eagi hf  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    EagI HF
    Description:
    EagI HF 2 500 units
    Catalog Number:
    r3505l
    Price:
    264
    Size:
    2 500 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs eagi hf
    EagI HF
    EagI HF 2 500 units
    https://www.bioz.com/result/eagi hf/product/New England Biolabs
    Average 90 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    eagi hf - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: From the oligonucleotide pool generated by OLS, we generated edit-directing plasmid pools via a ligation-mediated cloning scheme described below (graphically summarized in ). .. Reactions were stopped during linear amplification, and the amplified library was then purified with the QIAquick PCR purification kit (Qiagen, Hilden, Germany), digested with BstEII-HF and EagI-HF (New England Biolab, Ipswich, MA), and purified again.

    Article Title: PHASTpep: Analysis Software for Discovery of Cell-Selective Peptides via Phage Display and Next-Generation Sequencing
    Article Snippet: Paragraph title: Cloning into phage vector ... The M13KE vector (NEB) was digested with ACC651 and EagI-HF (NEB) followed by CIP.

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: The amplified library was cloned into pLK88, a version of pLK78 modified to include the BstEII and SphI sites. pLK88 was isolated with a QIAGEN Plasmid Plus Maxiprep kit (Qiagen, Hilden, Germany) from 200 milliliters of Escherichia coli culture. .. 20 micrograms of plasmid was then digested by BstEII-HF and EagI-HF, treated with Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA), and purified with the Qiagen PCR purification kit.

    Article Title: Development of Aspirin-Inducible Biosensors in Escherichia coli and SimCells
    Article Snippet: The ampicillin resistance gene was isolated by PCR from the plasmid pGEM-T (Promega, UK) by using an In-Fusion cloning kit (CloneTech, UK) and the primers PAR_AmpR For and Rev ( ). .. The targeting PAR plasmid was linearized and digested with EagI-HF (New England BioLabs), which disrupted the Kan ORF.

    Amplification:

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: .. Reactions were stopped during linear amplification, and the amplified library was then purified with the QIAquick PCR purification kit (Qiagen, Hilden, Germany), digested with BstEII-HF and EagI-HF (New England Biolab, Ipswich, MA), and purified again. .. The amplified library was cloned into pLK88, a version of pLK78 modified to include the BstEII and SphI sites. pLK88 was isolated with a QIAGEN Plasmid Plus Maxiprep kit (Qiagen, Hilden, Germany) from 200 milliliters of Escherichia coli culture.

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: The amplified library was cloned into pLK88, a version of pLK78 modified to include the BstEII and SphI sites. pLK88 was isolated with a QIAGEN Plasmid Plus Maxiprep kit (Qiagen, Hilden, Germany) from 200 milliliters of Escherichia coli culture. .. 20 micrograms of plasmid was then digested by BstEII-HF and EagI-HF, treated with Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA), and purified with the Qiagen PCR purification kit.

    Article Title: Lack of Parkin Anticipates the Phenotype and Affects Mitochondrial Morphology and mtDNA Levels in a Mouse Model of Parkinson's Disease
    Article Snippet: Two micrograms of total DNA was digested with EagI HF (NEB), separated on 0.7% agarose gel, and transferred to a Zeta-probe GT Membrane (Bio-Rad). .. Probes to detect mtDNA were amplified from genomic DNA isolated from striata of a C57BL/6J wild-type mouse with Q5 Hot Start High-Fidelity DNA Polymerase (NEB).

    Article Title: The Variable Region of Pneumococcal Pathogenicity Island 1 Is Responsible for Unusually High Virulence of a Serotype 1 Isolate
    Article Snippet: .. The amplified flanking products and erm cassette subsequently underwent restriction digestion using EagI-HF and XhoI-HF (NEB), followed by ligation. .. D39 was transformed with the resultant ligation product as described above.

