bbsi hf  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    BbsI HF
    Description:
    BbsI HF 1 500 units
    Catalog Number:
    r3539l
    Price:
    282
    Size:
    1 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs bbsi hf
    BbsI HF
    BbsI HF 1 500 units
    https://www.bioz.com/result/bbsi hf/product/New England Biolabs
    Average 95 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    bbsi hf - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Repression of Transcription at DNA Breaks Requires Cohesin throughout Interphase and Prevents Genome Instability
    Article Snippet: .. Assay for CRISPR-Cas9-Induced TMPRSS2:ERG Translocations CRISPR guide RNA sequences against the TMPRSS2 gene (Primer pair TMPRSS2-CR-3) and the ERG gene (Primer pair ERG-CR-2) (from ) were cloned in to the Cas9-empty plasmid (pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid ( ) using BbsI-HF (NEB; R3539S) restriction enzyme to create Cas9-TMPRSS2 and Cas9-ERG plasmids. .. LNCaP cells subjected to the 2-hit siRNA depletion in CSS-RPMI media were trypsinised on day 3, counted and 4x10ˆ5 cells transfected with either 6μg Cas9-empty plasmid or 3μg each for plasmids Cas9-TMPRSS2 and Cas9-ERG in CSS RPMI media with or without 300nM DHT.

    Article Title: Dynamic nanoscale morphology of the ER surveyed by STED microscopy
    Article Snippet: .. The annealed oligonucleotides were cloned into pSPCas9(BB)-2A-Puro (PX459) v2.0 (a gift from F. Zhang; Addgene plasmid 62988; ) that had been digested with BbsI-HF (R3539; New England BioLabs). .. The HDR template was generated to add a five-glycine linker and HaloTag7 sequence to the 3′ end of the NUP160 gene, fusing Halo to the C terminus of all NUP160 isoforms.

    Article Title: Repression of Transcription at DNA Breaks Requires Cohesin throughout Interphase and Prevents Genome Instability
    Article Snippet: .. CRISPR guide RNA sequences against the TMPRSS2 gene (Primer pair TMPRSS2-CR-3) and the ERG gene (Primer pair ERG-CR-2) (from ) were cloned in to the Cas9-empty plasmid (pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid ( ) using BbsI-HF (NEB; R3539S) restriction enzyme to create Cas9-TMPRSS2 and Cas9-ERG plasmids. .. LNCaP cells subjected to the 2-hit siRNA depletion in CSS-RPMI media were trypsinised on day 3, counted and 4x10ˆ5 cells transfected with either 6μg Cas9-empty plasmid or 3μg each for plasmids Cas9-TMPRSS2 and Cas9-ERG in CSS RPMI media with or without 300nM DHT.

    Article Title: Dissection of central clock function in Drosophila through cell-specific CRISPR-mediated clock gene disruption
    Article Snippet: .. Cloning Multiple gRNAs targeting per , tim , or acp98AB were constructed as previously described ( ). gRNA sequences were selected for predicted target specificity and efficiency according to http://chopchop.cbu.uib.no/ ( ). pCFD6 (Addgene #73915) was digested with BbsI-HF (NEB #R3539S) and gel purified. .. For each construct, inserts were generated in three separate PCR reactions using pCFD6 as the template and the primers listed in .

    Article Title: A Drosophila CRISPR/Cas9 Toolkit for Conditionally Manipulating Gene Expression in the Prothoracic Gland as a Test Case for Polytene Tissues
    Article Snippet: Paragraph title: gRNA selection and cloning ... The pCFD5 and PG-gRNA plasmids were pre-digested with BbsI (NEB R3539S) and fused to appropriate gRNA-containing PCR fragments via the Gibson reaction, followed by Sanger sequencing.

    Article Title: A fat-tissue sensor couples growth to oxygen availability by remotely controlling insulin secretion
    Article Snippet: The Cas9 target sequences below were synthesized as part of long oligonucleotides that were used to amplify gRNA structural sequences from pCFD6 using Q5 polymerase (New England Biolabs, #M0491S); plasmid template DNA was then removed by DpnI digestion (NEB, #R0176S). pCFD6 was linearized by BbsI digestion (NEB, #R3539S) and treated with alkaline phosphatase (NEB, #M0290S) to prevent self-ligation. .. Clones were analyzed by PCR and sequence confirmed. pCFD6-UAS-Hph KO and pCFD6-UAS-sima KO were integrated into landing site attP2 (third chromosome) in-house and by BestGene (Chino Hills, CA) using standard methods.

    Article Title: CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons
    Article Snippet: .. The reaction was conducted for 1 hr at 37°C followed by incubation for 5 min at 95°C and gradual temperature decrease from 95°C to 15°C. sgSTOP oligonucleotides were cloned into the B52 plasmid, which was digested with either BbsI-HF (NEB #R3539L) or BsmBI (NEB #R0580L) in a 20 μL reaction according to the manufacturer’s recommendations. .. 0.5 μL of recombinant shrimp alkaline phosphatase (NEB #M0371L) were then added to the digestion reaction and incubated for 1hr at 37°C to dephosphorylate the plasmid.

    Article Title: Homology-Directed Repair of a Defective Glabrous Gene in Arabidopsis With Cas9-Based Gene Targeting
    Article Snippet: Paragraph title: Cloning of a Binary T-DNA Repair Vector for In Planta Gene Targeting Repair Approach ... After digestion of pEN-C1.1 with BbsI-HF (New England Biolabs), we inserted the target sequence (AAGAGATGTGGGAAAAGAGA plus an additional guanine as first bp for transcription by the U6-26 promoter) using two annealed primers FH210/FH211 (Supplementary Table ) resulting in vector pFH89.

