transferrin expression  (Sino Biological)


Bioz Verified Symbol Sino Biological is a verified supplier
Bioz Manufacturer Symbol Sino Biological manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Name:
    Transferrin cDNA ORF Clone Rat C His tag
    Description:
    Full length Clone DNA of Rat transferrin with C terminal His tag
    Catalog Number:
    rg80586-ch
    Price:
    215.0
    Applications:
    Stable or Transient mammalian expression
    Size:
    1Unit
    Category:
    cDNA Clone
    Molecule Name:
    TF,F3,Transferrin,
    Buy from Supplier


    Structured Review

    Sino Biological transferrin expression
    Effects of <t>transferrin</t> overexpression and knockdown on atherosclerotic development and hypercoagulability. a–f Plasma concentrations of transferrin in five groups of Apoe −/− mice fed a HFD for 6 weeks (transferrin overexpression (PLP-Tf) and its blank PLP, knockdown (RNR-Tf) and its blank RNR, and normal Apoe −/− mice (NC)) ( a ). Relative activity of thrombin ( b ) and FXIIa ( c ), APTT ( d ), PT ( e ) in their plasma and tail bleeding time ( f ) are also shown. g Representative images of carotid artery blood flow (top) in FeCl 3 -treated mice by laser speckle perfusion imaging, and the region of interest (green rectangle) was placed in the carotid artery to quantify blood flow change. Relative blood flow in the region of interest is shown (bottom) by using perfusion unit. Red: blood flow; Blue and black area: background; The color bar on the right side indicates the perfusion unit scale (0–302). h Representative images of oil-red O-stained atherosclerotic plaques (top) and quantitative analysis of stained area (bottom) are shown. Data represent mean ± SD ( n = 6), ** P
    Full length Clone DNA of Rat transferrin with C terminal His tag
    https://www.bioz.com/result/transferrin expression/product/Sino Biological
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    transferrin expression - by Bioz Stars, 2021-02
    92/100 stars

    Images

    1) Product Images from "Transferrin plays a central role in coagulation balance by interacting with clotting factors"

    Article Title: Transferrin plays a central role in coagulation balance by interacting with clotting factors

    Journal: Cell Research

    doi: 10.1038/s41422-019-0260-6

    Effects of transferrin overexpression and knockdown on atherosclerotic development and hypercoagulability. a–f Plasma concentrations of transferrin in five groups of Apoe −/− mice fed a HFD for 6 weeks (transferrin overexpression (PLP-Tf) and its blank PLP, knockdown (RNR-Tf) and its blank RNR, and normal Apoe −/− mice (NC)) ( a ). Relative activity of thrombin ( b ) and FXIIa ( c ), APTT ( d ), PT ( e ) in their plasma and tail bleeding time ( f ) are also shown. g Representative images of carotid artery blood flow (top) in FeCl 3 -treated mice by laser speckle perfusion imaging, and the region of interest (green rectangle) was placed in the carotid artery to quantify blood flow change. Relative blood flow in the region of interest is shown (bottom) by using perfusion unit. Red: blood flow; Blue and black area: background; The color bar on the right side indicates the perfusion unit scale (0–302). h Representative images of oil-red O-stained atherosclerotic plaques (top) and quantitative analysis of stained area (bottom) are shown. Data represent mean ± SD ( n = 6), ** P
    Figure Legend Snippet: Effects of transferrin overexpression and knockdown on atherosclerotic development and hypercoagulability. a–f Plasma concentrations of transferrin in five groups of Apoe −/− mice fed a HFD for 6 weeks (transferrin overexpression (PLP-Tf) and its blank PLP, knockdown (RNR-Tf) and its blank RNR, and normal Apoe −/− mice (NC)) ( a ). Relative activity of thrombin ( b ) and FXIIa ( c ), APTT ( d ), PT ( e ) in their plasma and tail bleeding time ( f ) are also shown. g Representative images of carotid artery blood flow (top) in FeCl 3 -treated mice by laser speckle perfusion imaging, and the region of interest (green rectangle) was placed in the carotid artery to quantify blood flow change. Relative blood flow in the region of interest is shown (bottom) by using perfusion unit. Red: blood flow; Blue and black area: background; The color bar on the right side indicates the perfusion unit scale (0–302). h Representative images of oil-red O-stained atherosclerotic plaques (top) and quantitative analysis of stained area (bottom) are shown. Data represent mean ± SD ( n = 6), ** P

    Techniques Used: Over Expression, Mouse Assay, Plasmid Purification, Activity Assay, Imaging, Staining

