phusion high fidelity dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Phusion High Fidelity DNA Polymerase
    Description:
    Phusion High Fidelity DNA Polymerase 500 units
    Catalog Number:
    m0530l
    Price:
    446
    Size:
    500 units
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs phusion high fidelity dna polymerase
    Phusion High Fidelity DNA Polymerase
    Phusion High Fidelity DNA Polymerase 500 units
    https://www.bioz.com/result/phusion high fidelity dna polymerase/product/New England Biolabs
    Average 99 stars, based on 525 article reviews
    Price from $9.99 to $1999.99
    phusion high fidelity dna polymerase - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Demonstration of the Presence of the “Deleted” MIR122 Gene in HepG2 Cells
    Article Snippet: .. Such changes were still observed after amplification with Phusion High Fidelity DNA Polymerase, with 3/15 (20%) of single allele clones obtained from HepG2 and Huh-7 DNA showing apparent poly(T) slippage and also four sequence variants observed that were not seen in other clones of the same haplotype ( ). .. Overall, despite this sequence heterogeneity, the polymorphisms confirmed two different haplotypes in HepG2 DNA, consistent with the presence of two alleles of the pre-mir-122 stem-loop region.

    Centrifugation:

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction
    Article Snippet: For some fungal species, centrifugation of spores may be necessary to avoid transferring cell debris into the PCR reaction and to prevent inhibition during PCR reaction. .. Successful PCR amplification has also been obtained with a Phusion High‐Fidelity DNA polymerase (New England Biolabs; M0530; see Fig. A).

    Amplification:

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses
    Article Snippet: .. This result demonstrated that adequate distribution of sequencing reads between segments were obtained from a DNA library prepared from samples amplified by Phusion DNA polymerase (DNA library), and by whole-RNA library. .. Consistency of Illumina sequencing, and sequencing analysis of A/PR/8/34 and A/California/07/2009 strains Center for Biologics Evaluation and Research (CBER) stock of A/PR/8/34 was kindly provided by Dr. Peter Palese at Mount.

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses
    Article Snippet: .. Phusion protocol: Four microliters of viral cDNA was used as a template for PCR amplification in a total reaction volume of 50 μl, containing 0.2 μM of each universal primers: Universal_F (see above) and Universal_R: 5’GACATTTAGGTGACACTATAGAAGTAGAAACAAGG 3’, 200 μM of dNTP, 3 mM MgCl2 , and 1 unit of Phusion DNA polymerase (New England BioLabs, Ipswich, MA). .. PCR cycling conditions were as follows: an initial denaturation at 98°C for 30 sec followed by 35 cycles of 98°C for 10 sec, 55°C for 30 sec and 72°C for 5 min, and the final elongation at 72°C for 10 min. Extensor protocol: Four microliters of viral cDNA was used as a template for PCR amplification in a total reaction volume of 50 μl containing 0.4 μM of each universal primer (Universal_F and Universal_R), 500 μM of dNTP, 5 μl of 10x Extensor Buffer 2, and 2.5 units of Extensor PCR Enzyme Mix (5U/μl) (Dharmacon, Lafayette, CO).

    Article Title: Demonstration of the Presence of the “Deleted” MIR122 Gene in HepG2 Cells
    Article Snippet: .. Such changes were still observed after amplification with Phusion High Fidelity DNA Polymerase, with 3/15 (20%) of single allele clones obtained from HepG2 and Huh-7 DNA showing apparent poly(T) slippage and also four sequence variants observed that were not seen in other clones of the same haplotype ( ). .. Overall, despite this sequence heterogeneity, the polymorphisms confirmed two different haplotypes in HepG2 DNA, consistent with the presence of two alleles of the pre-mir-122 stem-loop region.

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: The extension was performed by addition of 0.4 units of Phusion High-Fidelity DNA Polymerase (New England Biolabs), 3 μl 1.0 mM dNTP, 5 units Ampligase (Epicenter Biotechnologies) in a 15-μl volume at 60°C for 15 min followed by 72°C for 15 min. .. The PCR was performed by the addition of 10 μl 5× GC buffer supplied wit the Phusion Polymerase Enzyme, 8 μl 1 mM dNTP, 25 pmol of each amplification primer, and 0.5 units Phusion polymerase (NEB).

    Article Title: A Set of Assays for the Comprehensive Analysis of FMR1 Alleles in the Fragile X–Related Disorders
    Article Snippet: .. These buffers were tested in the absence or presence of betaine, dimethyl sulfoxide, glycerol, 7-deaza-dGTP, and single-stranded DNA binding protein, compounds previously reported to facilitate the amplification of regions of high G + C-content., The best results were obtained with Phusion DNA polymerase and K+ -free buffers containing betaine and dimethyl sulfoxide. ..