    Amplification:

    Article Title: Dynamic nanoscale morphology of the ER surveyed by STED microscopy
    Article Snippet: The annealed oligonucleotides were cloned into pSPCas9(BB)-2A-Puro (PX459) v2.0 (a gift from F. Zhang; Addgene plasmid 62988; ) that had been digested with BbsI-HF (R3539; New England BioLabs). .. The HDR template was engineered using a four-piece Gibson assembly: (1) the vector backbone was pEGFP-N1 (Takara Bio Inc.) amplified with the following oligonucleotides so that the CMV promoter, MCS, and GFP sequence had been removed: forward primer 5′-CCTCCCCCTGAACCTGAAAC-3′ and reverse primer 5′-GGCTATGAACTAATGACCCCGT-3′; (2) the left homology arm, a gBlock containing 800 bp upstream of the NUP160 stop codon with a silent mutation to the PAM sites of one candidate gRNA and a 5′-GGAGGCGGCGGCGGC-3′ linker and was flanked by 20-bp overhangs that overlapped with the pEGFP-N1 backbone and HaloTag7; (3) HaloTag7 was amplified using the following oligonucleotides (a silent mutation in aspartic acid was included in the forward primer to facilitate amplification of the gene): forward primer 5′-ATGGACCCGAAATCGGTACT-3′ and reverse primer 5′-GCCGGAAATCTCTAGCGTC-3′; and (4) the right homology arm, a gBlock containing 800 bp downstream of the NUP160 stop codon with two point mutations in the PAM sites of candidate gRNAs that was flanked by 20-bp overlap with HaloTag7 and the EGFP-N1 backbone.

    Article Title: Downregulation of KCTD12 contributes to melanoma stemness by modulating CD271
    Article Snippet: First, the PX458 plasmid (Micro Helix, Beijing, China), which contained an eGFP tag, was enzyme digested by the BbsI-HF restriction endonuclease (New England Biolabs, USA). .. Then, the constructed vector was purified, transformed into the competent DH5α Escherichia coli, and amplified under ampicillin pressure.

    Article Title: Homology-Directed Repair of a Defective Glabrous Gene in Arabidopsis With Cas9-Based Gene Targeting
    Article Snippet: After digestion of pEN-C1.1 with BbsI-HF (New England Biolabs), we inserted the target sequence (AAGAGATGTGGGAAAAGAGA plus an additional guanine as first bp for transcription by the U6-26 promoter) using two annealed primers FH210/FH211 (Supplementary Table ) resulting in vector pFH89. .. We amplified the homology template from pFH95 using primers FH278/FH279 (Supplementary Table ) and performed Gateway® BP-reaction with pDONR 207 (Invitrogen) resulting in vector pFH122.

    Synthesized:

    Article Title: ITGB5 Plays a Key Role in Escherichia coli F4ac-Induced Diarrhea in Piglets
    Article Snippet: DNA oligonucleotides corresponding to the sgRNAs were synthesized by Invitrogen (Shanghai, China). .. Annealed oligonucleotides were inserted into pX330-U6-Chimeric_BB-CBh-hSpCas9 (plasmid 42230, PX330, Addgene, a gift from Feng Zhang, Broad Institute of MIT and Harvard) containing two BbsI (R3539S, NEB, Ipswich, MA) restriction enzyme sites, using a published protocol ( ).

    Article Title: Dynamic nanoscale morphology of the ER surveyed by STED microscopy
    Article Snippet: The gRNA sequence (listed above) was synthesized as two oligonucleotides with BbsI overhangs and an additional guanidine base 5′ to the protospacer sequence, and the oligonucleotides were phosphorylated with calf alkaline intestine phosphatase (M0290; New England BioLabs) and annealed by heating to 95°C and cooling to room temperature. .. The annealed oligonucleotides were cloned into pSPCas9(BB)-2A-Puro (PX459) v2.0 (a gift from F. Zhang; Addgene plasmid 62988; ) that had been digested with BbsI-HF (R3539; New England BioLabs).

    Article Title: A fat-tissue sensor couples growth to oxygen availability by remotely controlling insulin secretion
    Article Snippet: .. The Cas9 target sequences below were synthesized as part of long oligonucleotides that were used to amplify gRNA structural sequences from pCFD6 using Q5 polymerase (New England Biolabs, #M0491S); plasmid template DNA was then removed by DpnI digestion (NEB, #R0176S). pCFD6 was linearized by BbsI digestion (NEB, #R3539S) and treated with alkaline phosphatase (NEB, #M0290S) to prevent self-ligation. .. The PCR products were recombined into the linearized, phosphatase-treated vector by Gibson assembly using the NEBuilder HiFi DNA Assembly Master Mix (NEB, #E2621S).

    Article Title: CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons
    Article Snippet: sgSTOPs were synthesized as oligonucleotide pairs (IDT) compatible with BbsI and BsmBI restriction sites. .. The reaction was conducted for 1 hr at 37°C followed by incubation for 5 min at 95°C and gradual temperature decrease from 95°C to 15°C. sgSTOP oligonucleotides were cloned into the B52 plasmid, which was digested with either BbsI-HF (NEB #R3539L) or BsmBI (NEB #R0580L) in a 20 μL reaction according to the manufacturer’s recommendations.

    Quantitative RT-PCR:

    Article Title: Repression of Transcription at DNA Breaks Requires Cohesin throughout Interphase and Prevents Genome Instability
    Article Snippet: Assay for CRISPR-Cas9-Induced TMPRSS2:ERG Translocations CRISPR guide RNA sequences against the TMPRSS2 gene (Primer pair TMPRSS2-CR-3) and the ERG gene (Primer pair ERG-CR-2) (from ) were cloned in to the Cas9-empty plasmid (pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid ( ) using BbsI-HF (NEB; R3539S) restriction enzyme to create Cas9-TMPRSS2 and Cas9-ERG plasmids. .. The media was replaced with or without 300nM DHT 24hr later and cells harvested at 72hr for analysis by QRT-PCR using TMPRSS2-ERG translocation primers, as above.

    Article Title: Repression of Transcription at DNA Breaks Requires Cohesin throughout Interphase and Prevents Genome Instability
    Article Snippet: CRISPR guide RNA sequences against the TMPRSS2 gene (Primer pair TMPRSS2-CR-3) and the ERG gene (Primer pair ERG-CR-2) (from ) were cloned in to the Cas9-empty plasmid (pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid ( ) using BbsI-HF (NEB; R3539S) restriction enzyme to create Cas9-TMPRSS2 and Cas9-ERG plasmids. .. The media was replaced with or without 300nM DHT 24hr later and cells harvested at 72hr for analysis by QRT-PCR using TMPRSS2-ERG translocation primers, as above.