    Synthesized:

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: Generation of barcoded edit-directing plasmid pools The single-stranded oligonucleotides were synthesized by the Oligo Library Synthesis (OLS) platform (Agilent Technologies, Santa Clara, CA) in either the Watson or Crick orientation in order to minimize each oligonucleotide’s frequency of adenine bases. .. Reactions were stopped during linear amplification, and the amplified library was then purified with the QIAquick PCR purification kit (Qiagen, Hilden, Germany), digested with BstEII-HF and EagI-HF (New England Biolab, Ipswich, MA), and purified again.

    Article Title: PHASTpep: Analysis Software for Discovery of Cell-Selective Peptides via Phage Display and Next-Generation Sequencing
    Article Snippet: Oligos corresponding to the following sequences were chemically synthesized (Euorfins, Luxembourg) and ligated: (coding) [PHOS]GTACCTTTCTATTCTCACTCT(XXX)7 GGTGGAGGTTC , and (non-coding) [PHOS]GGCCGAACCTCCACC(XXX)7 AGAGTGAGAATAGAAAG , where (XXX)7 represents the DNA sequence of the desired peptide. .. The M13KE vector (NEB) was digested with ACC651 and EagI-HF (NEB) followed by CIP.

    Lambda DNA Preparation:

    Article Title: Real-Time Selective Sequencing with RUBRIC: Read Until with Basecall and Reference-Informed Criteria
    Article Snippet: .. Lambda DNA Experiments To provide a test case for RUBRIC selection, lambda-phage DNA (cat # N3011S, New England Biolabs (NEB), Ipswich, MA) was digested using the EagI enzyme (NEB, cat # R3505S) to produce three large DNA fragments of roughly similar size (20 kb, 17 kb, and 12 kb). .. Digestion was performed per NEB protocol in a 50 μL reaction, and the product was purified using phenol:chlororform.

    Construct:

    Article Title: Development of Aspirin-Inducible Biosensors in Escherichia coli and SimCells
    Article Snippet: Due to the selection marker on E. coli MC1000 ΔminD ::km , a plasmid of PAR (Psal-gfp-salR) with alternative ampicillin resistance (PAR_Amp *) was needed and was constructed as follows. .. The targeting PAR plasmid was linearized and digested with EagI-HF (New England BioLabs), which disrupted the Kan ORF.

    Article Title: The Variable Region of Pneumococcal Pathogenicity Island 1 Is Responsible for Unusually High Virulence of a Serotype 1 Isolate
    Article Snippet: The construct used to make the 4496ΔΦ mutant was generated by PCR amplification of flanking products from strain 4496 template DNA using primers 1 to 4 and the erm cassette as described above but using primers J293a and J215b ( ). .. The amplified flanking products and erm cassette subsequently underwent restriction digestion using EagI-HF and XhoI-HF (NEB), followed by ligation.

    Real-time Polymerase Chain Reaction:

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: Oligonucleotides were amplified on an AriaMx real-time PCR system (Agilent Technologies, Santa Clara, CA), using the KAPA Library Amplification kit (Kapa Biosystems, Wilmington, MA). .. Reactions were stopped during linear amplification, and the amplified library was then purified with the QIAquick PCR purification kit (Qiagen, Hilden, Germany), digested with BstEII-HF and EagI-HF (New England Biolab, Ipswich, MA), and purified again.

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: Oligonucleotides were amplified on an AriaMx real-time PCR system (Agilent Technologies, Santa Clara, CA), using the KAPA Library Amplification kit (Kapa Biosystems, Wilmington, MA). .. 20 micrograms of plasmid was then digested by BstEII-HF and EagI-HF, treated with Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA), and purified with the Qiagen PCR purification kit.

    Cell Culture:

    Article Title: Development of Aspirin-Inducible Biosensors in Escherichia coli and SimCells
    Article Snippet: The targeting PAR plasmid was linearized and digested with EagI-HF (New England BioLabs), which disrupted the Kan ORF. .. A single colony from each plate was cultured at 37°C with continuous shaking at 200 rpm overnight in 5 ml LB broth supplemented with 100 µg/ml ampicillin (LB amp).

