mfei  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    MfeI HF
    Description:
    MfeI HF 2 500 units
    Catalog Number:
    r3589l
    Price:
    297
    Size:
    2 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs mfei
    MfeI HF
    MfeI HF 2 500 units
    https://www.bioz.com/result/mfei/product/New England Biolabs
    Average 90 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    mfei - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Prediction of ultra-potent shRNAs with a sequential classification algorithm
    Article Snippet: The vector libraries were constructed using the previously described two-step cloning procedure , . .. Ligation products were MfeI-HF (NEB) digested to reduce background noise.

    Article Title: Corynebacterium pseudodiphtheriticum Exploits Staphylococcus aureus Virulence Components in a Novel Polymicrobial Defense Strategy
    Article Snippet: To identify the region of transposon insertion, a rescue cloning strategy was utilized that relied upon the presence of an R6K origin of replication in the H1 mariner transposon. .. Recovered DNA was digested with MfeI-HF (New England Biolabs), and a self-ligation was performed via the addition of Quick ligase (New England Biolabs).

    Centrifugation:

    Article Title: Corynebacterium pseudodiphtheriticum Exploits Staphylococcus aureus Virulence Components in a Novel Polymicrobial Defense Strategy
    Article Snippet: Cells were pelleted by centrifugation and resuspended in 0.2 ml of 1× phosphate-buffered saline (PBS; Gibco) with 10 μg/ml lysostaphin (Sigma-Aldrich). .. Recovered DNA was digested with MfeI-HF (New England Biolabs), and a self-ligation was performed via the addition of Quick ligase (New England Biolabs).

    Amplification:

    Article Title: Prediction of ultra-potent shRNAs with a sequential classification algorithm
    Article Snippet: In step 1, oligonucleotides were amplified using the Sens3′Mfe (5′-TACAATACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3′, IDT) and Sens5′Xho (5′-ATTCATCACAATTGTCCGCGTCGATCCTAGG-3′, IDT) primers, XhoI/MfeI (NEB) digested, and ligated into an XhoI/EcoRI (NEB) digested pTNL backbone vector. .. Ligation products were MfeI-HF (NEB) digested to reduce background noise.

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: Second, the intermediate pENTR plasmid was digested using MfeI-HF (New England Biolabs, Inc.) and BamHI, and then was ligated to a Pgk1 -NeoR fragment released from pENTR lox-FRT-rNeo using EcoRI and BamHI. .. Homology arms were amplified by PCR from C57BL/6 genomic DNA and the vector backbone was amplified from pDEST DTA-MLS ( ) using Q5 High-Fidelity DNA polymerase (New England Biolabs, Inc.) and primers listed in Table S2.

    High Throughput Screening Assay:

    Article Title: Prediction of ultra-potent shRNAs with a sequential classification algorithm
    Article Snippet: Ligation products were MfeI-HF (NEB) digested to reduce background noise. .. High-throughput sequencing based quantification of library composition and analysis of changes in shRNA representation over sort cycles were carried out as previously described , , with several adaptations to enhance readout precision.

    Stable Transfection:

    Article Title: Corynebacterium pseudodiphtheriticum Exploits Staphylococcus aureus Virulence Components in a Novel Polymicrobial Defense Strategy
    Article Snippet: Each recovered transposon mutant strain was independently confirmed to be stably resistant to C. pseudodiphtheriticum -mediated bactericidal activity. .. Recovered DNA was digested with MfeI-HF (New England Biolabs), and a self-ligation was performed via the addition of Quick ligase (New England Biolabs).

    Cytometry:

    Article Title: Prediction of ultra-potent shRNAs with a sequential classification algorithm
    Article Snippet: Ligation products were MfeI-HF (NEB) digested to reduce background noise. .. All cell culture and flow cytometry procedures of the Sensor assay, to gradually enrich for the most potent shRNAs, were conducted as previously described , .