    Transferrin interferences exert anti-AS effects in vivo. The HFD-fed Apoe −/− mice were subjected to anti-transferrin antibody (Tf AB) or control IgG treatment twice/week for 6 weeks. a Representative images (top) of oil-red O-stained plaques and quantitative analysis (bottom) of the stained area are shown. b Effects of TH16 and FX18 on FeCl 3 -induced carotid artery thrombus formation in C57BL/6J mice. Representative images of carotid artery blood flow (top) and quantitation (bottom) are shown. Red: blood flow; Blue and black area: background; The color bar on the right side indicates the perfusion unit scale (0–302). c Effects of TH16 and FX18 on mouse AS development. Representative images (top) of oil-red O-stained plaques and quantitative analysis (bottom) of the stained area are shown. d Graphical representation of transferrin’s central role and its interactions with clotting factors to maintain coagulation balance. Transferrin participates in three types of interactions for coagulation balance including: 1) most of transferrin (TRF, ~40 μM) is sequestered by binding with fibrinogen (~10 μM) at a molar rate of 4:1; 2) transferrin blocks inactivation effect of AT towards thrombin and FXa by binding with AT at a molar rate of 2:1; 3) transferrin interacts and potentiates thrombin and FXIIa at a molar rate of 1:1. Data represent mean ± SD ( n = 6–8), ** P
    Figure Legend Snippet: Transferrin interferences exert anti-AS effects in vivo. The HFD-fed Apoe −/− mice were subjected to anti-transferrin antibody (Tf AB) or control IgG treatment twice/week for 6 weeks. a Representative images (top) of oil-red O-stained plaques and quantitative analysis (bottom) of the stained area are shown. b Effects of TH16 and FX18 on FeCl 3 -induced carotid artery thrombus formation in C57BL/6J mice. Representative images of carotid artery blood flow (top) and quantitation (bottom) are shown. Red: blood flow; Blue and black area: background; The color bar on the right side indicates the perfusion unit scale (0–302). c Effects of TH16 and FX18 on mouse AS development. Representative images (top) of oil-red O-stained plaques and quantitative analysis (bottom) of the stained area are shown. d Graphical representation of transferrin’s central role and its interactions with clotting factors to maintain coagulation balance. Transferrin participates in three types of interactions for coagulation balance including: 1) most of transferrin (TRF, ~40 μM) is sequestered by binding with fibrinogen (~10 μM) at a molar rate of 4:1; 2) transferrin blocks inactivation effect of AT towards thrombin and FXa by binding with AT at a molar rate of 2:1; 3) transferrin interacts and potentiates thrombin and FXIIa at a molar rate of 1:1. Data represent mean ± SD ( n = 6–8), ** P

    Techniques Used: In Vivo, Mouse Assay, Staining, Quantitation Assay, Coagulation, Binding Assay

    Effects of transferrin overexpression, knockdown, anti-transferrin antibody treatment, and interference peptides on coagulation. a Plasma concentrations of transferrin in four groups of C57BL/6J mice (transferrin overexpression (PLP-Tf), knockdown (RNR-Tf), anti-transferrin antibody-treated (Tf AB), and normal control mice (NC)). b–f Relative activity of thrombin ( b ) and FXIIa ( c ), APTT ( d ), PT ( e ) in their plasma and tail bleeding time ( f ) are also shown. g – i Effects of TH16, FX18, TH16-scr, and FX18-scr on plasma recalcification time ( g ), clotting time ( h ), and tail bleeding time ( i ) in C57BL/6J mice. Data represent mean ± SD ( n = 6–8), ** P
    Figure Legend Snippet: Effects of transferrin overexpression, knockdown, anti-transferrin antibody treatment, and interference peptides on coagulation. a Plasma concentrations of transferrin in four groups of C57BL/6J mice (transferrin overexpression (PLP-Tf), knockdown (RNR-Tf), anti-transferrin antibody-treated (Tf AB), and normal control mice (NC)). b–f Relative activity of thrombin ( b ) and FXIIa ( c ), APTT ( d ), PT ( e ) in their plasma and tail bleeding time ( f ) are also shown. g – i Effects of TH16, FX18, TH16-scr, and FX18-scr on plasma recalcification time ( g ), clotting time ( h ), and tail bleeding time ( i ) in C57BL/6J mice. Data represent mean ± SD ( n = 6–8), ** P

    Techniques Used: Over Expression, Coagulation, Mouse Assay, Plasmid Purification, Activity Assay

    Enhanced enzymatic activity of thrombin and FXIIa is associated with elevated transferrin in atherosclerotic plasma. a , b An anti-transferrin antibody (Tf AB) alleviated the potentiating ability of CHD plasma on enzymatic activity of thrombin ( a ) and FXIIa ( b ). Data represent mean ± SD ( n = 6), ** P
    Figure Legend Snippet: Enhanced enzymatic activity of thrombin and FXIIa is associated with elevated transferrin in atherosclerotic plasma. a , b An anti-transferrin antibody (Tf AB) alleviated the potentiating ability of CHD plasma on enzymatic activity of thrombin ( a ) and FXIIa ( b ). Data represent mean ± SD ( n = 6), ** P