    Modification:

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: Reactions were stopped during linear amplification, and the amplified library was then purified with the QIAquick PCR purification kit (Qiagen, Hilden, Germany), digested with BstEII-HF and EagI-HF (New England Biolab, Ipswich, MA), and purified again. .. The amplified library was cloned into pLK88, a version of pLK78 modified to include the BstEII and SphI sites. pLK88 was isolated with a QIAGEN Plasmid Plus Maxiprep kit (Qiagen, Hilden, Germany) from 200 milliliters of Escherichia coli culture.

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: The amplified library was cloned into pLK88, a version of pLK78 modified to include the BstEII and SphI sites. pLK88 was isolated with a QIAGEN Plasmid Plus Maxiprep kit (Qiagen, Hilden, Germany) from 200 milliliters of Escherichia coli culture. .. 20 micrograms of plasmid was then digested by BstEII-HF and EagI-HF, treated with Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA), and purified with the Qiagen PCR purification kit.

    Transformation Assay:

    Article Title: The Variable Region of Pneumococcal Pathogenicity Island 1 Is Responsible for Unusually High Virulence of a Serotype 1 Isolate
    Article Snippet: D39 was transformed with the product of overlap extension PCR, as previously described ( , ), and selected on erythromycin-containing blood agar plates. .. The amplified flanking products and erm cassette subsequently underwent restriction digestion using EagI-HF and XhoI-HF (NEB), followed by ligation.

    Flow Cytometry:

    Article Title: Real-Time Selective Sequencing with RUBRIC: Read Until with Basecall and Reference-Informed Criteria
    Article Snippet: Lambda DNA Experiments To provide a test case for RUBRIC selection, lambda-phage DNA (cat # N3011S, New England Biolabs (NEB), Ipswich, MA) was digested using the EagI enzyme (NEB, cat # R3505S) to produce three large DNA fragments of roughly similar size (20 kb, 17 kb, and 12 kb). .. For all lambda DNA experiments (A1-E2 in Table ), digested samples were prepared using ONT’s 1D ligation kit (SQK-LSK108) and loaded into SpotON flow cells (FLO-MIN107, used for all experiments in this article) using methods described in the kit’s accompanying protocol.

    Southern Blot:

    Article Title: Lack of Parkin Anticipates the Phenotype and Affects Mitochondrial Morphology and mtDNA Levels in a Mouse Model of Parkinson's Disease
    Article Snippet: Paragraph title: Southern blotting. ... Two micrograms of total DNA was digested with EagI HF (NEB), separated on 0.7% agarose gel, and transferred to a Zeta-probe GT Membrane (Bio-Rad).

    Ligation:

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: From the oligonucleotide pool generated by OLS, we generated edit-directing plasmid pools via a ligation-mediated cloning scheme described below (graphically summarized in ). .. Reactions were stopped during linear amplification, and the amplified library was then purified with the QIAquick PCR purification kit (Qiagen, Hilden, Germany), digested with BstEII-HF and EagI-HF (New England Biolab, Ipswich, MA), and purified again.

    Article Title: PHASTpep: Analysis Software for Discovery of Cell-Selective Peptides via Phage Display and Next-Generation Sequencing
    Article Snippet: The M13KE vector (NEB) was digested with ACC651 and EagI-HF (NEB) followed by CIP. .. One reaction mix was prepared without insert as a ligation control.

    Article Title: Real-Time Selective Sequencing with RUBRIC: Read Until with Basecall and Reference-Informed Criteria
    Article Snippet: Lambda DNA Experiments To provide a test case for RUBRIC selection, lambda-phage DNA (cat # N3011S, New England Biolabs (NEB), Ipswich, MA) was digested using the EagI enzyme (NEB, cat # R3505S) to produce three large DNA fragments of roughly similar size (20 kb, 17 kb, and 12 kb). .. For all lambda DNA experiments (A1-E2 in Table ), digested samples were prepared using ONT’s 1D ligation kit (SQK-LSK108) and loaded into SpotON flow cells (FLO-MIN107, used for all experiments in this article) using methods described in the kit’s accompanying protocol.

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: From the oligonucleotide pool generated by OLS, we generated edit-directing plasmid pools via a ligation-mediated cloning scheme described below (graphically summarized in ). .. 20 micrograms of plasmid was then digested by BstEII-HF and EagI-HF, treated with Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA), and purified with the Qiagen PCR purification kit.

