCAAT and reverse: TTCAGGCAATCCAGAGC; COL3A1 forward: CTGTAACATGG­AA­ACTGGGGAAA and ereverse: CCAT­AGCTGAACTGAAAACCACC; POSTN forward: CCTGCCCTTATATGCTCTGCT and reverse: AAACATGGTCAATAGGCATCACT; LTBP2 forward: GCTCACCGGGA­GAAATGTCTG and reverse: CAGGTTTGATACAGTGGTTGGT; LOXL1 forward: GAGTGCTATTGCGCTT­CCC and reverse: GGTTGCCGAAGTCACAGGT; FLNA forward: GGCTACGGTGGGCTTAGTC and reverse: GTGGGACAGTAGGTGACCCT; DES forward: TACACCTGCGAGATTGATGC and reverse: ACATCCAAGGCCATCTTCAC; GAPDH forward: CGTAGAC­AAAATGGTGAAG­GTCGG and reverse: AAGCAGTTGGTGGTGCAGGATG; and PPIA forward: GAGCTGTTTGCAGACAAAGTTC and reverse: CCCTGGCACATGAATCCTGG.

    Size-exclusion Chromatography:

    Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
    Article Snippet: Five hundred nanograms of total RNA were added to mixtures of 2.5 µM random primer 9 (NewEngland Biolabs, Beverly, MA), 500 µM dNTPs, 40 U RNase inhibitor (Takara Bio. .. The mRNA expression values of ESR1 , PGR , and HER2 were measured by a Quanti Tect SYBR Green PCR kit (Qiagen) with a Rotor-gene 6000 (Qiagen) at 95 °C for 15 min, followed by 45 cycles of 94 °C for 15 sec, 55 °C for 30 sec and 72 °C for 30 sec.

    Purification:

    Article Title: Structural divergence creates new functional features in alphavirus genomes
    Article Snippet: .. Total purified RNAs were then incubated with 500 ng Random Primer 9 (NEB) at 65°C for 5 min, cooled to 0°C, and mixed with 10 mM dNTPs, 0.1 M DTT, 500 mM Tris pH 8.0, 750 KCl and 500 mM MnCl2 . .. The mix was then incubated at 42°C for 2 min, followed by the addition of 200 units of SuperScript II (Thermo Fisher Scientific) and a further incubation at 42°C for 180 min, heat inactivated at 70°C for 15 min, and then purified using illustra MicroSpin G-50 columns.

    Article Title: Sexual and asexual oogenesis require the expression of unique and shared sets of genes in the insect Acyrthosiphon pisum
    Article Snippet: First strand cDNAs were produced from 1 μg of total RNAs by using random primer 9 (New England BioLabs) and SuperScript® III Reverse Transcriptase (Invitrogen) following the supplier's instructions. cDNAs were used as a matrix for PCR amplification with specific primers (Additional file ). .. Remaining DNA was removed with RQ1 RNase-free DNAse treatment (Promega) and riboprobes were purified with the RNeasy mini kit (Qiagen).

    Sequencing:

    Article Title: Sexual and asexual oogenesis require the expression of unique and shared sets of genes in the insect Acyrthosiphon pisum
    Article Snippet: First strand cDNAs were produced from 1 μg of total RNAs by using random primer 9 (New England BioLabs) and SuperScript® III Reverse Transcriptase (Invitrogen) following the supplier's instructions. cDNAs were used as a matrix for PCR amplification with specific primers (Additional file ). .. Linear PCR products were amplified from cloned sequence with universal primers M13 and used as a matrix for synthesis of sense and antisense riboprobes by using digoxigenin-labelled dNTPs and the appropriate RNA polymerase (T3/T7/SP6) supplied in the DIG RNA labelling kit (Roche).

    Article Title: Ferroptosis as a p53-mediated activity during tumour suppression
    Article Snippet: Paragraph title: RNA extraction, RT–PCR and sequencing of tumour samples ... One microgram of total RNA was reverse transcribed by M-MuLV reverse transcriptase and Random Primer 9 (NEB) following manufacturer's protocol.