    Article Title: Variations of five eIF4E genes across cassava accessions exhibiting tolerant and susceptible responses to cassava brown streak disease
    Article Snippet: Paragraph title: Reverse transcription-PCR amplification of eIF4E mRNA transcripts ... PCR was performed in a 20 μl reaction volume containing 10 unit Phusion DNA polymerase (NEB, Ipswich, MA), 1 μl of 1:5 diluted cDNA template, 1X Phusion PCR buffer, 5 μM each of upstream and downstream primers, and 250 nM dNTP with the following cycling condition: 98°C for 1 minute; 35 cycles of 98°C for 15 seconds, 56°C for 15 seconds, and 72°C for 45 seconds; and finally 72°C for 5 minutes.

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction
    Article Snippet: .. Successful PCR amplification has also been obtained with a Phusion High‐Fidelity DNA polymerase (New England Biolabs; M0530; see Fig. A). .. This polymerase was tested in the following PCR conditions for PCR products of ∼1.2 kb: 1 cycle at 98°C for 30 s followed by 35 cycles of 98°C for 10 s, 58°C for 20 s, 72°C for 45 s, and finally 1 cycle of 72°C for 5 min. 8 Following the PCR, mix 5 µl of the PCR reaction with 1 µl of 6× DNA loading dye and load the reactions on an agarose gel (Voytas, ).

    Synthesized:

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses
    Article Snippet: The RNA was eluted in a final volume of 60 μl of sterile RNase-free water. cDNA was synthesized using Superscript III Reverse Transcriptase (SSIII, Invitrogen, Carlsbad, CA) with Universal_F primer: 5’ GACTAATACGACTCACTATAGGGAGCAAAAGCAGG 3’. cDNA synthesis was performed in a reaction containing 10 μl of isolated viral RNA, 1.6 μM of Universal_F primer, 600 units of SSIII, 0.5 mM dNTPs, 50 mM DTT, and first strand buffer in a total volume of 50 μl. .. Phusion protocol: Four microliters of viral cDNA was used as a template for PCR amplification in a total reaction volume of 50 μl, containing 0.2 μM of each universal primers: Universal_F (see above) and Universal_R: 5’GACATTTAGGTGACACTATAGAAGTAGAAACAAGG 3’, 200 μM of dNTP, 3 mM MgCl2 , and 1 unit of Phusion DNA polymerase (New England BioLabs, Ipswich, MA).

    Article Title: Preparation of 5?-O-(1-Thiotriphosphate)-Modified Oligonucleotides Using Polymerase-Endonuclease Amplification Reaction (PEAR)
    Article Snippet: Materials Phusion high fidelity DNA polymerase, highly thermostable restriction enzyme PspGI and dNTPs are purchased from New England Biolabs , Inc . .. The recognition site (R) of PspGI is CCWGG, where W = A or T. Synthetic ODNs, including a target (X ) and a probe (P ), are synthesized by Integrated DNA Technologies, Inc. and purified by HPLC.

    Article Title: Enzymatic Synthesis of Modified Oligonucleotides by PEAR Using Phusion and KOD DNA Polymerases
    Article Snippet: Four 2′-fluoro-2′-deoxyribinucleoside-5′-triphosphates (2′-F-dNTPs), including 2′-F-dATP, 2′-F-dCTP, 2′-F-dGTP, 2′-F-dUTP and four 2′-deoxyribonucleotides-5′-O-(1-thiotriphosphate) (dNTPαSs), including dATPαS, dGTPαS, dCTPαS, and dTTPαS, whose structural formula are shown in , were purchased from Trilink BioTechnologies, Inc. KOD DNA polymerase was purchased from TOYOBO (Shanghai) Biotech Co., Ltd. Phusion DNA polymerase, highly thermostable restriction enzyme PspGI, and dNTPs were purchased from New England Biolabs, Inc. UNIQ-10 Spin Column Oligo DNA Purification Kit was purchased from Sangon Biotech (Shanghai) Co., Ltd. .. Synthetic oligodeoxynucleotides, including a target ( X ) and a probe ( P ), were synthesized by Integrated DNA Technologies, Inc. and purified by high-performance liquid chromatography (HPLC).

    Electrophoresis:

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses
    Article Snippet: Phusion protocol: Four microliters of viral cDNA was used as a template for PCR amplification in a total reaction volume of 50 μl, containing 0.2 μM of each universal primers: Universal_F (see above) and Universal_R: 5’GACATTTAGGTGACACTATAGAAGTAGAAACAAGG 3’, 200 μM of dNTP, 3 mM MgCl2 , and 1 unit of Phusion DNA polymerase (New England BioLabs, Ipswich, MA). .. The resulting eight DNA amplicons representing all segments of viral genome were separated by electrophoresis in 1% agarose gels with ethidium bromide (Lonza, Rockland, ME) and visualized using the Kodak Gel Logic 200 Imaging System and Kodak Molecular Imaging Software (Carestream Health, Inc. Rochester, NY).