    Construct:

    Article Title: Prediction of ultra-potent shRNAs with a sequential classification algorithm
    Article Snippet: The vector libraries were constructed using the previously described two-step cloning procedure , . .. Ligation products were MfeI-HF (NEB) digested to reduce background noise.

    Knock-In:

    Article Title: Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-Conversion and Inactivation of NHEJ Repair
    Article Snippet: Worms were lysed and genotyped as described in the PCR-based knock-in screening section (see Supporting Information ). .. To each 10 µl PCR, 5 µl of Mfe I-HF (NEB, R3589L) digestion mixture (1 µl 10× CutSmart buffer, 3.5 µl dH20, 0.5 µl Mfe I-HF) was added.

    Incubation:

    Article Title: Corynebacterium pseudodiphtheriticum Exploits Staphylococcus aureus Virulence Components in a Novel Polymicrobial Defense Strategy
    Article Snippet: The cell suspension was incubated at 37°C for 1 h. DNA was then extracted using the Wizard Genomic DNA purification kit (Promega) according to the manufacturer’s instructions. .. Recovered DNA was digested with MfeI-HF (New England Biolabs), and a self-ligation was performed via the addition of Quick ligase (New England Biolabs).

    Article Title: The DNA repair protein SHPRH is a nucleosome-stimulated ATPase and a nucleosome-E3 ubiquitin ligase
    Article Snippet: .. Control (buffer only), remodeling factors (hSWI/SNF 93 ng and 186 ng in 20 μl; SHPRH 17 nM, 34 nM and 68 nM) were incubated with 20 nM of radiolabeled nucleosomes with a 80-bp DNA overhang, 1.5 U/μl of MfeI-HF (New England Biolabs), in the presence of ATP (2 mM) and the reaction were stopped at 20, 40 and 60 min, and visualized as described above. .. UBE2 screen and ubiquitination assays The screen for UBE2s which might support histone or nucleosome ubiquitination by SHPRH was carried out using the E2Select Ubiquitin Conjugation Kit from Boston Biochem (K-982).

    Article Title: Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-Conversion and Inactivation of NHEJ Repair
    Article Snippet: Concentrated OP50 food (30 µl; see the “PCR-based knock-in screening” protocol ( File S1 ) in the for recipe) was then added and F1 ’s were incubated for 3–4 days at 25° to allow progeny to develop. .. To each 10 µl PCR, 5 µl of Mfe I-HF (NEB, R3589L) digestion mixture (1 µl 10× CutSmart buffer, 3.5 µl dH20, 0.5 µl Mfe I-HF) was added.

    Activity Assay:

    Article Title: Corynebacterium pseudodiphtheriticum Exploits Staphylococcus aureus Virulence Components in a Novel Polymicrobial Defense Strategy
    Article Snippet: Each recovered transposon mutant strain was independently confirmed to be stably resistant to C. pseudodiphtheriticum -mediated bactericidal activity. .. Recovered DNA was digested with MfeI-HF (New England Biolabs), and a self-ligation was performed via the addition of Quick ligase (New England Biolabs).

    Article Title: Multiple Pairwise Analysis of Non-homologous Centromere Coupling Reveals Preferential Chromosome Size-Dependent Interactions and a Role for Bouquet Formation in Establishing the Interaction Pattern
    Article Snippet: For the double digestion, EcoRI-HF and MfeI-HF (NEB) generated cohesive ends that were compatible, yet recognizing slightly different sequences (GAATTC and CAATTG respectively). .. They were selected due to their extremely low star activity, extended enzymatic half-life suitable for overnight digestion and stronger activity in samples of lower purity, making them appropriate for digestion of crosslinked chromatin.

    Article Title: Massively parallel characterization of restriction endonucleases
    Article Snippet: Paragraph title: MfeI star activity ... These star sites were also seen after digestion with an engineered high-specificity version of MfeI (MfeI-HF, NEB), although at much lower coverage compared with wild-type MfeI (see ).