    Article Title: The Variable Region of Pneumococcal Pathogenicity Island 1 Is Responsible for Unusually High Virulence of a Serotype 1 Isolate
    Article Snippet: .. The amplified flanking products and erm cassette subsequently underwent restriction digestion using EagI-HF and XhoI-HF (NEB), followed by ligation. .. D39 was transformed with the resultant ligation product as described above.

    Introduce:

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: The amplification primers were designed to introduce an EagI cut site into the 3’ end of the amplification product ( , primers named OLS Library Amplification F and R). .. Reactions were stopped during linear amplification, and the amplified library was then purified with the QIAquick PCR purification kit (Qiagen, Hilden, Germany), digested with BstEII-HF and EagI-HF (New England Biolab, Ipswich, MA), and purified again.

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: The amplification primers were designed to introduce an EagI cut site into the 3’ end of the amplification product ( , primers named OLS Library Amplification F and R). .. 20 micrograms of plasmid was then digested by BstEII-HF and EagI-HF, treated with Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA), and purified with the Qiagen PCR purification kit.

    Generated:

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: From the oligonucleotide pool generated by OLS, we generated edit-directing plasmid pools via a ligation-mediated cloning scheme described below (graphically summarized in ). .. Reactions were stopped during linear amplification, and the amplified library was then purified with the QIAquick PCR purification kit (Qiagen, Hilden, Germany), digested with BstEII-HF and EagI-HF (New England Biolab, Ipswich, MA), and purified again.

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: From the oligonucleotide pool generated by OLS, we generated edit-directing plasmid pools via a ligation-mediated cloning scheme described below (graphically summarized in ). .. 20 micrograms of plasmid was then digested by BstEII-HF and EagI-HF, treated with Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA), and purified with the Qiagen PCR purification kit.

    Article Title: The Variable Region of Pneumococcal Pathogenicity Island 1 Is Responsible for Unusually High Virulence of a Serotype 1 Isolate
    Article Snippet: The construct used to make the 4496ΔΦ mutant was generated by PCR amplification of flanking products from strain 4496 template DNA using primers 1 to 4 and the erm cassette as described above but using primers J293a and J215b ( ). .. The amplified flanking products and erm cassette subsequently underwent restriction digestion using EagI-HF and XhoI-HF (NEB), followed by ligation.

    Sequencing:

    Article Title: PHASTpep: Analysis Software for Discovery of Cell-Selective Peptides via Phage Display and Next-Generation Sequencing
    Article Snippet: Oligos corresponding to the following sequences were chemically synthesized (Euorfins, Luxembourg) and ligated: (coding) [PHOS]GTACCTTTCTATTCTCACTCT(XXX)7 GGTGGAGGTTC , and (non-coding) [PHOS]GGCCGAACCTCCACC(XXX)7 AGAGTGAGAATAGAAAG , where (XXX)7 represents the DNA sequence of the desired peptide. .. The M13KE vector (NEB) was digested with ACC651 and EagI-HF (NEB) followed by CIP.

    Article Title: Real-Time Selective Sequencing with RUBRIC: Read Until with Basecall and Reference-Informed Criteria
    Article Snippet: Lambda DNA Experiments To provide a test case for RUBRIC selection, lambda-phage DNA (cat # N3011S, New England Biolabs (NEB), Ipswich, MA) was digested using the EagI enzyme (NEB, cat # R3505S) to produce three large DNA fragments of roughly similar size (20 kb, 17 kb, and 12 kb). .. The 17 kb fragment was chosen as the target for RUBRIC selection, while reads not matching its sequence were skipped.

    Mutagenesis:

    Article Title: The Variable Region of Pneumococcal Pathogenicity Island 1 Is Responsible for Unusually High Virulence of a Serotype 1 Isolate
    Article Snippet: The construct used to make the 4496ΔΦ mutant was generated by PCR amplification of flanking products from strain 4496 template DNA using primers 1 to 4 and the erm cassette as described above but using primers J293a and J215b ( ). .. The amplified flanking products and erm cassette subsequently underwent restriction digestion using EagI-HF and XhoI-HF (NEB), followed by ligation.