    Techniques Used: Activity Assay

    Effects of both apo- and holo-transferrin on thrombin, FXIIa and antithrombin. a Potentiating effects of both apo- and holo-transferrin on thrombin. b , c Representative RP-HPLC analysis ( b ) and quantification ( c ) of fibrinopeptide A (FbpA) and fibrinopeptide B (FbpB) released from 5 mg of fibrinogen hydrolyzed by 0.1 NIH unit thrombin mixed with 0, 0.2, 1, or 5 μM apo-transferrin, respectively. d Potentiating effects of both apo- and holo-transferrin on FXIIa. e , f Representative western blot ( e ) and quantification analysis of kallikrein heavy chain (HC ∼52 kDa) ( f ) released from 10 μg of prekallikrein (PK) hydrolyzed by 0.01 NIH unit FXIIa mixed with 0, 0.2, 1, or 5 μM apo-transferrin (lane 2–5), respectively. Blots of PK, FXIIa heavy chain (FXIIa HC), transferrin, and kallikrein light chain (LC ∼36 and 33 kDa) are also shown. g – j Apo- and holo-transferrin block antithrombin (AT)’s inactivation effect on thrombin ( g , h ) and FXa ( i , j ). TAT: thrombin–AT complex. HSA: human serum albumin. Data represent mean ± SD of five independent experiments, * P
    Figure Legend Snippet: Effects of both apo- and holo-transferrin on thrombin, FXIIa and antithrombin. a Potentiating effects of both apo- and holo-transferrin on thrombin. b , c Representative RP-HPLC analysis ( b ) and quantification ( c ) of fibrinopeptide A (FbpA) and fibrinopeptide B (FbpB) released from 5 mg of fibrinogen hydrolyzed by 0.1 NIH unit thrombin mixed with 0, 0.2, 1, or 5 μM apo-transferrin, respectively. d Potentiating effects of both apo- and holo-transferrin on FXIIa. e , f Representative western blot ( e ) and quantification analysis of kallikrein heavy chain (HC ∼52 kDa) ( f ) released from 10 μg of prekallikrein (PK) hydrolyzed by 0.01 NIH unit FXIIa mixed with 0, 0.2, 1, or 5 μM apo-transferrin (lane 2–5), respectively. Blots of PK, FXIIa heavy chain (FXIIa HC), transferrin, and kallikrein light chain (LC ∼36 and 33 kDa) are also shown. g – j Apo- and holo-transferrin block antithrombin (AT)’s inactivation effect on thrombin ( g , h ) and FXa ( i , j ). TAT: thrombin–AT complex. HSA: human serum albumin. Data represent mean ± SD of five independent experiments, * P

    Techniques Used: High Performance Liquid Chromatography, Western Blot, Blocking Assay

    Elevated levels of transferrin–thrombin/FXIIa complexes in CHD patient plasma and atherosclerotic plaque. a Western blot analysis of transferrin–prothrombin (Tf–PTh) and transferrin–FXII complexes in healthy (Normal) and CHD plasma. Red Ponceau (RP)-stained blots were uesd as the loading control. b , c Quantification of the transferrin–PTh ( b ) and transferrin–FXII ( c ) complexes. d Co-immunoprecipitation of transferrin and prothrombin or FXII in human normal plasma. e Human atherosclerotic plaque was labeled with either anti- transferrin antibody (green) or anti-thrombin antibody (red) to detect presence of the transferrin–thrombin complex (top), or labeled with either anti-transferrin antibody (red) or anti-FXIIa antibody (green) to detect presence of the transferrin–FXIIa complex (bottom). Cell nuclei were labeled with DAPI. Arrows indicate transferrin–thrombin- or transferrin–FXIIa-positive structures. Scale bar represents 30 μm. Images are representative of at least three independent experiments. f – h Western blot analysis ( f ) and quantification of transferrin–prothrombin complex ( g ) and the transferrin–FXII complex ( h ) in the supernatants of the homogenized thoracic aorta tissue from normal controls and atherosclerotic patients. Data represent mean ± SD ( n = 12), ** P
    Figure Legend Snippet: Elevated levels of transferrin–thrombin/FXIIa complexes in CHD patient plasma and atherosclerotic plaque. a Western blot analysis of transferrin–prothrombin (Tf–PTh) and transferrin–FXII complexes in healthy (Normal) and CHD plasma. Red Ponceau (RP)-stained blots were uesd as the loading control. b , c Quantification of the transferrin–PTh ( b ) and transferrin–FXII ( c ) complexes. d Co-immunoprecipitation of transferrin and prothrombin or FXII in human normal plasma. e Human atherosclerotic plaque was labeled with either anti- transferrin antibody (green) or anti-thrombin antibody (red) to detect presence of the transferrin–thrombin complex (top), or labeled with either anti-transferrin antibody (red) or anti-FXIIa antibody (green) to detect presence of the transferrin–FXIIa complex (bottom). Cell nuclei were labeled with DAPI. Arrows indicate transferrin–thrombin- or transferrin–FXIIa-positive structures. Scale bar represents 30 μm. Images are representative of at least three independent experiments. f – h Western blot analysis ( f ) and quantification of transferrin–prothrombin complex ( g ) and the transferrin–FXII complex ( h ) in the supernatants of the homogenized thoracic aorta tissue from normal controls and atherosclerotic patients. Data represent mean ± SD ( n = 12), ** P