    Modification:

    Article Title: Rapid identification and expression of human TCRs in retrogenic mice
    Article Snippet: The original mouse 8-1.1 TCR-pMSCVII-Ametrine (pMIA) vector ( ; ) was modified by quick change mutagenesis to incorporate the Sna bI, Sac II, Bst bI, and Mfe I restriction enzyme cut sites on either side of the TCR α and β variable regions of the encoded ‘placeholder’ TCR. .. Purified PCR products from the beta nested reaction and the TCR-pMIA vector were digested with Bst bI (NEB #R0519S) and Mfe I (NEB #R3589L).

    Transformation Assay:

    Article Title: Corynebacterium pseudodiphtheriticum Exploits Staphylococcus aureus Virulence Components in a Novel Polymicrobial Defense Strategy
    Article Snippet: Recovered DNA was digested with MfeI-HF (New England Biolabs), and a self-ligation was performed via the addition of Quick ligase (New England Biolabs). .. The resulting material was then transformed into chemically competent DH5α λpir, and colonies containing plasmids were recovered by plating on BHI agar that contained 50 µg/ml spectinomycin.

    Transfection:

    Article Title: A Structural Basis for BRD2/4-Mediated Host Chromatin Interaction and Oligomer Assembly of Kaposi Sarcoma-Associated Herpesvirus and Murine Gammaherpesvirus LANA ProteinsMolecular Basis for Oligomeric-DNA Binding and Episome Maintenance by KSHV LANACrystal Structure of the Gamma-2 Herpesvirus LANA DNA Binding Domain Identifies Charged Surface Residues Which Impact Viral Latency
    Article Snippet: Alternatively, pTR1 and pBluescript were transfected as the replicon and the non-replicating control respectively. .. 90% of DNA was digested for 72 h with 60 U of MfeI HF (or KpnI) (NEB) and 60 U DpnI (NEB) and the remaining 10% with 40 U MfeI HF (or KpnI) only.

    Southern Blot:

    Article Title: A Structural Basis for BRD2/4-Mediated Host Chromatin Interaction and Oligomer Assembly of Kaposi Sarcoma-Associated Herpesvirus and Murine Gammaherpesvirus LANA ProteinsMolecular Basis for Oligomeric-DNA Binding and Episome Maintenance by KSHV LANACrystal Structure of the Gamma-2 Herpesvirus LANA DNA Binding Domain Identifies Charged Surface Residues Which Impact Viral Latency
    Article Snippet: 90% of DNA was digested for 72 h with 60 U of MfeI HF (or KpnI) (NEB) and 60 U DpnI (NEB) and the remaining 10% with 40 U MfeI HF (or KpnI) only. .. Digested DNA was loaded and separated on a 0.8% agarose gel, and transferred to a nitrocellulose membrane by Southern blotting.

    Ligation:

    Article Title: Prediction of ultra-potent shRNAs with a sequential classification algorithm
    Article Snippet: .. Ligation products were MfeI-HF (NEB) digested to reduce background noise. .. In step 2, the missing 3′miR30-PGK-Venus fragment was cloned into the EcoRI/MluI sites, followed by BamHI-HF (NEB) digestion of the resulting ligation product to further reduce background noise.

    Article Title: Rapid identification and expression of human TCRs in retrogenic mice
    Article Snippet: Purified PCR products from the beta nested reaction and the TCR-pMIA vector were digested with Bst bI (NEB #R0519S) and Mfe I (NEB #R3589L). .. Prior to ligation, the vector backbone was treated with CIP enzyme (NEB #M0290S).

    Cell Culture:

    Article Title: Prediction of ultra-potent shRNAs with a sequential classification algorithm
    Article Snippet: Ligation products were MfeI-HF (NEB) digested to reduce background noise. .. All cell culture and flow cytometry procedures of the Sensor assay, to gradually enrich for the most potent shRNAs, were conducted as previously described , .