    Incubation:

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses
    Article Snippet: The reaction mixture was incubated at 55°C for two hours, followed by SSIII inactivation at 70°C for 20 min. Two different PCR protocols were used to simultaneously amplify all genome segments of influenza virus. .. Phusion protocol: Four microliters of viral cDNA was used as a template for PCR amplification in a total reaction volume of 50 μl, containing 0.2 μM of each universal primers: Universal_F (see above) and Universal_R: 5’GACATTTAGGTGACACTATAGAAGTAGAAACAAGG 3’, 200 μM of dNTP, 3 mM MgCl2 , and 1 unit of Phusion DNA polymerase (New England BioLabs, Ipswich, MA).

    Expressing:

    Article Title: Cellular reagents for diagnostics and synthetic biology
    Article Snippet: Assemblies using pure enzymes contained 0.08 units of T5 exonuclease (NEB), 0.5 units of Phusion DNA polymerase (NEB) and 80 units of Taq DNA ligase (NEB). .. For Gibson assemblies using cellular reagents the pure enzymes were substituted with individual Top10 E . coli cellular reagents expressing Taq DNA Ligase, Taq DNA polymerase, and T5 exonuclease.

    Transformation Assay:

    Article Title: Cellular reagents for diagnostics and synthetic biology
    Article Snippet: Paragraph title: Gibson assembly and transformation of chemically competent bacteria ... Assemblies using pure enzymes contained 0.08 units of T5 exonuclease (NEB), 0.5 units of Phusion DNA polymerase (NEB) and 80 units of Taq DNA ligase (NEB).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Preparation of 5?-O-(1-Thiotriphosphate)-Modified Oligonucleotides Using Polymerase-Endonuclease Amplification Reaction (PEAR)
    Article Snippet: Materials Phusion high fidelity DNA polymerase, highly thermostable restriction enzyme PspGI and dNTPs are purchased from New England Biolabs , Inc . .. The sequence of X is: TG T AAA CAT CCT CGA CTG GAA G , which is derived from human microRNA hsa-miR-30a.

    Article Title: Enzymatic Synthesis of Modified Oligonucleotides by PEAR Using Phusion and KOD DNA Polymerases
    Article Snippet: Four 2′-fluoro-2′-deoxyribinucleoside-5′-triphosphates (2′-F-dNTPs), including 2′-F-dATP, 2′-F-dCTP, 2′-F-dGTP, 2′-F-dUTP and four 2′-deoxyribonucleotides-5′-O-(1-thiotriphosphate) (dNTPαSs), including dATPαS, dGTPαS, dCTPαS, and dTTPαS, whose structural formula are shown in , were purchased from Trilink BioTechnologies, Inc. KOD DNA polymerase was purchased from TOYOBO (Shanghai) Biotech Co., Ltd. Phusion DNA polymerase, highly thermostable restriction enzyme PspGI, and dNTPs were purchased from New England Biolabs, Inc. UNIQ-10 Spin Column Oligo DNA Purification Kit was purchased from Sangon Biotech (Shanghai) Co., Ltd. .. The sequence of X is 5′-TGT AAA CAT CCT CGA CTG GAA G-3′, which is derived from human microRNA hsa-miR-30a.

    Derivative Assay:

    Article Title: Preparation of 5?-O-(1-Thiotriphosphate)-Modified Oligonucleotides Using Polymerase-Endonuclease Amplification Reaction (PEAR)
    Article Snippet: Materials Phusion high fidelity DNA polymerase, highly thermostable restriction enzyme PspGI and dNTPs are purchased from New England Biolabs , Inc . .. The sequence of X is: TG T AAA CAT CCT CGA CTG GAA G , which is derived from human microRNA hsa-miR-30a.

    Article Title: Enzymatic Synthesis of Modified Oligonucleotides by PEAR Using Phusion and KOD DNA Polymerases
    Article Snippet: Four 2′-fluoro-2′-deoxyribinucleoside-5′-triphosphates (2′-F-dNTPs), including 2′-F-dATP, 2′-F-dCTP, 2′-F-dGTP, 2′-F-dUTP and four 2′-deoxyribonucleotides-5′-O-(1-thiotriphosphate) (dNTPαSs), including dATPαS, dGTPαS, dCTPαS, and dTTPαS, whose structural formula are shown in , were purchased from Trilink BioTechnologies, Inc. KOD DNA polymerase was purchased from TOYOBO (Shanghai) Biotech Co., Ltd. Phusion DNA polymerase, highly thermostable restriction enzyme PspGI, and dNTPs were purchased from New England Biolabs, Inc. UNIQ-10 Spin Column Oligo DNA Purification Kit was purchased from Sangon Biotech (Shanghai) Co., Ltd. .. The sequence of X is 5′-TGT AAA CAT CCT CGA CTG GAA G-3′, which is derived from human microRNA hsa-miR-30a.