    Techniques Used: Western Blot, Staining, Immunoprecipitation, Labeling

    Interactions between transferrin and clotting factors. a – d SPR analysis of the interaction between transferrin and thrombin ( a ), FXIIa ( b ), fibrinogen ( c ) or antithrombin (AT) ( d ). e , f Native gel shift analysis of interaction between transferrin (8 μg) and thrombin (2, 4, and 8 μg) ( e ) or FXIIa (2, 4, and 8 μg) ( f ). g , h Native gel shift analysis of interaction between transferrin (2, 4, and 8 μg) and fibrinogen (8 μg) ( g ) or AT (8 μg) ( h ). Arrows indicate the complexes of transferrin–thrombin, transferrin–FXIIa, transferrin–fibrinogen or transferrin–AT. i , k SPR analysis of the interaction between wild-type transferrin (WT-Tf) or transferrin mutant (E333,338R) and thrombin ( i ) or FXIIa ( k ). j , l Effects of wild-type transferrin and transferrin mutant on enzymatic activity of thrombin ( j ) and FXIIa ( l ). m SPR analysis of the interaction between transferrin and wild-type thrombin (WT-Th) or thrombin mutant (Th-mutant, R117,122A). n Effects of transferrin on enzymatic activity of wild-type thrombin and thrombin mutant. o , q SPR analysis of interaction between transferrin and TH16 or TH16-scr (scrambled control of TH16) ( o ), and FX18 or FX18-scr (scrambled control of FX18) ( q ). p Effects of TH16 and TH16-scr on potentiating activity of transferrin on thrombin. r Effects of FX18 and FX18-scr on the potentiating activity of transferrin on FXIIa. Data represent mean ± SD of six independent experiments, ** P
    Figure Legend Snippet: Interactions between transferrin and clotting factors. a – d SPR analysis of the interaction between transferrin and thrombin ( a ), FXIIa ( b ), fibrinogen ( c ) or antithrombin (AT) ( d ). e , f Native gel shift analysis of interaction between transferrin (8 μg) and thrombin (2, 4, and 8 μg) ( e ) or FXIIa (2, 4, and 8 μg) ( f ). g , h Native gel shift analysis of interaction between transferrin (2, 4, and 8 μg) and fibrinogen (8 μg) ( g ) or AT (8 μg) ( h ). Arrows indicate the complexes of transferrin–thrombin, transferrin–FXIIa, transferrin–fibrinogen or transferrin–AT. i , k SPR analysis of the interaction between wild-type transferrin (WT-Tf) or transferrin mutant (E333,338R) and thrombin ( i ) or FXIIa ( k ). j , l Effects of wild-type transferrin and transferrin mutant on enzymatic activity of thrombin ( j ) and FXIIa ( l ). m SPR analysis of the interaction between transferrin and wild-type thrombin (WT-Th) or thrombin mutant (Th-mutant, R117,122A). n Effects of transferrin on enzymatic activity of wild-type thrombin and thrombin mutant. o , q SPR analysis of interaction between transferrin and TH16 or TH16-scr (scrambled control of TH16) ( o ), and FX18 or FX18-scr (scrambled control of FX18) ( q ). p Effects of TH16 and TH16-scr on potentiating activity of transferrin on thrombin. r Effects of FX18 and FX18-scr on the potentiating activity of transferrin on FXIIa. Data represent mean ± SD of six independent experiments, ** P

    Techniques Used: Coagulation, SPR Assay, Electrophoretic Mobility Shift Assay, Mutagenesis, Activity Assay

    Related Articles

    Western Blot:

    Article Title: Transferrin plays a central role in coagulation balance by interacting with clotting factors
    Article Snippet: .. Transferrin expression was quantified by both qRT-PCR (forward primer (5′–3′): GGACGCCATGACTTTGGATG; reverse primer (5′–3′): GCCATGACAGGCACTAGACC) and western blot analysis. .. PCR was performed on a CFX-96 Touch Real-Time Detection System (Bio-Rad, USA).

    Expressing:

    Article Title: Transferrin plays a central role in coagulation balance by interacting with clotting factors
    Article Snippet: .. Transferrin expression was quantified by both qRT-PCR (forward primer (5′–3′): GGACGCCATGACTTTGGATG; reverse primer (5′–3′): GCCATGACAGGCACTAGACC) and western blot analysis. .. PCR was performed on a CFX-96 Touch Real-Time Detection System (Bio-Rad, USA).