    Mutagenesis:

    Article Title: Corynebacterium pseudodiphtheriticum Exploits Staphylococcus aureus Virulence Components in a Novel Polymicrobial Defense Strategy
    Article Snippet: Paragraph title: Screen for resistant S. aureus transposon mutant strains. ... Recovered DNA was digested with MfeI-HF (New England Biolabs), and a self-ligation was performed via the addition of Quick ligase (New England Biolabs).

    Article Title: Rapid identification and expression of human TCRs in retrogenic mice
    Article Snippet: The original mouse 8-1.1 TCR-pMSCVII-Ametrine (pMIA) vector ( ; ) was modified by quick change mutagenesis to incorporate the Sna bI, Sac II, Bst bI, and Mfe I restriction enzyme cut sites on either side of the TCR α and β variable regions of the encoded ‘placeholder’ TCR. .. Purified PCR products from the beta nested reaction and the TCR-pMIA vector were digested with Bst bI (NEB #R0519S) and Mfe I (NEB #R3589L).

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: Paragraph title: Generation of the MafB-mCherry-Cre targeted mutation ... Second, the intermediate pENTR plasmid was digested using MfeI-HF (New England Biolabs, Inc.) and BamHI, and then was ligated to a Pgk1 -NeoR fragment released from pENTR lox-FRT-rNeo using EcoRI and BamHI.

    Generated:

    Article Title: Prediction of ultra-potent shRNAs with a sequential classification algorithm
    Article Snippet: For each of the 333 new genes, 300 primary predictions were generated by calculating the intersection of all transcript variants per gene (NCBI) and using DSIR supplemented with Sensor rules , to further impose shRNA-specific sequence requirements. .. Ligation products were MfeI-HF (NEB) digested to reduce background noise.

    Article Title: Multiple Pairwise Analysis of Non-homologous Centromere Coupling Reveals Preferential Chromosome Size-Dependent Interactions and a Role for Bouquet Formation in Establishing the Interaction Pattern
    Article Snippet: .. For the double digestion, EcoRI-HF and MfeI-HF (NEB) generated cohesive ends that were compatible, yet recognizing slightly different sequences (GAATTC and CAATTG respectively). .. They were selected due to their extremely low star activity, extended enzymatic half-life suitable for overnight digestion and stronger activity in samples of lower purity, making them appropriate for digestion of crosslinked chromatin.

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: That reaction generated pENTR MafB-P2A-FLAG-mCherry-T2A-Cre-UTR. .. Second, the intermediate pENTR plasmid was digested using MfeI-HF (New England Biolabs, Inc.) and BamHI, and then was ligated to a Pgk1 -NeoR fragment released from pENTR lox-FRT-rNeo using EcoRI and BamHI.

    Sequencing:

    Article Title: Prediction of ultra-potent shRNAs with a sequential classification algorithm
    Article Snippet: All shRNAs containing restriction sites used for cloning (XhoI, EcoRI, MluI, MfeI, BamHI) within the 60 nt target region encompassing the 22 nt guide sequence, as well as shRNAs closer than 15 nt to an artificial transcript junction (site where the common regions of transcript variants are joined), were eliminated. .. Ligation products were MfeI-HF (NEB) digested to reduce background noise.

    Article Title: A Structural Basis for BRD2/4-Mediated Host Chromatin Interaction and Oligomer Assembly of Kaposi Sarcoma-Associated Herpesvirus and Murine Gammaherpesvirus LANA ProteinsMolecular Basis for Oligomeric-DNA Binding and Episome Maintenance by KSHV LANACrystal Structure of the Gamma-2 Herpesvirus LANA DNA Binding Domain Identifies Charged Surface Residues Which Impact Viral Latency
    Article Snippet: On the next day cells were transfected with pGTR4 plasmid , containing four KSHV terminal repeats (TR), and a GFP coding sequence and the pEGFP-C1 (Clontech) plasmid, used as an internal non-replicating control. .. 90% of DNA was digested for 72 h with 60 U of MfeI HF (or KpnI) (NEB) and 60 U DpnI (NEB) and the remaining 10% with 40 U MfeI HF (or KpnI) only.