    Incubation:

    Article Title: CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons
    Article Snippet: .. The reaction was conducted for 1 hr at 37°C followed by incubation for 5 min at 95°C and gradual temperature decrease from 95°C to 15°C. sgSTOP oligonucleotides were cloned into the B52 plasmid, which was digested with either BbsI-HF (NEB #R3539L) or BsmBI (NEB #R0580L) in a 20 μL reaction according to the manufacturer’s recommendations. .. 0.5 μL of recombinant shrimp alkaline phosphatase (NEB #M0371L) were then added to the digestion reaction and incubated for 1hr at 37°C to dephosphorylate the plasmid.

    Expressing:

    Article Title: ITGB5 Plays a Key Role in Escherichia coli F4ac-Induced Diarrhea in Piglets
    Article Snippet: Paragraph title: Construction of CRISPR/Cas9–sgRNA Expression Vector ... Annealed oligonucleotides were inserted into pX330-U6-Chimeric_BB-CBh-hSpCas9 (plasmid 42230, PX330, Addgene, a gift from Feng Zhang, Broad Institute of MIT and Harvard) containing two BbsI (R3539S, NEB, Ipswich, MA) restriction enzyme sites, using a published protocol ( ).

    Article Title: Homology-Directed Repair of a Defective Glabrous Gene in Arabidopsis With Cas9-Based Gene Targeting
    Article Snippet: Cloning of a Binary T-DNA Repair Vector for In Planta Gene Targeting Repair Approach We made use of the binary T-DNA vector pDE-Cas9, containing an Arabidopsis -codon-optimized Cas9 controlled by the constitutive Ubiquitin promoter (PcUBp) from Petroselinum crispum ( ) and the sgRNA subcloning vector pEN-C.1.1 containing the Arabidopsis U6-26 promoter for sgRNA expression, the sgRNA scaffold and BbsI-sites for subcloning of the protospacer sequence ( ). .. After digestion of pEN-C1.1 with BbsI-HF (New England Biolabs), we inserted the target sequence (AAGAGATGTGGGAAAAGAGA plus an additional guanine as first bp for transcription by the U6-26 promoter) using two annealed primers FH210/FH211 (Supplementary Table ) resulting in vector pFH89.

    Transformation Assay:

    Article Title: Downregulation of KCTD12 contributes to melanoma stemness by modulating CD271
    Article Snippet: First, the PX458 plasmid (Micro Helix, Beijing, China), which contained an eGFP tag, was enzyme digested by the BbsI-HF restriction endonuclease (New England Biolabs, USA). .. Then, the constructed vector was purified, transformed into the competent DH5α Escherichia coli, and amplified under ampicillin pressure.

    Translocation Assay:

    Article Title: Repression of Transcription at DNA Breaks Requires Cohesin throughout Interphase and Prevents Genome Instability
    Article Snippet: Assay for CRISPR-Cas9-Induced TMPRSS2:ERG Translocations CRISPR guide RNA sequences against the TMPRSS2 gene (Primer pair TMPRSS2-CR-3) and the ERG gene (Primer pair ERG-CR-2) (from ) were cloned in to the Cas9-empty plasmid (pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid ( ) using BbsI-HF (NEB; R3539S) restriction enzyme to create Cas9-TMPRSS2 and Cas9-ERG plasmids. .. The media was replaced with or without 300nM DHT 24hr later and cells harvested at 72hr for analysis by QRT-PCR using TMPRSS2-ERG translocation primers, as above.

    Article Title: Repression of Transcription at DNA Breaks Requires Cohesin throughout Interphase and Prevents Genome Instability
    Article Snippet: CRISPR guide RNA sequences against the TMPRSS2 gene (Primer pair TMPRSS2-CR-3) and the ERG gene (Primer pair ERG-CR-2) (from ) were cloned in to the Cas9-empty plasmid (pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid ( ) using BbsI-HF (NEB; R3539S) restriction enzyme to create Cas9-TMPRSS2 and Cas9-ERG plasmids. .. The media was replaced with or without 300nM DHT 24hr later and cells harvested at 72hr for analysis by QRT-PCR using TMPRSS2-ERG translocation primers, as above.

    Transfection:

    Article Title: Repression of Transcription at DNA Breaks Requires Cohesin throughout Interphase and Prevents Genome Instability
    Article Snippet: Assay for CRISPR-Cas9-Induced TMPRSS2:ERG Translocations CRISPR guide RNA sequences against the TMPRSS2 gene (Primer pair TMPRSS2-CR-3) and the ERG gene (Primer pair ERG-CR-2) (from ) were cloned in to the Cas9-empty plasmid (pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid ( ) using BbsI-HF (NEB; R3539S) restriction enzyme to create Cas9-TMPRSS2 and Cas9-ERG plasmids. .. LNCaP cells subjected to the 2-hit siRNA depletion in CSS-RPMI media were trypsinised on day 3, counted and 4x10ˆ5 cells transfected with either 6μg Cas9-empty plasmid or 3μg each for plasmids Cas9-TMPRSS2 and Cas9-ERG in CSS RPMI media with or without 300nM DHT.

    Article Title: Dynamic nanoscale morphology of the ER surveyed by STED microscopy
    Article Snippet: The annealed oligonucleotides were cloned into pSPCas9(BB)-2A-Puro (PX459) v2.0 (a gift from F. Zhang; Addgene plasmid 62988; ) that had been digested with BbsI-HF (R3539; New England BioLabs). .. The PX459 v2.0 vector containing the NUP160 guide and the HDR template were transfected into U2OS cells using Lipofectamine 2000 and treated with 3 µg/ml puromycin (Invitrogen) in DMEM low glucose with 10% FBS for 48 h. The cells were labeled with HaloTag TMR ligand (G8251; Promega) and sorted for the top 1% of fluorescent cells.

    Article Title: Repression of Transcription at DNA Breaks Requires Cohesin throughout Interphase and Prevents Genome Instability
    Article Snippet: CRISPR guide RNA sequences against the TMPRSS2 gene (Primer pair TMPRSS2-CR-3) and the ERG gene (Primer pair ERG-CR-2) (from ) were cloned in to the Cas9-empty plasmid (pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid ( ) using BbsI-HF (NEB; R3539S) restriction enzyme to create Cas9-TMPRSS2 and Cas9-ERG plasmids. .. LNCaP cells subjected to the 2-hit siRNA depletion in CSS-RPMI media were trypsinised on day 3, counted and 4x10ˆ5 cells transfected with either 6μg Cas9-empty plasmid or 3μg each for plasmids Cas9-TMPRSS2 and Cas9-ERG in CSS RPMI media with or without 300nM DHT.