    Quantitative RT-PCR:

    Article Title: Transferrin plays a central role in coagulation balance by interacting with clotting factors
    Article Snippet: .. Transferrin expression was quantified by both qRT-PCR (forward primer (5′–3′): GGACGCCATGACTTTGGATG; reverse primer (5′–3′): GCCATGACAGGCACTAGACC) and western blot analysis. .. PCR was performed on a CFX-96 Touch Real-Time Detection System (Bio-Rad, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Sino Biological transferrin expression
    Effects of <t>transferrin</t> overexpression and knockdown on atherosclerotic development and hypercoagulability. a–f Plasma concentrations of transferrin in five groups of Apoe −/− mice fed a HFD for 6 weeks (transferrin overexpression (PLP-Tf) and its blank PLP, knockdown (RNR-Tf) and its blank RNR, and normal Apoe −/− mice (NC)) ( a ). Relative activity of thrombin ( b ) and FXIIa ( c ), APTT ( d ), PT ( e ) in their plasma and tail bleeding time ( f ) are also shown. g Representative images of carotid artery blood flow (top) in FeCl 3 -treated mice by laser speckle perfusion imaging, and the region of interest (green rectangle) was placed in the carotid artery to quantify blood flow change. Relative blood flow in the region of interest is shown (bottom) by using perfusion unit. Red: blood flow; Blue and black area: background; The color bar on the right side indicates the perfusion unit scale (0–302). h Representative images of oil-red O-stained atherosclerotic plaques (top) and quantitative analysis of stained area (bottom) are shown. Data represent mean ± SD ( n = 6), ** P
    Transferrin Expression, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transferrin expression/product/Sino Biological
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    transferrin expression - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier

    Image Search Results


    Effects of transferrin overexpression and knockdown on atherosclerotic development and hypercoagulability. a–f Plasma concentrations of transferrin in five groups of Apoe −/− mice fed a HFD for 6 weeks (transferrin overexpression (PLP-Tf) and its blank PLP, knockdown (RNR-Tf) and its blank RNR, and normal Apoe −/− mice (NC)) ( a ). Relative activity of thrombin ( b ) and FXIIa ( c ), APTT ( d ), PT ( e ) in their plasma and tail bleeding time ( f ) are also shown. g Representative images of carotid artery blood flow (top) in FeCl 3 -treated mice by laser speckle perfusion imaging, and the region of interest (green rectangle) was placed in the carotid artery to quantify blood flow change. Relative blood flow in the region of interest is shown (bottom) by using perfusion unit. Red: blood flow; Blue and black area: background; The color bar on the right side indicates the perfusion unit scale (0–302). h Representative images of oil-red O-stained atherosclerotic plaques (top) and quantitative analysis of stained area (bottom) are shown. Data represent mean ± SD ( n = 6), ** P

    Journal: Cell Research

    Article Title: Transferrin plays a central role in coagulation balance by interacting with clotting factors

    doi: 10.1038/s41422-019-0260-6

    Figure Lengend Snippet: Effects of transferrin overexpression and knockdown on atherosclerotic development and hypercoagulability. a–f Plasma concentrations of transferrin in five groups of Apoe −/− mice fed a HFD for 6 weeks (transferrin overexpression (PLP-Tf) and its blank PLP, knockdown (RNR-Tf) and its blank RNR, and normal Apoe −/− mice (NC)) ( a ). Relative activity of thrombin ( b ) and FXIIa ( c ), APTT ( d ), PT ( e ) in their plasma and tail bleeding time ( f ) are also shown. g Representative images of carotid artery blood flow (top) in FeCl 3 -treated mice by laser speckle perfusion imaging, and the region of interest (green rectangle) was placed in the carotid artery to quantify blood flow change. Relative blood flow in the region of interest is shown (bottom) by using perfusion unit. Red: blood flow; Blue and black area: background; The color bar on the right side indicates the perfusion unit scale (0–302). h Representative images of oil-red O-stained atherosclerotic plaques (top) and quantitative analysis of stained area (bottom) are shown. Data represent mean ± SD ( n = 6), ** P

    Article Snippet: Transferrin expression was quantified by both qRT-PCR (forward primer (5′–3′): GGACGCCATGACTTTGGATG; reverse primer (5′–3′): GCCATGACAGGCACTAGACC) and western blot analysis.

    Techniques: Over Expression, Mouse Assay, Plasmid Purification, Activity Assay, Imaging, Staining

    Transferrin interferences exert anti-AS effects in vivo. The HFD-fed Apoe −/− mice were subjected to anti-transferrin antibody (Tf AB) or control IgG treatment twice/week for 6 weeks. a Representative images (top) of oil-red O-stained plaques and quantitative analysis (bottom) of the stained area are shown. b Effects of TH16 and FX18 on FeCl 3 -induced carotid artery thrombus formation in C57BL/6J mice. Representative images of carotid artery blood flow (top) and quantitation (bottom) are shown. Red: blood flow; Blue and black area: background; The color bar on the right side indicates the perfusion unit scale (0–302). c Effects of TH16 and FX18 on mouse AS development. Representative images (top) of oil-red O-stained plaques and quantitative analysis (bottom) of the stained area are shown. d Graphical representation of transferrin’s central role and its interactions with clotting factors to maintain coagulation balance. Transferrin participates in three types of interactions for coagulation balance including: 1) most of transferrin (TRF, ~40 μM) is sequestered by binding with fibrinogen (~10 μM) at a molar rate of 4:1; 2) transferrin blocks inactivation effect of AT towards thrombin and FXa by binding with AT at a molar rate of 2:1; 3) transferrin interacts and potentiates thrombin and FXIIa at a molar rate of 1:1. Data represent mean ± SD ( n = 6–8), ** P