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: Second, the intermediate pENTR plasmid was digested using MfeI-HF (New England Biolabs, Inc.) and BamHI, and then was ligated to a Pgk1 -NeoR fragment released from pENTR lox-FRT-rNeo using EcoRI and BamHI. .. The sequence of the synthetic fragment was: 5′-TACTACGCGGCCGCGAATTCGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCATTAAGGGTTCCGGATCTATAGATCATGAGTGGGAGGAATGAGCTGGCCCTTAATTTGGTTTTGCTTGTTTAAATTATGATATCCAACTATGAAACATTATCATAAAGCAATAGTAAAGAGCCTTCAGTAAAGAGCAGGCATTTATCTAATCCCACCCCACCCCCACCCCCGTAGCTCCAATCCTTCCATTCAAAATGTAGGTACTCTGTTCTCACCCTTCTTAACAAAGTATGACAGGAAAAACTTCCATTTTAGTGGACATCTTTATTGTTTAATAGATCATCAATTTCTGCAGACTTACAGCGGATCCTTAATTCAATTGGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGAATTCGAAGCGGCCGCCATCAT-3′.

    DNA Purification:

    Article Title: Corynebacterium pseudodiphtheriticum Exploits Staphylococcus aureus Virulence Components in a Novel Polymicrobial Defense Strategy
    Article Snippet: The cell suspension was incubated at 37°C for 1 h. DNA was then extracted using the Wizard Genomic DNA purification kit (Promega) according to the manufacturer’s instructions. .. Recovered DNA was digested with MfeI-HF (New England Biolabs), and a self-ligation was performed via the addition of Quick ligase (New England Biolabs).

    Article Title: Rapid identification and expression of human TCRs in retrogenic mice
    Article Snippet: Purified PCR products from the beta nested reaction and the TCR-pMIA vector were digested with Bst bI (NEB #R0519S) and Mfe I (NEB #R3589L). .. The digested PCR products were purified using a DNA purification kit (Zymo Research #11-305C).

    Multiple Displacement Amplification:

    Article Title: Chromatin remodeling by the CHD7 protein is impaired by mutations that cause human developmental disorders
    Article Snippet: .. Here, we measured the ability of remodeling factors to expose an MfeI restriction site at +28-bp inside the nucleosomes and used 1.5 U/μL of MfeI-HF (New England Biolabs). hSWI/SNF complex concentrations are given assuming a Molecular Mass of ∼1.2 MDa). .. Data were quantified using the ImageQuantTL (GE Healthcare Life Sciences) and cut DNA intensity was normalized to cytosine content before calculating cut/uncut ratios and plotting the data using GraphPad Prism.

    Flow Cytometry:

    Article Title: Prediction of ultra-potent shRNAs with a sequential classification algorithm
    Article Snippet: Ligation products were MfeI-HF (NEB) digested to reduce background noise. .. All cell culture and flow cytometry procedures of the Sensor assay, to gradually enrich for the most potent shRNAs, were conducted as previously described , .

    Purification:

    Article Title: A Structural Basis for BRD2/4-Mediated Host Chromatin Interaction and Oligomer Assembly of Kaposi Sarcoma-Associated Herpesvirus and Murine Gammaherpesvirus LANA ProteinsMolecular Basis for Oligomeric-DNA Binding and Episome Maintenance by KSHV LANACrystal Structure of the Gamma-2 Herpesvirus LANA DNA Binding Domain Identifies Charged Surface Residues Which Impact Viral Latency
    Article Snippet: The episomal DNA was purified using phenol-chlorophorm extraction and the Gel lock columns (5PRIME), precipitated with ethanol and the pellet was dissolved in 20 µl of water. .. 90% of DNA was digested for 72 h with 60 U of MfeI HF (or KpnI) (NEB) and 60 U DpnI (NEB) and the remaining 10% with 40 U MfeI HF (or KpnI) only.