    Isolation:

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: Reactions were stopped during linear amplification, and the amplified library was then purified with the QIAquick PCR purification kit (Qiagen, Hilden, Germany), digested with BstEII-HF and EagI-HF (New England Biolab, Ipswich, MA), and purified again. .. The amplified library was cloned into pLK88, a version of pLK78 modified to include the BstEII and SphI sites. pLK88 was isolated with a QIAGEN Plasmid Plus Maxiprep kit (Qiagen, Hilden, Germany) from 200 milliliters of Escherichia coli culture.

    Article Title: Development of Aspirin-Inducible Biosensors in Escherichia coli and SimCells
    Article Snippet: The ampicillin resistance gene was isolated by PCR from the plasmid pGEM-T (Promega, UK) by using an In-Fusion cloning kit (CloneTech, UK) and the primers PAR_AmpR For and Rev ( ). .. The targeting PAR plasmid was linearized and digested with EagI-HF (New England BioLabs), which disrupted the Kan ORF.

    Article Title: Lack of Parkin Anticipates the Phenotype and Affects Mitochondrial Morphology and mtDNA Levels in a Mouse Model of Parkinson's Disease
    Article Snippet: Two micrograms of total DNA was digested with EagI HF (NEB), separated on 0.7% agarose gel, and transferred to a Zeta-probe GT Membrane (Bio-Rad). .. Probes to detect mtDNA were amplified from genomic DNA isolated from striata of a C57BL/6J wild-type mouse with Q5 Hot Start High-Fidelity DNA Polymerase (NEB).

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: The amplified library was cloned into pLK88, a version of pLK78 modified to include the BstEII and SphI sites. pLK88 was isolated with a QIAGEN Plasmid Plus Maxiprep kit (Qiagen, Hilden, Germany) from 200 milliliters of Escherichia coli culture. .. 20 micrograms of plasmid was then digested by BstEII-HF and EagI-HF, treated with Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA), and purified with the Qiagen PCR purification kit.

    Purification:

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: .. Reactions were stopped during linear amplification, and the amplified library was then purified with the QIAquick PCR purification kit (Qiagen, Hilden, Germany), digested with BstEII-HF and EagI-HF (New England Biolab, Ipswich, MA), and purified again. .. The amplified library was cloned into pLK88, a version of pLK78 modified to include the BstEII and SphI sites. pLK88 was isolated with a QIAGEN Plasmid Plus Maxiprep kit (Qiagen, Hilden, Germany) from 200 milliliters of Escherichia coli culture.

    Article Title: PHASTpep: Analysis Software for Discovery of Cell-Selective Peptides via Phage Display and Next-Generation Sequencing
    Article Snippet: The M13KE vector (NEB) was digested with ACC651 and EagI-HF (NEB) followed by CIP. .. Vector was purified using the Qiaquick kit (Qiagen) according to manufacturer’s instructions with a final elution into 40 uL of EB.

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: .. 20 micrograms of plasmid was then digested by BstEII-HF and EagI-HF, treated with Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA), and purified with the Qiagen PCR purification kit. .. We tested two ligation reactions: 1 microgram of digested vector was ligated with either 100 nanograms or 800 nanograms of the digested insert, with 4 microliters of T4 DNA Ligase M0202M (New England Biolabs, Ipswich, MA), in an 800 or 200 microliter reaction, respectively, at room temperature for 10 minutes.

    Article Title: Development of Aspirin-Inducible Biosensors in Escherichia coli and SimCells
    Article Snippet: Paragraph title: Culture and purification of SimCells. ... The targeting PAR plasmid was linearized and digested with EagI-HF (New England BioLabs), which disrupted the Kan ORF.