    High Performance Liquid Chromatography:

    Article Title: Preparation of 5?-O-(1-Thiotriphosphate)-Modified Oligonucleotides Using Polymerase-Endonuclease Amplification Reaction (PEAR)
    Article Snippet: Materials Phusion high fidelity DNA polymerase, highly thermostable restriction enzyme PspGI and dNTPs are purchased from New England Biolabs , Inc . .. The recognition site (R) of PspGI is CCWGG, where W = A or T. Synthetic ODNs, including a target (X ) and a probe (P ), are synthesized by Integrated DNA Technologies, Inc. and purified by HPLC.

    Article Title: Enzymatic Synthesis of Modified Oligonucleotides by PEAR Using Phusion and KOD DNA Polymerases
    Article Snippet: Four 2′-fluoro-2′-deoxyribinucleoside-5′-triphosphates (2′-F-dNTPs), including 2′-F-dATP, 2′-F-dCTP, 2′-F-dGTP, 2′-F-dUTP and four 2′-deoxyribonucleotides-5′-O-(1-thiotriphosphate) (dNTPαSs), including dATPαS, dGTPαS, dCTPαS, and dTTPαS, whose structural formula are shown in , were purchased from Trilink BioTechnologies, Inc. KOD DNA polymerase was purchased from TOYOBO (Shanghai) Biotech Co., Ltd. Phusion DNA polymerase, highly thermostable restriction enzyme PspGI, and dNTPs were purchased from New England Biolabs, Inc. UNIQ-10 Spin Column Oligo DNA Purification Kit was purchased from Sangon Biotech (Shanghai) Co., Ltd. .. Synthetic oligodeoxynucleotides, including a target ( X ) and a probe ( P ), were synthesized by Integrated DNA Technologies, Inc. and purified by high-performance liquid chromatography (HPLC).

    Transferring:

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction
    Article Snippet: For some fungal species, centrifugation of spores may be necessary to avoid transferring cell debris into the PCR reaction and to prevent inhibition during PCR reaction. .. Successful PCR amplification has also been obtained with a Phusion High‐Fidelity DNA polymerase (New England Biolabs; M0530; see Fig. A).

    Infection:

    Article Title: Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease
    Article Snippet: T7 Endonuclease I Assay Genomic DNA from infected cells were extracted with a commercial kit (DNeasy Blood and Tissue Kit; Qiagen, Hilden, Germany) following manufacturer's protocol, and quantified using a spectrophotometer (NanoDrop 2000c; Thermo Fisher Scientific). .. The targeted regions in exon 1 of the VEGF-A gene were PCR-amplifed with high-fidelity DNA polymerase (Phusion; New England Biolabs, Ipswich, MA, USA) using primers flanking the target sites ( ) and purified with a PCR purification kit (QIAquick; Qiagen).

    Inhibition:

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction
    Article Snippet: For some fungal species, centrifugation of spores may be necessary to avoid transferring cell debris into the PCR reaction and to prevent inhibition during PCR reaction. .. Successful PCR amplification has also been obtained with a Phusion High‐Fidelity DNA polymerase (New England Biolabs; M0530; see Fig. A).

    Imaging:

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses
    Article Snippet: Phusion protocol: Four microliters of viral cDNA was used as a template for PCR amplification in a total reaction volume of 50 μl, containing 0.2 μM of each universal primers: Universal_F (see above) and Universal_R: 5’GACATTTAGGTGACACTATAGAAGTAGAAACAAGG 3’, 200 μM of dNTP, 3 mM MgCl2 , and 1 unit of Phusion DNA polymerase (New England BioLabs, Ipswich, MA). .. The resulting eight DNA amplicons representing all segments of viral genome were separated by electrophoresis in 1% agarose gels with ethidium bromide (Lonza, Rockland, ME) and visualized using the Kodak Gel Logic 200 Imaging System and Kodak Molecular Imaging Software (Carestream Health, Inc. Rochester, NY).