    Article Title: Rapid identification and expression of human TCRs in retrogenic mice
    Article Snippet: .. Purified PCR products from the beta nested reaction and the TCR-pMIA vector were digested with Bst bI (NEB #R0519S) and Mfe I (NEB #R3589L). .. The digested PCR products were purified using a DNA purification kit (Zymo Research #11-305C).

    Polymerase Chain Reaction:

    Article Title: Rapid identification and expression of human TCRs in retrogenic mice
    Article Snippet: .. Purified PCR products from the beta nested reaction and the TCR-pMIA vector were digested with Bst bI (NEB #R0519S) and Mfe I (NEB #R3589L). .. The digested PCR products were purified using a DNA purification kit (Zymo Research #11-305C).

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: Second, the intermediate pENTR plasmid was digested using MfeI-HF (New England Biolabs, Inc.) and BamHI, and then was ligated to a Pgk1 -NeoR fragment released from pENTR lox-FRT-rNeo using EcoRI and BamHI. .. Homology arms were amplified by PCR from C57BL/6 genomic DNA and the vector backbone was amplified from pDEST DTA-MLS ( ) using Q5 High-Fidelity DNA polymerase (New England Biolabs, Inc.) and primers listed in Table S2.

    Article Title: Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-Conversion and Inactivation of NHEJ Repair
    Article Snippet: .. To each 10 µl PCR, 5 µl of Mfe I-HF (NEB, R3589L) digestion mixture (1 µl 10× CutSmart buffer, 3.5 µl dH20, 0.5 µl Mfe I-HF) was added. .. The reaction was mixed, incubated at 37° for 1 hr, and then resolved on a 1.5% TAE-agarose gel.

    CRISPR:

    Article Title: Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-Conversion and Inactivation of NHEJ Repair
    Article Snippet: MfeI deletion assay Wild-type (WT) animals were microinjected with 50 ng/µl of pJW1138 or pJW1236 [klp-12 targeting CRISPR/Cas9 plasmids with original and flipped plus extended (F+E) sgRNAs, respectively], 10 ng/µl myo-2 ::tdTomato co-injection marker, and 40 ng/µl of pBluescript DNA. .. To each 10 µl PCR, 5 µl of Mfe I-HF (NEB, R3589L) digestion mixture (1 µl 10× CutSmart buffer, 3.5 µl dH20, 0.5 µl Mfe I-HF) was added.

    Agarose Gel Electrophoresis:

    Article Title: A Structural Basis for BRD2/4-Mediated Host Chromatin Interaction and Oligomer Assembly of Kaposi Sarcoma-Associated Herpesvirus and Murine Gammaherpesvirus LANA ProteinsMolecular Basis for Oligomeric-DNA Binding and Episome Maintenance by KSHV LANACrystal Structure of the Gamma-2 Herpesvirus LANA DNA Binding Domain Identifies Charged Surface Residues Which Impact Viral Latency
    Article Snippet: 90% of DNA was digested for 72 h with 60 U of MfeI HF (or KpnI) (NEB) and 60 U DpnI (NEB) and the remaining 10% with 40 U MfeI HF (or KpnI) only. .. Digested DNA was loaded and separated on a 0.8% agarose gel, and transferred to a nitrocellulose membrane by Southern blotting.

    Plasmid Preparation:

    Article Title: Prediction of ultra-potent shRNAs with a sequential classification algorithm
    Article Snippet: In step 1, oligonucleotides were amplified using the Sens3′Mfe (5′-TACAATACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3′, IDT) and Sens5′Xho (5′-ATTCATCACAATTGTCCGCGTCGATCCTAGG-3′, IDT) primers, XhoI/MfeI (NEB) digested, and ligated into an XhoI/EcoRI (NEB) digested pTNL backbone vector. .. Ligation products were MfeI-HF (NEB) digested to reduce background noise.