    Article Title: Real-Time Selective Sequencing with RUBRIC: Read Until with Basecall and Reference-Informed Criteria
    Article Snippet: Lambda DNA Experiments To provide a test case for RUBRIC selection, lambda-phage DNA (cat # N3011S, New England Biolabs (NEB), Ipswich, MA) was digested using the EagI enzyme (NEB, cat # R3505S) to produce three large DNA fragments of roughly similar size (20 kb, 17 kb, and 12 kb). .. Digestion was performed per NEB protocol in a 50 μL reaction, and the product was purified using phenol:chlororform.

    Article Title: Targeted mutagenesis in a human-parasitic nematode
    Article Snippet: PCR cleanup on wild-type and unc iL3 pools was performed using the QIAquick PCR purification kit (Qiagen, Cat. # 28104). .. For each sample, ~1 μg of template DNA was digested with EagI-HF (NEB, Cat. # R3505S) at 37°C for 1 h. Digested products were resolved on ~1% agarose gels stained with GelRed using 1-kb and 100-bp markers.

    Polymerase Chain Reaction:

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: .. Reactions were stopped during linear amplification, and the amplified library was then purified with the QIAquick PCR purification kit (Qiagen, Hilden, Germany), digested with BstEII-HF and EagI-HF (New England Biolab, Ipswich, MA), and purified again. .. The amplified library was cloned into pLK88, a version of pLK78 modified to include the BstEII and SphI sites. pLK88 was isolated with a QIAGEN Plasmid Plus Maxiprep kit (Qiagen, Hilden, Germany) from 200 milliliters of Escherichia coli culture.

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: .. 20 micrograms of plasmid was then digested by BstEII-HF and EagI-HF, treated with Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA), and purified with the Qiagen PCR purification kit. .. We tested two ligation reactions: 1 microgram of digested vector was ligated with either 100 nanograms or 800 nanograms of the digested insert, with 4 microliters of T4 DNA Ligase M0202M (New England Biolabs, Ipswich, MA), in an 800 or 200 microliter reaction, respectively, at room temperature for 10 minutes.

    Article Title: Development of Aspirin-Inducible Biosensors in Escherichia coli and SimCells
    Article Snippet: The resulting sticky-end PCR product contained an overhanging EagI site and was thereby ligated in a linearized PAR plasmid. .. The targeting PAR plasmid was linearized and digested with EagI-HF (New England BioLabs), which disrupted the Kan ORF.

    Article Title: Targeted mutagenesis in a human-parasitic nematode
    Article Snippet: PCR cleanup on wild-type and unc iL3 pools was performed using the QIAquick PCR purification kit (Qiagen, Cat. # 28104). .. For each sample, ~1 μg of template DNA was digested with EagI-HF (NEB, Cat. # R3505S) at 37°C for 1 h. Digested products were resolved on ~1% agarose gels stained with GelRed using 1-kb and 100-bp markers.

    Article Title: The Variable Region of Pneumococcal Pathogenicity Island 1 Is Responsible for Unusually High Virulence of a Serotype 1 Isolate
    Article Snippet: The construct used to make the 4496ΔΦ mutant was generated by PCR amplification of flanking products from strain 4496 template DNA using primers 1 to 4 and the erm cassette as described above but using primers J293a and J215b ( ). .. The amplified flanking products and erm cassette subsequently underwent restriction digestion using EagI-HF and XhoI-HF (NEB), followed by ligation.

    Plasmid Preparation:

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: Paragraph title: Generation of barcoded edit-directing plasmid pools ... Reactions were stopped during linear amplification, and the amplified library was then purified with the QIAquick PCR purification kit (Qiagen, Hilden, Germany), digested with BstEII-HF and EagI-HF (New England Biolab, Ipswich, MA), and purified again.

    Article Title: PHASTpep: Analysis Software for Discovery of Cell-Selective Peptides via Phage Display and Next-Generation Sequencing
    Article Snippet: .. The M13KE vector (NEB) was digested with ACC651 and EagI-HF (NEB) followed by CIP. .. Vector was purified using the Qiaquick kit (Qiagen) according to manufacturer’s instructions with a final elution into 40 uL of EB.