    Mouse Assay:

    Article Title: Ablation of SUN2-containing LINC complexes drives cardiac hypertrophy without interstitial fibrosis
    Article Snippet: qPCR Following heart isolation and PBS perfusion, ventricular cardiac tissue was isolated from 13-mo-old WT and Sun2-/- mice or P54/P55 WT and Sun2-/- mice, minced, and homogenized in TRIzol (Invitrogen). .. To generate cDNA, equal amounts of digested total RNA (1 μg) were added to SuperScript III Reverse Transcriptase (Invitrogen) reactions using Random Primer 9 (New England Biolabs).

    Article Title: Gene-Silencing Screen for Mammalian Axon Regeneration Identifies Inpp5f (Sac2) as an Endogenous Suppressor of Repair after Spinal Cord Injury
    Article Snippet: To quantify levels of Inpp5f mRNA expression in different brain regions before or 7 d after SCI, mice were deeply anesthetized by CO2 and decapitated. .. Total RNA was prepared according to the TRIzol reagent protocol. cDNA was then produced by assembling the following reverse transcription PCR: 1 μg of total RNA, 0.5 μl M-MuLV Reverse Transcriptase and 2.5 μl 10× buffer (enzyme at 200,000 U/ml stock concentration; catalog #M0253S; New England BioLabs), 1.5 μl Random Primer 9 (50 μ m stock; catalog #S1254S; New England BioLabs), 1 μl dNTP (10 m m stock' catalog #U151A; Promega), and brought to 25 μl total reaction volume with DEPC water.

    In Situ Hybridization:

    Article Title: Sexual and asexual oogenesis require the expression of unique and shared sets of genes in the insect Acyrthosiphon pisum
    Article Snippet: Paragraph title: Riboprobe synthesis for in situ hybridization ... First strand cDNAs were produced from 1 μg of total RNAs by using random primer 9 (New England BioLabs) and SuperScript® III Reverse Transcriptase (Invitrogen) following the supplier's instructions. cDNAs were used as a matrix for PCR amplification with specific primers (Additional file ).

    Plasmid Preparation:

    Article Title: RsmV, a Small Noncoding Regulatory RNA in Pseudomonas aeruginosa That Sequesters RsmA and RsmF from Target mRNAs
    Article Snippet: Protein-containing fractions from the RsmAHis6 - or RsmFHis6 -expressing strains and an equivalent volume from the vector control strain were treated with TRIzol (Thermo Fisher), and RNA was extracted according to the manufacturer's protocol. .. First-strand cDNA was synthesized using Superscript II (Thermo Fisher) according to the manufacturer's protocol with Random Primer 9 (NEB).

    Article Title: Sexual and asexual oogenesis require the expression of unique and shared sets of genes in the insect Acyrthosiphon pisum
    Article Snippet: First strand cDNAs were produced from 1 μg of total RNAs by using random primer 9 (New England BioLabs) and SuperScript® III Reverse Transcriptase (Invitrogen) following the supplier's instructions. cDNAs were used as a matrix for PCR amplification with specific primers (Additional file ). .. Amplified fragments were cloned into the StrataClone PCR Cloning Vector pSC-A-amp/kan (StrataClone) or pENTR Directional TOPO (Invitrogen) and sequenced (Genoscreen).

    Real-time Polymerase Chain Reaction:

    Article Title: Human Guanylate Binding Proteins Potentiate the Anti-Chlamydia Effects of Interferon-?
    Article Snippet: .. Real time PCR Expression of human Guanylate Binding Protein (GBP)-1, GBP2 and β-actin was assessed by isolating total RNA from 1×106 HeLa cells using the TRIZOL reagent per the manufacturer's instructions, followed by reverse transcription ( 500 ng total RNA, Superscript III Reverse Transcriptase system (Invitrogen cat #18080-044), nonamer Random Primer 9 (New England Biolabs cat #S1254S)) and quantitative real-time polymerase chain reaction PCR. .. The QuantiTect primers for the gene GBP-1 (NM_002053; cat #QT01669885 or #QT00011641) with a predicted amplicon length of 96 bp and custom designed primers for GBP2 (FWD 5′-GAC CAA ATG TTC CAG AGG AAA TTA GGG GC-3′ , REV 5′-AAT GTT CCC TGC TTG ACA TCT TCT TCT AAA GG-3′ ) were used.