    Ligation:

    Article Title: CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons
    Article Snippet: The reaction was conducted for 1 hr at 37°C followed by incubation for 5 min at 95°C and gradual temperature decrease from 95°C to 15°C. sgSTOP oligonucleotides were cloned into the B52 plasmid, which was digested with either BbsI-HF (NEB #R3539L) or BsmBI (NEB #R0580L) in a 20 μL reaction according to the manufacturer’s recommendations. .. The linearized plasmid was gel purified and incubated with the sgSTOP oligonucleotides for 1 hr at room temperature in the following ligation reaction: 50 ng of digested plasmid, 0.5 μL phosphorylated and annealed sgRNAs (diluted 1/100 in water), 1 μL 5X ligase buffer (Life Technologies) and 0.25 μL of T4 ligase.

    Generated:

    Article Title: Dynamic nanoscale morphology of the ER surveyed by STED microscopy
    Article Snippet: The annealed oligonucleotides were cloned into pSPCas9(BB)-2A-Puro (PX459) v2.0 (a gift from F. Zhang; Addgene plasmid 62988; ) that had been digested with BbsI-HF (R3539; New England BioLabs). .. The HDR template was generated to add a five-glycine linker and HaloTag7 sequence to the 3′ end of the NUP160 gene, fusing Halo to the C terminus of all NUP160 isoforms.

    Article Title: Dissection of central clock function in Drosophila through cell-specific CRISPR-mediated clock gene disruption
    Article Snippet: Cloning Multiple gRNAs targeting per , tim , or acp98AB were constructed as previously described ( ). gRNA sequences were selected for predicted target specificity and efficiency according to http://chopchop.cbu.uib.no/ ( ). pCFD6 (Addgene #73915) was digested with BbsI-HF (NEB #R3539S) and gel purified. .. For each construct, inserts were generated in three separate PCR reactions using pCFD6 as the template and the primers listed in .

    Article Title: A fat-tissue sensor couples growth to oxygen availability by remotely controlling insulin secretion
    Article Snippet: The Cas9 target sequences below were synthesized as part of long oligonucleotides that were used to amplify gRNA structural sequences from pCFD6 using Q5 polymerase (New England Biolabs, #M0491S); plasmid template DNA was then removed by DpnI digestion (NEB, #R0176S). pCFD6 was linearized by BbsI digestion (NEB, #R3539S) and treated with alkaline phosphatase (NEB, #M0290S) to prevent self-ligation. .. To remove fatiga or sima function in the fat body, two CRISPR-driver stocks—ppl-GAL4; UAS-Cas9.P2/TM6B, Tb and Cg-GAL4; UAS-Cas9.P2/TM6B, Tb —were made, and these were crossed to the UAS-gRNA lines generated above, or to w 1118 as a driver control.

    Sequencing:

    Article Title: Dynamic nanoscale morphology of the ER surveyed by STED microscopy
    Article Snippet: The gRNA sequence (listed above) was synthesized as two oligonucleotides with BbsI overhangs and an additional guanidine base 5′ to the protospacer sequence, and the oligonucleotides were phosphorylated with calf alkaline intestine phosphatase (M0290; New England BioLabs) and annealed by heating to 95°C and cooling to room temperature. .. The annealed oligonucleotides were cloned into pSPCas9(BB)-2A-Puro (PX459) v2.0 (a gift from F. Zhang; Addgene plasmid 62988; ) that had been digested with BbsI-HF (R3539; New England BioLabs).

    Article Title: Downregulation of KCTD12 contributes to melanoma stemness by modulating CD271
    Article Snippet: First, the PX458 plasmid (Micro Helix, Beijing, China), which contained an eGFP tag, was enzyme digested by the BbsI-HF restriction endonuclease (New England Biolabs, USA). .. Before the vector was extracted from Escherichia coli using an endotoxin-free plasmid extraction kit (Solarbio, China), it was sent for sequencing (Sangon, Shanghai, China).

    Article Title: A Drosophila CRISPR/Cas9 Toolkit for Conditionally Manipulating Gene Expression in the Prothoracic Gland as a Test Case for Polytene Tissues
    Article Snippet: .. The pCFD5 and PG-gRNA plasmids were pre-digested with BbsI (NEB R3539S) and fused to appropriate gRNA-containing PCR fragments via the Gibson reaction, followed by Sanger sequencing. .. For PG2-gRNA, which only has a single BbsI cutting site, we used PG1 as a template to extend the scaffold for multiple gRNA sequences in the PG2 vector.

    Article Title: A fat-tissue sensor couples growth to oxygen availability by remotely controlling insulin secretion
    Article Snippet: The Cas9 target sequences below were synthesized as part of long oligonucleotides that were used to amplify gRNA structural sequences from pCFD6 using Q5 polymerase (New England Biolabs, #M0491S); plasmid template DNA was then removed by DpnI digestion (NEB, #R0176S). pCFD6 was linearized by BbsI digestion (NEB, #R3539S) and treated with alkaline phosphatase (NEB, #M0290S) to prevent self-ligation. .. Clones were analyzed by PCR and sequence confirmed. pCFD6-UAS-Hph KO and pCFD6-UAS-sima KO were integrated into landing site attP2 (third chromosome) in-house and by BestGene (Chino Hills, CA) using standard methods.

    Article Title: CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons
    Article Snippet: The oligonucleotide sequences were designed as follows: 5′-ACACCG(N)20G-3′ and 5′-AAAAC(N)20CG-3′ for BsmBI restriction sites; 5′-CACCG(N)20-3′ and 5′AAAC(N)20C-3′ for BbsI restriction sites, where “(N)20” corresponds to each sgRNA sequence. .. The reaction was conducted for 1 hr at 37°C followed by incubation for 5 min at 95°C and gradual temperature decrease from 95°C to 15°C. sgSTOP oligonucleotides were cloned into the B52 plasmid, which was digested with either BbsI-HF (NEB #R3539L) or BsmBI (NEB #R0580L) in a 20 μL reaction according to the manufacturer’s recommendations.