    Sequencing:

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses
    Article Snippet: .. This result demonstrated that adequate distribution of sequencing reads between segments were obtained from a DNA library prepared from samples amplified by Phusion DNA polymerase (DNA library), and by whole-RNA library. .. Consistency of Illumina sequencing, and sequencing analysis of A/PR/8/34 and A/California/07/2009 strains Center for Biologics Evaluation and Research (CBER) stock of A/PR/8/34 was kindly provided by Dr. Peter Palese at Mount.

    Article Title: Preparation of 5?-O-(1-Thiotriphosphate)-Modified Oligonucleotides Using Polymerase-Endonuclease Amplification Reaction (PEAR)
    Article Snippet: Materials Phusion high fidelity DNA polymerase, highly thermostable restriction enzyme PspGI and dNTPs are purchased from New England Biolabs , Inc . .. The sequence of X is: TG T AAA CAT CCT CGA CTG GAA G , which is derived from human microRNA hsa-miR-30a.

    Article Title: Demonstration of the Presence of the “Deleted” MIR122 Gene in HepG2 Cells
    Article Snippet: .. Such changes were still observed after amplification with Phusion High Fidelity DNA Polymerase, with 3/15 (20%) of single allele clones obtained from HepG2 and Huh-7 DNA showing apparent poly(T) slippage and also four sequence variants observed that were not seen in other clones of the same haplotype ( ). .. Overall, despite this sequence heterogeneity, the polymorphisms confirmed two different haplotypes in HepG2 DNA, consistent with the presence of two alleles of the pre-mir-122 stem-loop region.

    Article Title: Variations of five eIF4E genes across cassava accessions exhibiting tolerant and susceptible responses to cassava brown streak disease
    Article Snippet: PCR was performed in a 20 μl reaction volume containing 10 unit Phusion DNA polymerase (NEB, Ipswich, MA), 1 μl of 1:5 diluted cDNA template, 1X Phusion PCR buffer, 5 μM each of upstream and downstream primers, and 250 nM dNTP with the following cycling condition: 98°C for 1 minute; 35 cycles of 98°C for 15 seconds, 56°C for 15 seconds, and 72°C for 45 seconds; and finally 72°C for 5 minutes. .. Primers were designed according to five annotated eIF4E transcripts identified in the draft cassava genomic sequence (Manihot esculenta v4.1) published in Phytozome ( http://phytozome.jgi.doe.gov ) in 2013, prior to the availability of the current cassava genome V6.1 ( ).

    Article Title: Enzymatic Synthesis of Modified Oligonucleotides by PEAR Using Phusion and KOD DNA Polymerases
    Article Snippet: Four 2′-fluoro-2′-deoxyribinucleoside-5′-triphosphates (2′-F-dNTPs), including 2′-F-dATP, 2′-F-dCTP, 2′-F-dGTP, 2′-F-dUTP and four 2′-deoxyribonucleotides-5′-O-(1-thiotriphosphate) (dNTPαSs), including dATPαS, dGTPαS, dCTPαS, and dTTPαS, whose structural formula are shown in , were purchased from Trilink BioTechnologies, Inc. KOD DNA polymerase was purchased from TOYOBO (Shanghai) Biotech Co., Ltd. Phusion DNA polymerase, highly thermostable restriction enzyme PspGI, and dNTPs were purchased from New England Biolabs, Inc. UNIQ-10 Spin Column Oligo DNA Purification Kit was purchased from Sangon Biotech (Shanghai) Co., Ltd. .. The sequence of X is 5′-TGT AAA CAT CCT CGA CTG GAA G-3′, which is derived from human microRNA hsa-miR-30a.

    Binding Assay:

    Article Title: A Set of Assays for the Comprehensive Analysis of FMR1 Alleles in the Fragile X–Related Disorders
    Article Snippet: .. These buffers were tested in the absence or presence of betaine, dimethyl sulfoxide, glycerol, 7-deaza-dGTP, and single-stranded DNA binding protein, compounds previously reported to facilitate the amplification of regions of high G + C-content., The best results were obtained with Phusion DNA polymerase and K+ -free buffers containing betaine and dimethyl sulfoxide. ..

    Isolation:

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses
    Article Snippet: The RNA was eluted in a final volume of 60 μl of sterile RNase-free water. cDNA was synthesized using Superscript III Reverse Transcriptase (SSIII, Invitrogen, Carlsbad, CA) with Universal_F primer: 5’ GACTAATACGACTCACTATAGGGAGCAAAAGCAGG 3’. cDNA synthesis was performed in a reaction containing 10 μl of isolated viral RNA, 1.6 μM of Universal_F primer, 600 units of SSIII, 0.5 mM dNTPs, 50 mM DTT, and first strand buffer in a total volume of 50 μl. .. Phusion protocol: Four microliters of viral cDNA was used as a template for PCR amplification in a total reaction volume of 50 μl, containing 0.2 μM of each universal primers: Universal_F (see above) and Universal_R: 5’GACATTTAGGTGACACTATAGAAGTAGAAACAAGG 3’, 200 μM of dNTP, 3 mM MgCl2 , and 1 unit of Phusion DNA polymerase (New England BioLabs, Ipswich, MA).