    Article Title: Ablation of SUN2-containing LINC complexes drives cardiac hypertrophy without interstitial fibrosis
    Article Snippet: Paragraph title: qPCR ... To generate cDNA, equal amounts of digested total RNA (1 μg) were added to SuperScript III Reverse Transcriptase (Invitrogen) reactions using Random Primer 9 (New England Biolabs).

    Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
    Article Snippet: Five hundred nanograms of total RNA were added to mixtures of 2.5 µM random primer 9 (NewEngland Biolabs, Beverly, MA), 500 µM dNTPs, 40 U RNase inhibitor (Takara Bio. .. The primers used for quantitative PCR (qPCR) are shown in Supplementary Table .

    Article Title: Blood-induced bone loss in murine hemophilic arthropathy is prevented by blocking the iRhom2/ADAM17/TNF-α pathway
    Article Snippet: Total RNA (600 ng per sample) was reverse transcribed into cDNA using 2.5 mM deoxynucleotide triphosphates, RNasin Plus (Promega, Madison, WI), and M-MuLV Reverse Transcriptase and Random Primer 9 (NEB, Ipswich, MA). .. Real-time quantitative polymerase chain reaction (qPCR) was performed on a StepOnePlus (Applied Biosystems, Foster City, CA) using SYBR Green (Thermo Scientific) and gapdh or trap primers (QuantiTect assay; QIAGEN).

    Article Title: RsmV, a Small Noncoding Regulatory RNA in Pseudomonas aeruginosa That Sequesters RsmA and RsmF from Target mRNAs
    Article Snippet: First-strand cDNA was synthesized using Superscript II (Thermo Fisher) according to the manufacturer's protocol with Random Primer 9 (NEB). .. The copy number of the indicated genes was determined by qPCR using SYBR green master mix (Bio-Rad).

    Article Title: Ferroptosis as a p53-mediated activity during tumour suppression
    Article Snippet: One microgram of total RNA was reverse transcribed by M-MuLV reverse transcriptase and Random Primer 9 (NEB) following manufacturer's protocol. .. Quantitative PCR was done using a 7500 Fast Real-Time PCR System (Applied Biosystems) with standard protocol.

    Article Title: Gene-Silencing Screen for Mammalian Axon Regeneration Identifies Inpp5f (Sac2) as an Endogenous Suppressor of Repair after Spinal Cord Injury
    Article Snippet: Total RNA was prepared according to the TRIzol reagent protocol. cDNA was then produced by assembling the following reverse transcription PCR: 1 μg of total RNA, 0.5 μl M-MuLV Reverse Transcriptase and 2.5 μl 10× buffer (enzyme at 200,000 U/ml stock concentration; catalog #M0253S; New England BioLabs), 1.5 μl Random Primer 9 (50 μ m stock; catalog #S1254S; New England BioLabs), 1 μl dNTP (10 m m stock' catalog #U151A; Promega), and brought to 25 μl total reaction volume with DEPC water. .. PCR program is 30°C for 10 min, 42°C for 40 min, and 99°C for 5 min. cDNA of each sample was then used for real-time qPCR in the following reaction: 1 μl cDNA, 5 μl iQ master mix (catalog #170-8860; Bio-Rad), 3.5 μl ddH2 O, and 0.5 μl gene expression assay targeting mouse Inpp5f (20× stock, Mm00724391 m1p Life Technologies). qPCR was performed on a Bio-Rad CFX Connect Real-Time PCR Detection System using standard cycles.

    RNA Extraction:

    Article Title: Ferroptosis as a p53-mediated activity during tumour suppression
    Article Snippet: Paragraph title: RNA extraction, RT–PCR and sequencing of tumour samples ... One microgram of total RNA was reverse transcribed by M-MuLV reverse transcriptase and Random Primer 9 (NEB) following manufacturer's protocol.

    shRNA:

    Article Title: Gene-Silencing Screen for Mammalian Axon Regeneration Identifies Inpp5f (Sac2) as an Endogenous Suppressor of Repair after Spinal Cord Injury
    Article Snippet: To quantify the extent of Inpp5f gene knockdown after treating with lentiviral shRNA particles, total RNA was harvested from cortical culture in 96-well plates 3 d after adding viruses by applying 30 μl of TRIzol reagent (catalog #15596-026; Life Technologies) to each well. .. Total RNA was prepared according to the TRIzol reagent protocol. cDNA was then produced by assembling the following reverse transcription PCR: 1 μg of total RNA, 0.5 μl M-MuLV Reverse Transcriptase and 2.5 μl 10× buffer (enzyme at 200,000 U/ml stock concentration; catalog #M0253S; New England BioLabs), 1.5 μl Random Primer 9 (50 μ m stock; catalog #S1254S; New England BioLabs), 1 μl dNTP (10 m m stock' catalog #U151A; Promega), and brought to 25 μl total reaction volume with DEPC water.

    In Vitro:

    Article Title: Selective 2′-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile, and accurate RNA structure analysis
    Article Snippet: The 5 μM concentration is convenient for in vitro studies; however, much lower concentrations of RNA can be probed using the Small RNA and Amplicon workflows. .. Dithiothreitol (DTT; Fisher Bioreagents, cat. no. BP172-5) Turbo DNase Reaction Buffer (10×, Life Technologies, cat. no. AM2238) Turbo DNase (2 U/μl, Life Technologies, cat. no. AM2238) RNeasy Mini Kit (Qiagen, cat. no. 74104) Deoxynucleotide triphosphates (dNTPs; 10 mM each nucleotide, New England Biolabs, cat. no. N0447S) SuperScript II reverse transcriptase (200 U/μl, Life Technologies, cat. no. 18064-014) Reverse transcription primer (custom synthesis) Random nonamers (New England Biolabs, cat. no. S1254S) LNA+ primers (custom synthesis) Q5 Reaction Buffer (5×, New England Biolabs, cat. no. M0493S) Q5 Hot Start High-Fidelity DNA Polymerase (2,000 U/ml, New England Biolabs, cat. no. M0493S) Step 1 PCR primers; (Integrated DNA Technologies, custom synthesis; see Reagent Setup and – )

    Article Title: Transcriptional profiles of drought-responsive genes in modulating transcription signal transduction, and biochemical pathways in tomato
    Article Snippet: Total RNA (5 μg) along with T7 -Oligo (dT)15 (Boya, China) was used for reverse transcription of double-stranded cDNA using the DNA Synthesis Kit (Promega, USA), then transcribed to cRNA in vitro using T7 RiboMAX Express Large Scale RNA Production System (Promega, USA). .. 2 μg of cRNA plus Random Primer 9 (New England Biolabs, USA) was used to produce cDNA by M-MLV (200 μ/μl, Invitrogen, USA).

    Produced:

    Article Title: Sexual and asexual oogenesis require the expression of unique and shared sets of genes in the insect Acyrthosiphon pisum
    Article Snippet: .. First strand cDNAs were produced from 1 μg of total RNAs by using random primer 9 (New England BioLabs) and SuperScript® III Reverse Transcriptase (Invitrogen) following the supplier's instructions. cDNAs were used as a matrix for PCR amplification with specific primers (Additional file ). .. Amplified fragments were cloned into the StrataClone PCR Cloning Vector pSC-A-amp/kan (StrataClone) or pENTR Directional TOPO (Invitrogen) and sequenced (Genoscreen).

    Article Title: Gene-Silencing Screen for Mammalian Axon Regeneration Identifies Inpp5f (Sac2) as an Endogenous Suppressor of Repair after Spinal Cord Injury
    Article Snippet: .. Total RNA was prepared according to the TRIzol reagent protocol. cDNA was then produced by assembling the following reverse transcription PCR: 1 μg of total RNA, 0.5 μl M-MuLV Reverse Transcriptase and 2.5 μl 10× buffer (enzyme at 200,000 U/ml stock concentration; catalog #M0253S; New England BioLabs), 1.5 μl Random Primer 9 (50 μ m stock; catalog #S1254S; New England BioLabs), 1 μl dNTP (10 m m stock' catalog #U151A; Promega), and brought to 25 μl total reaction volume with DEPC water. .. PCR program is 30°C for 10 min, 42°C for 40 min, and 99°C for 5 min. cDNA of each sample was then used for real-time qPCR in the following reaction: 1 μl cDNA, 5 μl iQ master mix (catalog #170-8860; Bio-Rad), 3.5 μl ddH2 O, and 0.5 μl gene expression assay targeting mouse Inpp5f (20× stock, Mm00724391 m1p Life Technologies). qPCR was performed on a Bio-Rad CFX Connect Real-Time PCR Detection System using standard cycles.