    Article Title: Homology-Directed Repair of a Defective Glabrous Gene in Arabidopsis With Cas9-Based Gene Targeting
    Article Snippet: .. After digestion of pEN-C1.1 with BbsI-HF (New England Biolabs), we inserted the target sequence (AAGAGATGTGGGAAAAGAGA plus an additional guanine as first bp for transcription by the U6-26 promoter) using two annealed primers FH210/FH211 (Supplementary Table ) resulting in vector pFH89. .. We then digested pFH89 with MluI-HF (New England Biolabs) to extract the sgRNA cassette and ligated it into MluI-HF-digested pDE-Cas9, thereby creating the vector pFH99.

    Article Title: Stearyl polyethylenimine complexed with plasmids as the core of human serum albumin nanoparticles noncovalently bound to CRISPR/Cas9 plasmids or siRNA for disrupting or silencing PD-L1 expression for immunotherapy
    Article Snippet: Paragraph title: Design of the PD-L1 knockout sequence of sgRNA ... Vector construction Digestion of the plasmid The plasmid (1 μg) was digested in a total volume of a 50 μL solution composed of 1 μL BbsI-HF restriction enzyme, 5 μL NEBuffer™ (×10), and 43 μL nuclease-free water for 1 hour at 37°C.

    Injection:

    Article Title: A Drosophila CRISPR/Cas9 Toolkit for Conditionally Manipulating Gene Expression in the Prothoracic Gland as a Test Case for Polytene Tissues
    Article Snippet: Optimal target sites were then confirmed by sequencing the loci from genomic DNA extracted from corresponding fly lines we used for plasmid injection. .. The pCFD5 and PG-gRNA plasmids were pre-digested with BbsI (NEB R3539S) and fused to appropriate gRNA-containing PCR fragments via the Gibson reaction, followed by Sanger sequencing.

    Recombinant:

    Article Title: CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons
    Article Snippet: The reaction was conducted for 1 hr at 37°C followed by incubation for 5 min at 95°C and gradual temperature decrease from 95°C to 15°C. sgSTOP oligonucleotides were cloned into the B52 plasmid, which was digested with either BbsI-HF (NEB #R3539L) or BsmBI (NEB #R0580L) in a 20 μL reaction according to the manufacturer’s recommendations. .. 0.5 μL of recombinant shrimp alkaline phosphatase (NEB #M0371L) were then added to the digestion reaction and incubated for 1hr at 37°C to dephosphorylate the plasmid.

    Mutagenesis:

    Article Title: Dynamic nanoscale morphology of the ER surveyed by STED microscopy
    Article Snippet: The annealed oligonucleotides were cloned into pSPCas9(BB)-2A-Puro (PX459) v2.0 (a gift from F. Zhang; Addgene plasmid 62988; ) that had been digested with BbsI-HF (R3539; New England BioLabs). .. The HDR template was engineered using a four-piece Gibson assembly: (1) the vector backbone was pEGFP-N1 (Takara Bio Inc.) amplified with the following oligonucleotides so that the CMV promoter, MCS, and GFP sequence had been removed: forward primer 5′-CCTCCCCCTGAACCTGAAAC-3′ and reverse primer 5′-GGCTATGAACTAATGACCCCGT-3′; (2) the left homology arm, a gBlock containing 800 bp upstream of the NUP160 stop codon with a silent mutation to the PAM sites of one candidate gRNA and a 5′-GGAGGCGGCGGCGGC-3′ linker and was flanked by 20-bp overhangs that overlapped with the pEGFP-N1 backbone and HaloTag7; (3) HaloTag7 was amplified using the following oligonucleotides (a silent mutation in aspartic acid was included in the forward primer to facilitate amplification of the gene): forward primer 5′-ATGGACCCGAAATCGGTACT-3′ and reverse primer 5′-GCCGGAAATCTCTAGCGTC-3′; and (4) the right homology arm, a gBlock containing 800 bp downstream of the NUP160 stop codon with two point mutations in the PAM sites of candidate gRNAs that was flanked by 20-bp overlap with HaloTag7 and the EGFP-N1 backbone.

    Article Title: Downregulation of KCTD12 contributes to melanoma stemness by modulating CD271
    Article Snippet: Paragraph title: Targeted CRISPR/Cas9 KCTD12-KO mutant A375 cell line ... First, the PX458 plasmid (Micro Helix, Beijing, China), which contained an eGFP tag, was enzyme digested by the BbsI-HF restriction endonuclease (New England Biolabs, USA).

    Subcloning:

    Article Title: Homology-Directed Repair of a Defective Glabrous Gene in Arabidopsis With Cas9-Based Gene Targeting
    Article Snippet: Cloning of a Binary T-DNA Repair Vector for In Planta Gene Targeting Repair Approach We made use of the binary T-DNA vector pDE-Cas9, containing an Arabidopsis -codon-optimized Cas9 controlled by the constitutive Ubiquitin promoter (PcUBp) from Petroselinum crispum ( ) and the sgRNA subcloning vector pEN-C.1.1 containing the Arabidopsis U6-26 promoter for sgRNA expression, the sgRNA scaffold and BbsI-sites for subcloning of the protospacer sequence ( ). .. After digestion of pEN-C1.1 with BbsI-HF (New England Biolabs), we inserted the target sequence (AAGAGATGTGGGAAAAGAGA plus an additional guanine as first bp for transcription by the U6-26 promoter) using two annealed primers FH210/FH211 (Supplementary Table ) resulting in vector pFH89.

    Labeling:

    Article Title: Dynamic nanoscale morphology of the ER surveyed by STED microscopy
    Article Snippet: The annealed oligonucleotides were cloned into pSPCas9(BB)-2A-Puro (PX459) v2.0 (a gift from F. Zhang; Addgene plasmid 62988; ) that had been digested with BbsI-HF (R3539; New England BioLabs). .. The PX459 v2.0 vector containing the NUP160 guide and the HDR template were transfected into U2OS cells using Lipofectamine 2000 and treated with 3 µg/ml puromycin (Invitrogen) in DMEM low glucose with 10% FBS for 48 h. The cells were labeled with HaloTag TMR ligand (G8251; Promega) and sorted for the top 1% of fluorescent cells.

    Purification:

    Article Title: Dissection of central clock function in Drosophila through cell-specific CRISPR-mediated clock gene disruption
    Article Snippet: .. Cloning Multiple gRNAs targeting per , tim , or acp98AB were constructed as previously described ( ). gRNA sequences were selected for predicted target specificity and efficiency according to http://chopchop.cbu.uib.no/ ( ). pCFD6 (Addgene #73915) was digested with BbsI-HF (NEB #R3539S) and gel purified. .. For each construct, inserts were generated in three separate PCR reactions using pCFD6 as the template and the primers listed in .