    Journal: Cell Research

    Article Title: Transferrin plays a central role in coagulation balance by interacting with clotting factors

    doi: 10.1038/s41422-019-0260-6

    Figure Lengend Snippet: Transferrin interferences exert anti-AS effects in vivo. The HFD-fed Apoe −/− mice were subjected to anti-transferrin antibody (Tf AB) or control IgG treatment twice/week for 6 weeks. a Representative images (top) of oil-red O-stained plaques and quantitative analysis (bottom) of the stained area are shown. b Effects of TH16 and FX18 on FeCl 3 -induced carotid artery thrombus formation in C57BL/6J mice. Representative images of carotid artery blood flow (top) and quantitation (bottom) are shown. Red: blood flow; Blue and black area: background; The color bar on the right side indicates the perfusion unit scale (0–302). c Effects of TH16 and FX18 on mouse AS development. Representative images (top) of oil-red O-stained plaques and quantitative analysis (bottom) of the stained area are shown. d Graphical representation of transferrin’s central role and its interactions with clotting factors to maintain coagulation balance. Transferrin participates in three types of interactions for coagulation balance including: 1) most of transferrin (TRF, ~40 μM) is sequestered by binding with fibrinogen (~10 μM) at a molar rate of 4:1; 2) transferrin blocks inactivation effect of AT towards thrombin and FXa by binding with AT at a molar rate of 2:1; 3) transferrin interacts and potentiates thrombin and FXIIa at a molar rate of 1:1. Data represent mean ± SD ( n = 6–8), ** P

    Article Snippet: Transferrin expression was quantified by both qRT-PCR (forward primer (5′–3′): GGACGCCATGACTTTGGATG; reverse primer (5′–3′): GCCATGACAGGCACTAGACC) and western blot analysis.

    Techniques: In Vivo, Mouse Assay, Staining, Quantitation Assay, Coagulation, Binding Assay

    Effects of transferrin overexpression, knockdown, anti-transferrin antibody treatment, and interference peptides on coagulation. a Plasma concentrations of transferrin in four groups of C57BL/6J mice (transferrin overexpression (PLP-Tf), knockdown (RNR-Tf), anti-transferrin antibody-treated (Tf AB), and normal control mice (NC)). b–f Relative activity of thrombin ( b ) and FXIIa ( c ), APTT ( d ), PT ( e ) in their plasma and tail bleeding time ( f ) are also shown. g – i Effects of TH16, FX18, TH16-scr, and FX18-scr on plasma recalcification time ( g ), clotting time ( h ), and tail bleeding time ( i ) in C57BL/6J mice. Data represent mean ± SD ( n = 6–8), ** P

    Journal: Cell Research

    Article Title: Transferrin plays a central role in coagulation balance by interacting with clotting factors

    doi: 10.1038/s41422-019-0260-6

    Figure Lengend Snippet: Effects of transferrin overexpression, knockdown, anti-transferrin antibody treatment, and interference peptides on coagulation. a Plasma concentrations of transferrin in four groups of C57BL/6J mice (transferrin overexpression (PLP-Tf), knockdown (RNR-Tf), anti-transferrin antibody-treated (Tf AB), and normal control mice (NC)). b–f Relative activity of thrombin ( b ) and FXIIa ( c ), APTT ( d ), PT ( e ) in their plasma and tail bleeding time ( f ) are also shown. g – i Effects of TH16, FX18, TH16-scr, and FX18-scr on plasma recalcification time ( g ), clotting time ( h ), and tail bleeding time ( i ) in C57BL/6J mice. Data represent mean ± SD ( n = 6–8), ** P

    Article Snippet: Transferrin expression was quantified by both qRT-PCR (forward primer (5′–3′): GGACGCCATGACTTTGGATG; reverse primer (5′–3′): GCCATGACAGGCACTAGACC) and western blot analysis.

    Techniques: Over Expression, Coagulation, Mouse Assay, Plasmid Purification, Activity Assay

    Enhanced enzymatic activity of thrombin and FXIIa is associated with elevated transferrin in atherosclerotic plasma. a , b An anti-transferrin antibody (Tf AB) alleviated the potentiating ability of CHD plasma on enzymatic activity of thrombin ( a ) and FXIIa ( b ). Data represent mean ± SD ( n = 6), ** P

    Journal: Cell Research

    Article Title: Transferrin plays a central role in coagulation balance by interacting with clotting factors

    doi: 10.1038/s41422-019-0260-6

    Figure Lengend Snippet: Enhanced enzymatic activity of thrombin and FXIIa is associated with elevated transferrin in atherosclerotic plasma. a , b An anti-transferrin antibody (Tf AB) alleviated the potentiating ability of CHD plasma on enzymatic activity of thrombin ( a ) and FXIIa ( b ). Data represent mean ± SD ( n = 6), ** P

    Article Snippet: Transferrin expression was quantified by both qRT-PCR (forward primer (5′–3′): GGACGCCATGACTTTGGATG; reverse primer (5′–3′): GCCATGACAGGCACTAGACC) and western blot analysis.