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: .. 20 micrograms of plasmid was then digested by BstEII-HF and EagI-HF, treated with Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA), and purified with the Qiagen PCR purification kit. .. We tested two ligation reactions: 1 microgram of digested vector was ligated with either 100 nanograms or 800 nanograms of the digested insert, with 4 microliters of T4 DNA Ligase M0202M (New England Biolabs, Ipswich, MA), in an 800 or 200 microliter reaction, respectively, at room temperature for 10 minutes.

    Article Title: Development of Aspirin-Inducible Biosensors in Escherichia coli and SimCells
    Article Snippet: .. The targeting PAR plasmid was linearized and digested with EagI-HF (New England BioLabs), which disrupted the Kan ORF. ..

    Negative Control:

    Article Title: Highly parallel genome variant engineering with CRISPR/Cas9
    Article Snippet: 20 micrograms of plasmid was then digested by BstEII-HF and EagI-HF, treated with Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA), and purified with the Qiagen PCR purification kit. .. Concurrently, we ran negative control ligations lacking the insert DNA.

    Selection:

    Article Title: Development of Aspirin-Inducible Biosensors in Escherichia coli and SimCells
    Article Snippet: Due to the selection marker on E. coli MC1000 ΔminD ::km , a plasmid of PAR (Psal-gfp-salR) with alternative ampicillin resistance (PAR_Amp *) was needed and was constructed as follows. .. The targeting PAR plasmid was linearized and digested with EagI-HF (New England BioLabs), which disrupted the Kan ORF.

    Article Title: Real-Time Selective Sequencing with RUBRIC: Read Until with Basecall and Reference-Informed Criteria
    Article Snippet: .. Lambda DNA Experiments To provide a test case for RUBRIC selection, lambda-phage DNA (cat # N3011S, New England Biolabs (NEB), Ipswich, MA) was digested using the EagI enzyme (NEB, cat # R3505S) to produce three large DNA fragments of roughly similar size (20 kb, 17 kb, and 12 kb). .. Digestion was performed per NEB protocol in a 50 μL reaction, and the product was purified using phenol:chlororform.

    Article Title: The Variable Region of Pneumococcal Pathogenicity Island 1 Is Responsible for Unusually High Virulence of a Serotype 1 Isolate
    Article Snippet: The amplified flanking products and erm cassette subsequently underwent restriction digestion using EagI-HF and XhoI-HF (NEB), followed by ligation. .. After selection on BA plus 2 μg/ml erythromycin, genomic DNA was extracted from one of the transformants and used as the donor in a second round of transformation of strain 4496.

    Agarose Gel Electrophoresis:

    Article Title: Lack of Parkin Anticipates the Phenotype and Affects Mitochondrial Morphology and mtDNA Levels in a Mouse Model of Parkinson's Disease
    Article Snippet: .. Two micrograms of total DNA was digested with EagI HF (NEB), separated on 0.7% agarose gel, and transferred to a Zeta-probe GT Membrane (Bio-Rad). .. Probes to detect mtDNA were amplified from genomic DNA isolated from striata of a C57BL/6J wild-type mouse with Q5 Hot Start High-Fidelity DNA Polymerase (NEB).

    Marker:

    Article Title: Development of Aspirin-Inducible Biosensors in Escherichia coli and SimCells
    Article Snippet: Due to the selection marker on E. coli MC1000 ΔminD ::km , a plasmid of PAR (Psal-gfp-salR) with alternative ampicillin resistance (PAR_Amp *) was needed and was constructed as follows. .. The targeting PAR plasmid was linearized and digested with EagI-HF (New England BioLabs), which disrupted the Kan ORF.

    Staining:

    Article Title: Targeted mutagenesis in a human-parasitic nematode
    Article Snippet: .. For each sample, ~1 μg of template DNA was digested with EagI-HF (NEB, Cat. # R3505S) at 37°C for 1 h. Digested products were resolved on ~1% agarose gels stained with GelRed using 1-kb and 100-bp markers. .. Illumina sequencing of S . stercoralis Genomic DNA from populations of wild-type iL3s or Ss-unc-22- targeted F1 iL3s were collected as described above.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs eagi hf
    Eagi Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/eagi hf/product/New England Biolabs
    Average 90 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    eagi hf - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results