    Article Title: Downregulation of KCTD12 contributes to melanoma stemness by modulating CD271
    Article Snippet: First, the PX458 plasmid (Micro Helix, Beijing, China), which contained an eGFP tag, was enzyme digested by the BbsI-HF restriction endonuclease (New England Biolabs, USA). .. Then, the constructed vector was purified, transformed into the competent DH5α Escherichia coli, and amplified under ampicillin pressure.

    Article Title: CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons
    Article Snippet: The reaction was conducted for 1 hr at 37°C followed by incubation for 5 min at 95°C and gradual temperature decrease from 95°C to 15°C. sgSTOP oligonucleotides were cloned into the B52 plasmid, which was digested with either BbsI-HF (NEB #R3539L) or BsmBI (NEB #R0580L) in a 20 μL reaction according to the manufacturer’s recommendations. .. The linearized plasmid was gel purified and incubated with the sgSTOP oligonucleotides for 1 hr at room temperature in the following ligation reaction: 50 ng of digested plasmid, 0.5 μL phosphorylated and annealed sgRNAs (diluted 1/100 in water), 1 μL 5X ligase buffer (Life Technologies) and 0.25 μL of T4 ligase.

    Polymerase Chain Reaction:

    Article Title: Dissection of central clock function in Drosophila through cell-specific CRISPR-mediated clock gene disruption
    Article Snippet: Cloning Multiple gRNAs targeting per , tim , or acp98AB were constructed as previously described ( ). gRNA sequences were selected for predicted target specificity and efficiency according to http://chopchop.cbu.uib.no/ ( ). pCFD6 (Addgene #73915) was digested with BbsI-HF (NEB #R3539S) and gel purified. .. For each construct, inserts were generated in three separate PCR reactions using pCFD6 as the template and the primers listed in .

    Article Title: A Drosophila CRISPR/Cas9 Toolkit for Conditionally Manipulating Gene Expression in the Prothoracic Gland as a Test Case for Polytene Tissues
    Article Snippet: .. The pCFD5 and PG-gRNA plasmids were pre-digested with BbsI (NEB R3539S) and fused to appropriate gRNA-containing PCR fragments via the Gibson reaction, followed by Sanger sequencing. .. For PG2-gRNA, which only has a single BbsI cutting site, we used PG1 as a template to extend the scaffold for multiple gRNA sequences in the PG2 vector.

    Article Title: A fat-tissue sensor couples growth to oxygen availability by remotely controlling insulin secretion
    Article Snippet: The Cas9 target sequences below were synthesized as part of long oligonucleotides that were used to amplify gRNA structural sequences from pCFD6 using Q5 polymerase (New England Biolabs, #M0491S); plasmid template DNA was then removed by DpnI digestion (NEB, #R0176S). pCFD6 was linearized by BbsI digestion (NEB, #R3539S) and treated with alkaline phosphatase (NEB, #M0290S) to prevent self-ligation. .. The PCR products were recombined into the linearized, phosphatase-treated vector by Gibson assembly using the NEBuilder HiFi DNA Assembly Master Mix (NEB, #E2621S).

    Construct:

    Article Title: Dissection of central clock function in Drosophila through cell-specific CRISPR-mediated clock gene disruption
    Article Snippet: .. Cloning Multiple gRNAs targeting per , tim , or acp98AB were constructed as previously described ( ). gRNA sequences were selected for predicted target specificity and efficiency according to http://chopchop.cbu.uib.no/ ( ). pCFD6 (Addgene #73915) was digested with BbsI-HF (NEB #R3539S) and gel purified. .. For each construct, inserts were generated in three separate PCR reactions using pCFD6 as the template and the primers listed in .

    Article Title: Downregulation of KCTD12 contributes to melanoma stemness by modulating CD271
    Article Snippet: First, the PX458 plasmid (Micro Helix, Beijing, China), which contained an eGFP tag, was enzyme digested by the BbsI-HF restriction endonuclease (New England Biolabs, USA). .. Then, the constructed vector was purified, transformed into the competent DH5α Escherichia coli, and amplified under ampicillin pressure.

    CRISPR:

    Article Title: Repression of Transcription at DNA Breaks Requires Cohesin throughout Interphase and Prevents Genome Instability
    Article Snippet: .. Assay for CRISPR-Cas9-Induced TMPRSS2:ERG Translocations CRISPR guide RNA sequences against the TMPRSS2 gene (Primer pair TMPRSS2-CR-3) and the ERG gene (Primer pair ERG-CR-2) (from ) were cloned in to the Cas9-empty plasmid (pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid ( ) using BbsI-HF (NEB; R3539S) restriction enzyme to create Cas9-TMPRSS2 and Cas9-ERG plasmids. .. LNCaP cells subjected to the 2-hit siRNA depletion in CSS-RPMI media were trypsinised on day 3, counted and 4x10ˆ5 cells transfected with either 6μg Cas9-empty plasmid or 3μg each for plasmids Cas9-TMPRSS2 and Cas9-ERG in CSS RPMI media with or without 300nM DHT.

    Article Title: ITGB5 Plays a Key Role in Escherichia coli F4ac-Induced Diarrhea in Piglets
    Article Snippet: Paragraph title: Construction of CRISPR/Cas9–sgRNA Expression Vector ... Annealed oligonucleotides were inserted into pX330-U6-Chimeric_BB-CBh-hSpCas9 (plasmid 42230, PX330, Addgene, a gift from Feng Zhang, Broad Institute of MIT and Harvard) containing two BbsI (R3539S, NEB, Ipswich, MA) restriction enzyme sites, using a published protocol ( ).

    Article Title: Repression of Transcription at DNA Breaks Requires Cohesin throughout Interphase and Prevents Genome Instability
    Article Snippet: .. CRISPR guide RNA sequences against the TMPRSS2 gene (Primer pair TMPRSS2-CR-3) and the ERG gene (Primer pair ERG-CR-2) (from ) were cloned in to the Cas9-empty plasmid (pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid ( ) using BbsI-HF (NEB; R3539S) restriction enzyme to create Cas9-TMPRSS2 and Cas9-ERG plasmids. .. LNCaP cells subjected to the 2-hit siRNA depletion in CSS-RPMI media were trypsinised on day 3, counted and 4x10ˆ5 cells transfected with either 6μg Cas9-empty plasmid or 3μg each for plasmids Cas9-TMPRSS2 and Cas9-ERG in CSS RPMI media with or without 300nM DHT.