    Article Title: Corynebacterium pseudodiphtheriticum Exploits Staphylococcus aureus Virulence Components in a Novel Polymicrobial Defense Strategy
    Article Snippet: Recovered DNA was digested with MfeI-HF (New England Biolabs), and a self-ligation was performed via the addition of Quick ligase (New England Biolabs). .. Plasmid DNA was then extracted from these cultures using the QIAprep Spin miniprep kit according to the manufacturer’s instructions (Qiagen).

    Article Title: A Structural Basis for BRD2/4-Mediated Host Chromatin Interaction and Oligomer Assembly of Kaposi Sarcoma-Associated Herpesvirus and Murine Gammaherpesvirus LANA ProteinsMolecular Basis for Oligomeric-DNA Binding and Episome Maintenance by KSHV LANACrystal Structure of the Gamma-2 Herpesvirus LANA DNA Binding Domain Identifies Charged Surface Residues Which Impact Viral Latency
    Article Snippet: On the next day cells were transfected with pGTR4 plasmid , containing four KSHV terminal repeats (TR), and a GFP coding sequence and the pEGFP-C1 (Clontech) plasmid, used as an internal non-replicating control. .. 90% of DNA was digested for 72 h with 60 U of MfeI HF (or KpnI) (NEB) and 60 U DpnI (NEB) and the remaining 10% with 40 U MfeI HF (or KpnI) only.

    Article Title: Rapid identification and expression of human TCRs in retrogenic mice
    Article Snippet: .. Purified PCR products from the beta nested reaction and the TCR-pMIA vector were digested with Bst bI (NEB #R0519S) and Mfe I (NEB #R3589L). .. The digested PCR products were purified using a DNA purification kit (Zymo Research #11-305C).

    Article Title: Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells
    Article Snippet: .. Second, the intermediate pENTR plasmid was digested using MfeI-HF (New England Biolabs, Inc.) and BamHI, and then was ligated to a Pgk1 -NeoR fragment released from pENTR lox-FRT-rNeo using EcoRI and BamHI. .. Orientation of the synthetic fragment in the intermediate pENTR plasmid determined orientation of the Pgk1 -NeoR fragment in the final product, yielding either pENTR FRT-Neo or pENTR FRT-rNeo.

    shRNA:

    Article Title: Prediction of ultra-potent shRNAs with a sequential classification algorithm
    Article Snippet: For each of the 333 new genes, 300 primary predictions were generated by calculating the intersection of all transcript variants per gene (NCBI) and using DSIR supplemented with Sensor rules , to further impose shRNA-specific sequence requirements. .. Ligation products were MfeI-HF (NEB) digested to reduce background noise.

    DNA Deletion Assay:

    Article Title: Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-Conversion and Inactivation of NHEJ Repair
    Article Snippet: Paragraph title: MfeI deletion assay ... To each 10 µl PCR, 5 µl of Mfe I-HF (NEB, R3589L) digestion mixture (1 µl 10× CutSmart buffer, 3.5 µl dH20, 0.5 µl Mfe I-HF) was added.

    E. coli Genomic Assay:

    Article Title: Massively parallel characterization of restriction endonucleases
    Article Snippet: MfeI star activity After digestion of E. coli genomic DNA with MfeI in star activity conditions for 24 h, non-cognate sequences with single base pair changes from the cognate CAATTG were seen at digested sites. .. These star sites were also seen after digestion with an engineered high-specificity version of MfeI (MfeI-HF, NEB), although at much lower coverage compared with wild-type MfeI (see ).