    Size-exclusion Chromatography:

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses
    Article Snippet: Phusion protocol: Four microliters of viral cDNA was used as a template for PCR amplification in a total reaction volume of 50 μl, containing 0.2 μM of each universal primers: Universal_F (see above) and Universal_R: 5’GACATTTAGGTGACACTATAGAAGTAGAAACAAGG 3’, 200 μM of dNTP, 3 mM MgCl2 , and 1 unit of Phusion DNA polymerase (New England BioLabs, Ipswich, MA). .. PCR cycling conditions were as follows: an initial denaturation at 98°C for 30 sec followed by 35 cycles of 98°C for 10 sec, 55°C for 30 sec and 72°C for 5 min, and the final elongation at 72°C for 10 min. Extensor protocol: Four microliters of viral cDNA was used as a template for PCR amplification in a total reaction volume of 50 μl containing 0.4 μM of each universal primer (Universal_F and Universal_R), 500 μM of dNTP, 5 μl of 10x Extensor Buffer 2, and 2.5 units of Extensor PCR Enzyme Mix (5U/μl) (Dharmacon, Lafayette, CO).

    Purification:

    Article Title: Preparation of 5?-O-(1-Thiotriphosphate)-Modified Oligonucleotides Using Polymerase-Endonuclease Amplification Reaction (PEAR)
    Article Snippet: Materials Phusion high fidelity DNA polymerase, highly thermostable restriction enzyme PspGI and dNTPs are purchased from New England Biolabs , Inc . .. The recognition site (R) of PspGI is CCWGG, where W = A or T. Synthetic ODNs, including a target (X ) and a probe (P ), are synthesized by Integrated DNA Technologies, Inc. and purified by HPLC.

    Article Title: Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease
    Article Snippet: .. The targeted regions in exon 1 of the VEGF-A gene were PCR-amplifed with high-fidelity DNA polymerase (Phusion; New England Biolabs, Ipswich, MA, USA) using primers flanking the target sites ( ) and purified with a PCR purification kit (QIAquick; Qiagen). .. We denatured 200 ng of the PCR product then slowly hybridized to form heteroduplexes using the following program settings: 95°C for 5 minutes, 95° to 85°C at −2°C/second, 85° to 25°C at −0.1°C/second.

    Article Title: Enzymatic Synthesis of Modified Oligonucleotides by PEAR Using Phusion and KOD DNA Polymerases
    Article Snippet: Four 2′-fluoro-2′-deoxyribinucleoside-5′-triphosphates (2′-F-dNTPs), including 2′-F-dATP, 2′-F-dCTP, 2′-F-dGTP, 2′-F-dUTP and four 2′-deoxyribonucleotides-5′-O-(1-thiotriphosphate) (dNTPαSs), including dATPαS, dGTPαS, dCTPαS, and dTTPαS, whose structural formula are shown in , were purchased from Trilink BioTechnologies, Inc. KOD DNA polymerase was purchased from TOYOBO (Shanghai) Biotech Co., Ltd. Phusion DNA polymerase, highly thermostable restriction enzyme PspGI, and dNTPs were purchased from New England Biolabs, Inc. UNIQ-10 Spin Column Oligo DNA Purification Kit was purchased from Sangon Biotech (Shanghai) Co., Ltd. .. Synthetic oligodeoxynucleotides, including a target ( X ) and a probe ( P ), were synthesized by Integrated DNA Technologies, Inc. and purified by high-performance liquid chromatography (HPLC).

    Polymerase Chain Reaction:

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses
    Article Snippet: .. Phusion protocol: Four microliters of viral cDNA was used as a template for PCR amplification in a total reaction volume of 50 μl, containing 0.2 μM of each universal primers: Universal_F (see above) and Universal_R: 5’GACATTTAGGTGACACTATAGAAGTAGAAACAAGG 3’, 200 μM of dNTP, 3 mM MgCl2 , and 1 unit of Phusion DNA polymerase (New England BioLabs, Ipswich, MA). .. PCR cycling conditions were as follows: an initial denaturation at 98°C for 30 sec followed by 35 cycles of 98°C for 10 sec, 55°C for 30 sec and 72°C for 5 min, and the final elongation at 72°C for 10 min. Extensor protocol: Four microliters of viral cDNA was used as a template for PCR amplification in a total reaction volume of 50 μl containing 0.4 μM of each universal primer (Universal_F and Universal_R), 500 μM of dNTP, 5 μl of 10x Extensor Buffer 2, and 2.5 units of Extensor PCR Enzyme Mix (5U/μl) (Dharmacon, Lafayette, CO).