    Techniques: Activity Assay

    Effects of both apo- and holo-transferrin on thrombin, FXIIa and antithrombin. a Potentiating effects of both apo- and holo-transferrin on thrombin. b , c Representative RP-HPLC analysis ( b ) and quantification ( c ) of fibrinopeptide A (FbpA) and fibrinopeptide B (FbpB) released from 5 mg of fibrinogen hydrolyzed by 0.1 NIH unit thrombin mixed with 0, 0.2, 1, or 5 μM apo-transferrin, respectively. d Potentiating effects of both apo- and holo-transferrin on FXIIa. e , f Representative western blot ( e ) and quantification analysis of kallikrein heavy chain (HC ∼52 kDa) ( f ) released from 10 μg of prekallikrein (PK) hydrolyzed by 0.01 NIH unit FXIIa mixed with 0, 0.2, 1, or 5 μM apo-transferrin (lane 2–5), respectively. Blots of PK, FXIIa heavy chain (FXIIa HC), transferrin, and kallikrein light chain (LC ∼36 and 33 kDa) are also shown. g – j Apo- and holo-transferrin block antithrombin (AT)’s inactivation effect on thrombin ( g , h ) and FXa ( i , j ). TAT: thrombin–AT complex. HSA: human serum albumin. Data represent mean ± SD of five independent experiments, * P

    Journal: Cell Research

    Article Title: Transferrin plays a central role in coagulation balance by interacting with clotting factors

    doi: 10.1038/s41422-019-0260-6

    Figure Lengend Snippet: Effects of both apo- and holo-transferrin on thrombin, FXIIa and antithrombin. a Potentiating effects of both apo- and holo-transferrin on thrombin. b , c Representative RP-HPLC analysis ( b ) and quantification ( c ) of fibrinopeptide A (FbpA) and fibrinopeptide B (FbpB) released from 5 mg of fibrinogen hydrolyzed by 0.1 NIH unit thrombin mixed with 0, 0.2, 1, or 5 μM apo-transferrin, respectively. d Potentiating effects of both apo- and holo-transferrin on FXIIa. e , f Representative western blot ( e ) and quantification analysis of kallikrein heavy chain (HC ∼52 kDa) ( f ) released from 10 μg of prekallikrein (PK) hydrolyzed by 0.01 NIH unit FXIIa mixed with 0, 0.2, 1, or 5 μM apo-transferrin (lane 2–5), respectively. Blots of PK, FXIIa heavy chain (FXIIa HC), transferrin, and kallikrein light chain (LC ∼36 and 33 kDa) are also shown. g – j Apo- and holo-transferrin block antithrombin (AT)’s inactivation effect on thrombin ( g , h ) and FXa ( i , j ). TAT: thrombin–AT complex. HSA: human serum albumin. Data represent mean ± SD of five independent experiments, * P

    Article Snippet: Transferrin expression was quantified by both qRT-PCR (forward primer (5′–3′): GGACGCCATGACTTTGGATG; reverse primer (5′–3′): GCCATGACAGGCACTAGACC) and western blot analysis.

    Techniques: High Performance Liquid Chromatography, Western Blot, Blocking Assay

    Elevated levels of transferrin–thrombin/FXIIa complexes in CHD patient plasma and atherosclerotic plaque. a Western blot analysis of transferrin–prothrombin (Tf–PTh) and transferrin–FXII complexes in healthy (Normal) and CHD plasma. Red Ponceau (RP)-stained blots were uesd as the loading control. b , c Quantification of the transferrin–PTh ( b ) and transferrin–FXII ( c ) complexes. d Co-immunoprecipitation of transferrin and prothrombin or FXII in human normal plasma. e Human atherosclerotic plaque was labeled with either anti- transferrin antibody (green) or anti-thrombin antibody (red) to detect presence of the transferrin–thrombin complex (top), or labeled with either anti-transferrin antibody (red) or anti-FXIIa antibody (green) to detect presence of the transferrin–FXIIa complex (bottom). Cell nuclei were labeled with DAPI. Arrows indicate transferrin–thrombin- or transferrin–FXIIa-positive structures. Scale bar represents 30 μm. Images are representative of at least three independent experiments. f – h Western blot analysis ( f ) and quantification of transferrin–prothrombin complex ( g ) and the transferrin–FXII complex ( h ) in the supernatants of the homogenized thoracic aorta tissue from normal controls and atherosclerotic patients. Data represent mean ± SD ( n = 12), ** P