    Article Title: Downregulation of KCTD12 contributes to melanoma stemness by modulating CD271
    Article Snippet: Paragraph title: Targeted CRISPR/Cas9 KCTD12-KO mutant A375 cell line ... First, the PX458 plasmid (Micro Helix, Beijing, China), which contained an eGFP tag, was enzyme digested by the BbsI-HF restriction endonuclease (New England Biolabs, USA).

    Article Title: A Drosophila CRISPR/Cas9 Toolkit for Conditionally Manipulating Gene Expression in the Prothoracic Gland as a Test Case for Polytene Tissues
    Article Snippet: gRNA selection and cloning Target gene sequences were obtained from FlyBase and analyzed for optimal target gRNA sites by selecting sequences that showed consensus between two programs, namely “CRISPR optimal target finder” ( http://tools.flycrispr.molbio.wisc.edu/targetFinder/ ) and “Harvard CRISPR gRNA design tool” ( http://www.flyrnai.org/crispr/ ). .. The pCFD5 and PG-gRNA plasmids were pre-digested with BbsI (NEB R3539S) and fused to appropriate gRNA-containing PCR fragments via the Gibson reaction, followed by Sanger sequencing.

    Article Title: A fat-tissue sensor couples growth to oxygen availability by remotely controlling insulin secretion
    Article Snippet: Paragraph title: Generation of tissue-specific CRISPR lines ... The Cas9 target sequences below were synthesized as part of long oligonucleotides that were used to amplify gRNA structural sequences from pCFD6 using Q5 polymerase (New England Biolabs, #M0491S); plasmid template DNA was then removed by DpnI digestion (NEB, #R0176S). pCFD6 was linearized by BbsI digestion (NEB, #R3539S) and treated with alkaline phosphatase (NEB, #M0290S) to prevent self-ligation.

    Plasmid Preparation:

    Article Title: Repression of Transcription at DNA Breaks Requires Cohesin throughout Interphase and Prevents Genome Instability
    Article Snippet: .. Assay for CRISPR-Cas9-Induced TMPRSS2:ERG Translocations CRISPR guide RNA sequences against the TMPRSS2 gene (Primer pair TMPRSS2-CR-3) and the ERG gene (Primer pair ERG-CR-2) (from ) were cloned in to the Cas9-empty plasmid (pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid ( ) using BbsI-HF (NEB; R3539S) restriction enzyme to create Cas9-TMPRSS2 and Cas9-ERG plasmids. .. LNCaP cells subjected to the 2-hit siRNA depletion in CSS-RPMI media were trypsinised on day 3, counted and 4x10ˆ5 cells transfected with either 6μg Cas9-empty plasmid or 3μg each for plasmids Cas9-TMPRSS2 and Cas9-ERG in CSS RPMI media with or without 300nM DHT.

    Article Title: ITGB5 Plays a Key Role in Escherichia coli F4ac-Induced Diarrhea in Piglets
    Article Snippet: .. Annealed oligonucleotides were inserted into pX330-U6-Chimeric_BB-CBh-hSpCas9 (plasmid 42230, PX330, Addgene, a gift from Feng Zhang, Broad Institute of MIT and Harvard) containing two BbsI (R3539S, NEB, Ipswich, MA) restriction enzyme sites, using a published protocol ( ). .. The sgRNA with higher efficiency was used for single clone selection.

    Article Title: Dynamic nanoscale morphology of the ER surveyed by STED microscopy
    Article Snippet: .. The annealed oligonucleotides were cloned into pSPCas9(BB)-2A-Puro (PX459) v2.0 (a gift from F. Zhang; Addgene plasmid 62988; ) that had been digested with BbsI-HF (R3539; New England BioLabs). .. The HDR template was generated to add a five-glycine linker and HaloTag7 sequence to the 3′ end of the NUP160 gene, fusing Halo to the C terminus of all NUP160 isoforms.

    Article Title: Repression of Transcription at DNA Breaks Requires Cohesin throughout Interphase and Prevents Genome Instability
    Article Snippet: .. CRISPR guide RNA sequences against the TMPRSS2 gene (Primer pair TMPRSS2-CR-3) and the ERG gene (Primer pair ERG-CR-2) (from ) were cloned in to the Cas9-empty plasmid (pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid ( ) using BbsI-HF (NEB; R3539S) restriction enzyme to create Cas9-TMPRSS2 and Cas9-ERG plasmids. .. LNCaP cells subjected to the 2-hit siRNA depletion in CSS-RPMI media were trypsinised on day 3, counted and 4x10ˆ5 cells transfected with either 6μg Cas9-empty plasmid or 3μg each for plasmids Cas9-TMPRSS2 and Cas9-ERG in CSS RPMI media with or without 300nM DHT.

    Article Title: Downregulation of KCTD12 contributes to melanoma stemness by modulating CD271
    Article Snippet: .. First, the PX458 plasmid (Micro Helix, Beijing, China), which contained an eGFP tag, was enzyme digested by the BbsI-HF restriction endonuclease (New England Biolabs, USA). .. Second, the annealed double strand sgRNA was connected to the open-loop PX458 plasmid.

    Article Title: A Drosophila CRISPR/Cas9 Toolkit for Conditionally Manipulating Gene Expression in the Prothoracic Gland as a Test Case for Polytene Tissues
    Article Snippet: Optimal target sites were then confirmed by sequencing the loci from genomic DNA extracted from corresponding fly lines we used for plasmid injection. .. The pCFD5 and PG-gRNA plasmids were pre-digested with BbsI (NEB R3539S) and fused to appropriate gRNA-containing PCR fragments via the Gibson reaction, followed by Sanger sequencing.

    Article Title: A fat-tissue sensor couples growth to oxygen availability by remotely controlling insulin secretion
    Article Snippet: .. The Cas9 target sequences below were synthesized as part of long oligonucleotides that were used to amplify gRNA structural sequences from pCFD6 using Q5 polymerase (New England Biolabs, #M0491S); plasmid template DNA was then removed by DpnI digestion (NEB, #R0176S). pCFD6 was linearized by BbsI digestion (NEB, #R3539S) and treated with alkaline phosphatase (NEB, #M0290S) to prevent self-ligation. .. The PCR products were recombined into the linearized, phosphatase-treated vector by Gibson assembly using the NEBuilder HiFi DNA Assembly Master Mix (NEB, #E2621S).