    Concentration Assay:

    Article Title: Selective 2′-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile, and accurate RNA structure analysis
    Article Snippet: The 5 μM concentration is convenient for in vitro studies; however, much lower concentrations of RNA can be probed using the Small RNA and Amplicon workflows. .. Dithiothreitol (DTT; Fisher Bioreagents, cat. no. BP172-5) Turbo DNase Reaction Buffer (10×, Life Technologies, cat. no. AM2238) Turbo DNase (2 U/μl, Life Technologies, cat. no. AM2238) RNeasy Mini Kit (Qiagen, cat. no. 74104) Deoxynucleotide triphosphates (dNTPs; 10 mM each nucleotide, New England Biolabs, cat. no. N0447S) SuperScript II reverse transcriptase (200 U/μl, Life Technologies, cat. no. 18064-014) Reverse transcription primer (custom synthesis) Random nonamers (New England Biolabs, cat. no. S1254S) LNA+ primers (custom synthesis) Q5 Reaction Buffer (5×, New England Biolabs, cat. no. M0493S) Q5 Hot Start High-Fidelity DNA Polymerase (2,000 U/ml, New England Biolabs, cat. no. M0493S) Step 1 PCR primers; (Integrated DNA Technologies, custom synthesis; see Reagent Setup and – )

    Article Title: Transcriptional profiles of drought-responsive genes in modulating transcription signal transduction, and biochemical pathways in tomato
    Article Snippet: 2 μg of cRNA plus Random Primer 9 (New England Biolabs, USA) was used to produce cDNA by M-MLV (200 μ/μl, Invitrogen, USA). .. Finally, a 2 μg cDNA aliquot, along with Random Primer 9, 120 μM final concentration of each dATP, dGTP, dTTP, 60 μM final concentration dCTP and 40 μM final concentration of Cy5-dCTP, Cy3-dCTP was used to produce Cy5/Cy3-labelled cDNAs by KLENOW (Takara, Japan).

    Article Title: Gene-Silencing Screen for Mammalian Axon Regeneration Identifies Inpp5f (Sac2) as an Endogenous Suppressor of Repair after Spinal Cord Injury
    Article Snippet: .. Total RNA was prepared according to the TRIzol reagent protocol. cDNA was then produced by assembling the following reverse transcription PCR: 1 μg of total RNA, 0.5 μl M-MuLV Reverse Transcriptase and 2.5 μl 10× buffer (enzyme at 200,000 U/ml stock concentration; catalog #M0253S; New England BioLabs), 1.5 μl Random Primer 9 (50 μ m stock; catalog #S1254S; New England BioLabs), 1 μl dNTP (10 m m stock' catalog #U151A; Promega), and brought to 25 μl total reaction volume with DEPC water. .. PCR program is 30°C for 10 min, 42°C for 40 min, and 99°C for 5 min. cDNA of each sample was then used for real-time qPCR in the following reaction: 1 μl cDNA, 5 μl iQ master mix (catalog #170-8860; Bio-Rad), 3.5 μl ddH2 O, and 0.5 μl gene expression assay targeting mouse Inpp5f (20× stock, Mm00724391 m1p Life Technologies). qPCR was performed on a Bio-Rad CFX Connect Real-Time PCR Detection System using standard cycles.

    Lysis:

    Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
    Article Snippet: Briefly, the frozen breast cancer tissues were minced, placed into a tube containing beads, and homogenized in 9 volumes of lysis buffer with a Retsch MM300 (Qiagen, Hilden, Germany) mixer mill. .. Five hundred nanograms of total RNA were added to mixtures of 2.5 µM random primer 9 (NewEngland Biolabs, Beverly, MA), 500 µM dNTPs, 40 U RNase inhibitor (Takara Bio.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs random hexamer primers
    Random Hexamer Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/random hexamer primers/product/New England Biolabs
    Average 90 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    random hexamer primers - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results