    Journal: Cell Research

    Article Title: Transferrin plays a central role in coagulation balance by interacting with clotting factors

    doi: 10.1038/s41422-019-0260-6

    Figure Lengend Snippet: Elevated levels of transferrin–thrombin/FXIIa complexes in CHD patient plasma and atherosclerotic plaque. a Western blot analysis of transferrin–prothrombin (Tf–PTh) and transferrin–FXII complexes in healthy (Normal) and CHD plasma. Red Ponceau (RP)-stained blots were uesd as the loading control. b , c Quantification of the transferrin–PTh ( b ) and transferrin–FXII ( c ) complexes. d Co-immunoprecipitation of transferrin and prothrombin or FXII in human normal plasma. e Human atherosclerotic plaque was labeled with either anti- transferrin antibody (green) or anti-thrombin antibody (red) to detect presence of the transferrin–thrombin complex (top), or labeled with either anti-transferrin antibody (red) or anti-FXIIa antibody (green) to detect presence of the transferrin–FXIIa complex (bottom). Cell nuclei were labeled with DAPI. Arrows indicate transferrin–thrombin- or transferrin–FXIIa-positive structures. Scale bar represents 30 μm. Images are representative of at least three independent experiments. f – h Western blot analysis ( f ) and quantification of transferrin–prothrombin complex ( g ) and the transferrin–FXII complex ( h ) in the supernatants of the homogenized thoracic aorta tissue from normal controls and atherosclerotic patients. Data represent mean ± SD ( n = 12), ** P

    Article Snippet: Transferrin expression was quantified by both qRT-PCR (forward primer (5′–3′): GGACGCCATGACTTTGGATG; reverse primer (5′–3′): GCCATGACAGGCACTAGACC) and western blot analysis.

    Techniques: Western Blot, Staining, Immunoprecipitation, Labeling

    Interactions between transferrin and clotting factors. a – d SPR analysis of the interaction between transferrin and thrombin ( a ), FXIIa ( b ), fibrinogen ( c ) or antithrombin (AT) ( d ). e , f Native gel shift analysis of interaction between transferrin (8 μg) and thrombin (2, 4, and 8 μg) ( e ) or FXIIa (2, 4, and 8 μg) ( f ). g , h Native gel shift analysis of interaction between transferrin (2, 4, and 8 μg) and fibrinogen (8 μg) ( g ) or AT (8 μg) ( h ). Arrows indicate the complexes of transferrin–thrombin, transferrin–FXIIa, transferrin–fibrinogen or transferrin–AT. i , k SPR analysis of the interaction between wild-type transferrin (WT-Tf) or transferrin mutant (E333,338R) and thrombin ( i ) or FXIIa ( k ). j , l Effects of wild-type transferrin and transferrin mutant on enzymatic activity of thrombin ( j ) and FXIIa ( l ). m SPR analysis of the interaction between transferrin and wild-type thrombin (WT-Th) or thrombin mutant (Th-mutant, R117,122A). n Effects of transferrin on enzymatic activity of wild-type thrombin and thrombin mutant. o , q SPR analysis of interaction between transferrin and TH16 or TH16-scr (scrambled control of TH16) ( o ), and FX18 or FX18-scr (scrambled control of FX18) ( q ). p Effects of TH16 and TH16-scr on potentiating activity of transferrin on thrombin. r Effects of FX18 and FX18-scr on the potentiating activity of transferrin on FXIIa. Data represent mean ± SD of six independent experiments, ** P

    Journal: Cell Research

    Article Title: Transferrin plays a central role in coagulation balance by interacting with clotting factors

    doi: 10.1038/s41422-019-0260-6

    Figure Lengend Snippet: Interactions between transferrin and clotting factors. a – d SPR analysis of the interaction between transferrin and thrombin ( a ), FXIIa ( b ), fibrinogen ( c ) or antithrombin (AT) ( d ). e , f Native gel shift analysis of interaction between transferrin (8 μg) and thrombin (2, 4, and 8 μg) ( e ) or FXIIa (2, 4, and 8 μg) ( f ). g , h Native gel shift analysis of interaction between transferrin (2, 4, and 8 μg) and fibrinogen (8 μg) ( g ) or AT (8 μg) ( h ). Arrows indicate the complexes of transferrin–thrombin, transferrin–FXIIa, transferrin–fibrinogen or transferrin–AT. i , k SPR analysis of the interaction between wild-type transferrin (WT-Tf) or transferrin mutant (E333,338R) and thrombin ( i ) or FXIIa ( k ). j , l Effects of wild-type transferrin and transferrin mutant on enzymatic activity of thrombin ( j ) and FXIIa ( l ). m SPR analysis of the interaction between transferrin and wild-type thrombin (WT-Th) or thrombin mutant (Th-mutant, R117,122A). n Effects of transferrin on enzymatic activity of wild-type thrombin and thrombin mutant. o , q SPR analysis of interaction between transferrin and TH16 or TH16-scr (scrambled control of TH16) ( o ), and FX18 or FX18-scr (scrambled control of FX18) ( q ). p Effects of TH16 and TH16-scr on potentiating activity of transferrin on thrombin. r Effects of FX18 and FX18-scr on the potentiating activity of transferrin on FXIIa. Data represent mean ± SD of six independent experiments, ** P

    Article Snippet: Transferrin expression was quantified by both qRT-PCR (forward primer (5′–3′): GGACGCCATGACTTTGGATG; reverse primer (5′–3′): GCCATGACAGGCACTAGACC) and western blot analysis.

    Techniques: Coagulation, SPR Assay, Electrophoretic Mobility Shift Assay, Mutagenesis, Activity Assay