    Marker:

    Article Title: Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-Conversion and Inactivation of NHEJ Repair
    Article Snippet: Marker positive F1 animals were picked into 30 µl of M9 + gelatin in a 96 well. .. To each 10 µl PCR, 5 µl of Mfe I-HF (NEB, R3589L) digestion mixture (1 µl 10× CutSmart buffer, 3.5 µl dH20, 0.5 µl Mfe I-HF) was added.

    Lysis:

    Article Title: A Structural Basis for BRD2/4-Mediated Host Chromatin Interaction and Oligomer Assembly of Kaposi Sarcoma-Associated Herpesvirus and Murine Gammaherpesvirus LANA ProteinsMolecular Basis for Oligomeric-DNA Binding and Episome Maintenance by KSHV LANACrystal Structure of the Gamma-2 Herpesvirus LANA DNA Binding Domain Identifies Charged Surface Residues Which Impact Viral Latency
    Article Snippet: 72 h later cells were harvested in lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM EDTA, 0.6% SDS). .. 90% of DNA was digested for 72 h with 60 U of MfeI HF (or KpnI) (NEB) and 60 U DpnI (NEB) and the remaining 10% with 40 U MfeI HF (or KpnI) only.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs mfei hf
    3C2D-qPCR design for characterizing centromere coupling. (A) Design of two primers (arrow) and one Taqman probe (ball-and-stick) to quantify the interaction between restriction fragments ligated together, each encompassing a non-homologous centromere (oval). (B) Distribution of restriction enzyme sites on fragments encompassing the centromere ( CEN ) on all 16 chromosomes using an <t>EcoRI</t> single digestion (3C) (left) or an <t>EcoRI-MfeI</t> double digestion (3C2D) (right). For each chromosome (on y-axis), the distances of the restriction sites delimitating the CEN fragment are given in kilobases (kb), in relation to the center of the CEN (x-axis). Blue vertical lines indicate EcoRI sites and red lines indicate MfeI sites.
    Mfei Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mfei hf/product/New England Biolabs
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    mfei hf - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results


    3C2D-qPCR design for characterizing centromere coupling. (A) Design of two primers (arrow) and one Taqman probe (ball-and-stick) to quantify the interaction between restriction fragments ligated together, each encompassing a non-homologous centromere (oval). (B) Distribution of restriction enzyme sites on fragments encompassing the centromere ( CEN ) on all 16 chromosomes using an EcoRI single digestion (3C) (left) or an EcoRI-MfeI double digestion (3C2D) (right). For each chromosome (on y-axis), the distances of the restriction sites delimitating the CEN fragment are given in kilobases (kb), in relation to the center of the CEN (x-axis). Blue vertical lines indicate EcoRI sites and red lines indicate MfeI sites.

    Journal: PLoS Genetics

    Article Title: Multiple Pairwise Analysis of Non-homologous Centromere Coupling Reveals Preferential Chromosome Size-Dependent Interactions and a Role for Bouquet Formation in Establishing the Interaction Pattern

    doi: 10.1371/journal.pgen.1006347

    Figure Lengend Snippet: 3C2D-qPCR design for characterizing centromere coupling. (A) Design of two primers (arrow) and one Taqman probe (ball-and-stick) to quantify the interaction between restriction fragments ligated together, each encompassing a non-homologous centromere (oval). (B) Distribution of restriction enzyme sites on fragments encompassing the centromere ( CEN ) on all 16 chromosomes using an EcoRI single digestion (3C) (left) or an EcoRI-MfeI double digestion (3C2D) (right). For each chromosome (on y-axis), the distances of the restriction sites delimitating the CEN fragment are given in kilobases (kb), in relation to the center of the CEN (x-axis). Blue vertical lines indicate EcoRI sites and red lines indicate MfeI sites.

    Article Snippet: For the double digestion, EcoRI-HF and MfeI-HF (NEB) generated cohesive ends that were compatible, yet recognizing slightly different sequences (GAATTC and CAATTG respectively).

    Techniques: Real-time Polymerase Chain Reaction