    Article Title: A comprehensive assay for targeted multiplex amplification of human DNA sequences
    Article Snippet: The extension was performed by addition of 0.4 units of Phusion High-Fidelity DNA Polymerase (New England Biolabs), 3 μl 1.0 mM dNTP, 5 units Ampligase (Epicenter Biotechnologies) in a 15-μl volume at 60°C for 15 min followed by 72°C for 15 min. .. The PCR was performed by the addition of 10 μl 5× GC buffer supplied wit the Phusion Polymerase Enzyme, 8 μl 1 mM dNTP, 25 pmol of each amplification primer, and 0.5 units Phusion polymerase (NEB).

    Article Title: Variations of five eIF4E genes across cassava accessions exhibiting tolerant and susceptible responses to cassava brown streak disease
    Article Snippet: .. PCR was performed in a 20 μl reaction volume containing 10 unit Phusion DNA polymerase (NEB, Ipswich, MA), 1 μl of 1:5 diluted cDNA template, 1X Phusion PCR buffer, 5 μM each of upstream and downstream primers, and 250 nM dNTP with the following cycling condition: 98°C for 1 minute; 35 cycles of 98°C for 15 seconds, 56°C for 15 seconds, and 72°C for 45 seconds; and finally 72°C for 5 minutes. .. Primers were designed according to five annotated eIF4E transcripts identified in the draft cassava genomic sequence (Manihot esculenta v4.1) published in Phytozome ( http://phytozome.jgi.doe.gov ) in 2013, prior to the availability of the current cassava genome V6.1 ( ).

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction
    Article Snippet: .. Successful PCR amplification has also been obtained with a Phusion High‐Fidelity DNA polymerase (New England Biolabs; M0530; see Fig. A). .. This polymerase was tested in the following PCR conditions for PCR products of ∼1.2 kb: 1 cycle at 98°C for 30 s followed by 35 cycles of 98°C for 10 s, 58°C for 20 s, 72°C for 45 s, and finally 1 cycle of 72°C for 5 min. 8 Following the PCR, mix 5 µl of the PCR reaction with 1 µl of 6× DNA loading dye and load the reactions on an agarose gel (Voytas, ).

    Article Title: Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease
    Article Snippet: .. The targeted regions in exon 1 of the VEGF-A gene were PCR-amplifed with high-fidelity DNA polymerase (Phusion; New England Biolabs, Ipswich, MA, USA) using primers flanking the target sites ( ) and purified with a PCR purification kit (QIAquick; Qiagen). .. We denatured 200 ng of the PCR product then slowly hybridized to form heteroduplexes using the following program settings: 95°C for 5 minutes, 95° to 85°C at −2°C/second, 85° to 25°C at −0.1°C/second.

    T7EI Assay:

    Article Title: Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease
    Article Snippet: Paragraph title: T7 Endonuclease I Assay ... The targeted regions in exon 1 of the VEGF-A gene were PCR-amplifed with high-fidelity DNA polymerase (Phusion; New England Biolabs, Ipswich, MA, USA) using primers flanking the target sites ( ) and purified with a PCR purification kit (QIAquick; Qiagen).

    Software:

    Article Title: Deep Sequencing for Evaluation of Genetic Stability of Influenza A/California/07/2009 (H1N1) Vaccine Viruses
    Article Snippet: Phusion protocol: Four microliters of viral cDNA was used as a template for PCR amplification in a total reaction volume of 50 μl, containing 0.2 μM of each universal primers: Universal_F (see above) and Universal_R: 5’GACATTTAGGTGACACTATAGAAGTAGAAACAAGG 3’, 200 μM of dNTP, 3 mM MgCl2 , and 1 unit of Phusion DNA polymerase (New England BioLabs, Ipswich, MA). .. The resulting eight DNA amplicons representing all segments of viral genome were separated by electrophoresis in 1% agarose gels with ethidium bromide (Lonza, Rockland, ME) and visualized using the Kodak Gel Logic 200 Imaging System and Kodak Molecular Imaging Software (Carestream Health, Inc. Rochester, NY).

    Agarose Gel Electrophoresis:

    Article Title: Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction). Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction
    Article Snippet: Successful PCR amplification has also been obtained with a Phusion High‐Fidelity DNA polymerase (New England Biolabs; M0530; see Fig. A). .. This polymerase was tested in the following PCR conditions for PCR products of ∼1.2 kb: 1 cycle at 98°C for 30 s followed by 35 cycles of 98°C for 10 s, 58°C for 20 s, 72°C for 45 s, and finally 1 cycle of 72°C for 5 min. 8 Following the PCR, mix 5 µl of the PCR reaction with 1 µl of 6× DNA loading dye and load the reactions on an agarose gel (Voytas, ).