    Article Title: Stearyl polyethylenimine complexed with plasmids as the core of human serum albumin nanoparticles noncovalently bound to CRISPR/Cas9 plasmids or siRNA for disrupting or silencing PD-L1 expression for immunotherapy
    Article Snippet: BbsI-HF® and T4 DNA ligase were purchased from New England Biolabs (Ipswich, MA, USA). .. The Plasmid DNA Mini Kit and Gel/PCR DNA Purification Mini Kit were purchased from Novelgene (Taipei, Taiwan).

    Article Title: CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons
    Article Snippet: .. The reaction was conducted for 1 hr at 37°C followed by incubation for 5 min at 95°C and gradual temperature decrease from 95°C to 15°C. sgSTOP oligonucleotides were cloned into the B52 plasmid, which was digested with either BbsI-HF (NEB #R3539L) or BsmBI (NEB #R0580L) in a 20 μL reaction according to the manufacturer’s recommendations. .. 0.5 μL of recombinant shrimp alkaline phosphatase (NEB #M0371L) were then added to the digestion reaction and incubated for 1hr at 37°C to dephosphorylate the plasmid.

    Article Title: Homology-Directed Repair of a Defective Glabrous Gene in Arabidopsis With Cas9-Based Gene Targeting
    Article Snippet: .. After digestion of pEN-C1.1 with BbsI-HF (New England Biolabs), we inserted the target sequence (AAGAGATGTGGGAAAAGAGA plus an additional guanine as first bp for transcription by the U6-26 promoter) using two annealed primers FH210/FH211 (Supplementary Table ) resulting in vector pFH89. .. We then digested pFH89 with MluI-HF (New England Biolabs) to extract the sgRNA cassette and ligated it into MluI-HF-digested pDE-Cas9, thereby creating the vector pFH99.

    Article Title: Stearyl polyethylenimine complexed with plasmids as the core of human serum albumin nanoparticles noncovalently bound to CRISPR/Cas9 plasmids or siRNA for disrupting or silencing PD-L1 expression for immunotherapy
    Article Snippet: .. Vector construction Digestion of the plasmid The plasmid (1 μg) was digested in a total volume of a 50 μL solution composed of 1 μL BbsI-HF restriction enzyme, 5 μL NEBuffer™ (×10), and 43 μL nuclease-free water for 1 hour at 37°C. ..

    Selection:

    Article Title: ITGB5 Plays a Key Role in Escherichia coli F4ac-Induced Diarrhea in Piglets
    Article Snippet: Annealed oligonucleotides were inserted into pX330-U6-Chimeric_BB-CBh-hSpCas9 (plasmid 42230, PX330, Addgene, a gift from Feng Zhang, Broad Institute of MIT and Harvard) containing two BbsI (R3539S, NEB, Ipswich, MA) restriction enzyme sites, using a published protocol ( ). .. The sgRNA with higher efficiency was used for single clone selection.

    Article Title: A Drosophila CRISPR/Cas9 Toolkit for Conditionally Manipulating Gene Expression in the Prothoracic Gland as a Test Case for Polytene Tissues
    Article Snippet: Paragraph title: gRNA selection and cloning ... The pCFD5 and PG-gRNA plasmids were pre-digested with BbsI (NEB R3539S) and fused to appropriate gRNA-containing PCR fragments via the Gibson reaction, followed by Sanger sequencing.

    Knock-Out:

    Article Title: Stearyl polyethylenimine complexed with plasmids as the core of human serum albumin nanoparticles noncovalently bound to CRISPR/Cas9 plasmids or siRNA for disrupting or silencing PD-L1 expression for immunotherapy
    Article Snippet: Paragraph title: Design of the PD-L1 knockout sequence of sgRNA ... Vector construction Digestion of the plasmid The plasmid (1 μg) was digested in a total volume of a 50 μL solution composed of 1 μL BbsI-HF restriction enzyme, 5 μL NEBuffer™ (×10), and 43 μL nuclease-free water for 1 hour at 37°C.

    Concentration Assay:

    Article Title: CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons
    Article Snippet: Oligonucleotide pairs were resuspended in TE (100 μM final concentration) and annealed in the following reaction buffer: 6.5 μL water, 2 μL 5X T4 ligase buffer (Life Technologies), 0.5 μL T4 PNK (NEB #M0201L) and 0.5 μL of each oligonucleotide (100 μM; IDT). .. The reaction was conducted for 1 hr at 37°C followed by incubation for 5 min at 95°C and gradual temperature decrease from 95°C to 15°C. sgSTOP oligonucleotides were cloned into the B52 plasmid, which was digested with either BbsI-HF (NEB #R3539L) or BsmBI (NEB #R0580L) in a 20 μL reaction according to the manufacturer’s recommendations.

    DNA Purification:

    Article Title: Stearyl polyethylenimine complexed with plasmids as the core of human serum albumin nanoparticles noncovalently bound to CRISPR/Cas9 plasmids or siRNA for disrupting or silencing PD-L1 expression for immunotherapy
    Article Snippet: BbsI-HF® and T4 DNA ligase were purchased from New England Biolabs (Ipswich, MA, USA). .. The Plasmid DNA Mini Kit and Gel/PCR DNA Purification Mini Kit were purchased from Novelgene (Taipei, Taiwan).

    Gel Extraction:

    Article Title: Stearyl polyethylenimine complexed with plasmids as the core of human serum albumin nanoparticles noncovalently bound to CRISPR/Cas9 plasmids or siRNA for disrupting or silencing PD-L1 expression for immunotherapy
    Article Snippet: Vector construction Digestion of the plasmid The plasmid (1 μg) was digested in a total volume of a 50 μL solution composed of 1 μL BbsI-HF restriction enzyme, 5 μL NEBuffer™ (×10), and 43 μL nuclease-free water for 1 hour at 37°C. .. The digested plasmid in the gel was purified with a gel extraction kit and stored at −20°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs bbsi hf
    Bbsi Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bbsi hf/product/New England Biolabs
    Average 95 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    bbsi hf - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results