    Article Title: Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease
    Article Snippet: The targeted regions in exon 1 of the VEGF-A gene were PCR-amplifed with high-fidelity DNA polymerase (Phusion; New England Biolabs, Ipswich, MA, USA) using primers flanking the target sites ( ) and purified with a PCR purification kit (QIAquick; Qiagen). .. The reaction was stopped with 0.02 M EDTA, and the digested products were separated on a 2% TBE agarose gel for analysis.

    Spectrophotometry:

    Article Title: Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease
    Article Snippet: T7 Endonuclease I Assay Genomic DNA from infected cells were extracted with a commercial kit (DNeasy Blood and Tissue Kit; Qiagen, Hilden, Germany) following manufacturer's protocol, and quantified using a spectrophotometer (NanoDrop 2000c; Thermo Fisher Scientific). .. The targeted regions in exon 1 of the VEGF-A gene were PCR-amplifed with high-fidelity DNA polymerase (Phusion; New England Biolabs, Ipswich, MA, USA) using primers flanking the target sites ( ) and purified with a PCR purification kit (QIAquick; Qiagen).

    DNA Purification:

    Article Title: Enzymatic Synthesis of Modified Oligonucleotides by PEAR Using Phusion and KOD DNA Polymerases
    Article Snippet: .. Four 2′-fluoro-2′-deoxyribinucleoside-5′-triphosphates (2′-F-dNTPs), including 2′-F-dATP, 2′-F-dCTP, 2′-F-dGTP, 2′-F-dUTP and four 2′-deoxyribonucleotides-5′-O-(1-thiotriphosphate) (dNTPαSs), including dATPαS, dGTPαS, dCTPαS, and dTTPαS, whose structural formula are shown in , were purchased from Trilink BioTechnologies, Inc. KOD DNA polymerase was purchased from TOYOBO (Shanghai) Biotech Co., Ltd. Phusion DNA polymerase, highly thermostable restriction enzyme PspGI, and dNTPs were purchased from New England Biolabs, Inc. UNIQ-10 Spin Column Oligo DNA Purification Kit was purchased from Sangon Biotech (Shanghai) Co., Ltd. .. Synthetic oligodeoxynucleotides, including a target ( X ) and a probe ( P ), were synthesized by Integrated DNA Technologies, Inc. and purified by high-performance liquid chromatography (HPLC).

    CTG Assay:

    Article Title: Preparation of 5?-O-(1-Thiotriphosphate)-Modified Oligonucleotides Using Polymerase-Endonuclease Amplification Reaction (PEAR)
    Article Snippet: Materials Phusion high fidelity DNA polymerase, highly thermostable restriction enzyme PspGI and dNTPs are purchased from New England Biolabs , Inc . .. The sequence of X is: TG T AAA CAT CCT CGA CTG GAA G , which is derived from human microRNA hsa-miR-30a.

    Article Title: Enzymatic Synthesis of Modified Oligonucleotides by PEAR Using Phusion and KOD DNA Polymerases
    Article Snippet: Four 2′-fluoro-2′-deoxyribinucleoside-5′-triphosphates (2′-F-dNTPs), including 2′-F-dATP, 2′-F-dCTP, 2′-F-dGTP, 2′-F-dUTP and four 2′-deoxyribonucleotides-5′-O-(1-thiotriphosphate) (dNTPαSs), including dATPαS, dGTPαS, dCTPαS, and dTTPαS, whose structural formula are shown in , were purchased from Trilink BioTechnologies, Inc. KOD DNA polymerase was purchased from TOYOBO (Shanghai) Biotech Co., Ltd. Phusion DNA polymerase, highly thermostable restriction enzyme PspGI, and dNTPs were purchased from New England Biolabs, Inc. UNIQ-10 Spin Column Oligo DNA Purification Kit was purchased from Sangon Biotech (Shanghai) Co., Ltd. .. The sequence of X is 5′-TGT AAA CAT CCT CGA CTG GAA G-3′, which is derived from human microRNA hsa-miR-30a.

    other:

    Article Title: TT(N)mGCCTC inhibits archaeal family B DNA polymerases
    Article Snippet: Phusion® High-Fidelity DNA Polymerase (Phusion) and Q5® High-Fidelity DNA Polymerase (Q5) were from New England Biolabs.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs mfei hf
    Mfei Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mfei hf/product/New England Biolabs
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    mfei hf - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results