bsabi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    BsaBI
    Description:
    BsaBI 10 000 units
    Catalog Number:
    r0537l
    Price:
    282
    Size:
    10 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs bsabi
    BsaBI
    BsaBI 10 000 units
    https://www.bioz.com/result/bsabi/product/New England Biolabs
    Average 99 stars, based on 507 article reviews
    Price from $9.99 to $1999.99
    bsabi - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Initiation Factor eIF2-independent Mode of c-Src mRNA Translation Occurs via an Internal Ribosome Entry Site *
    Article Snippet: The plasmid 5′PV-FLuc contains wild type, full-length poliovirus (PV, Mahoney strain) 5′NCR (nt 1–742) cloned in-frame with FLuc ORF followed by the poly(A) tail. .. The mutant plasmid 5′PV(Δ286–605)-FLuc was constructed by restriction enzyme digestion of the 5′PV-FLuc plasmid with BlpI and BsaBI followed by filling with T4 DNA polymerase and religation with Quick T4 DNA ligase (New England Biolabs).

    Article Title: Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism
    Article Snippet: BsaBI (NEB #R0537) and SphI-HF (NEB #R3182) were used to digest both the pTIP-shR6 vector (to excise the shR6 insert) and the double-stranded shRNA DNA cassette insert followed by ligation with T4 DNA ligase. .. The poly-N represents the two 21 bp sequences that transcribe for the sense ( N ) and antisense ( n ) shRNA. miR-30 based shRNAs were generated by The Gene Editing and Screening Core, at Memorial Sloan Kettering, NY, by converting the 21mers expressed in the pLKO and pTIP vectors into 22mers followed by cloning into the Dox-inducible LT3REPIR vector as described ( ).

    Article Title: IS1301 Fingerprint Analysis of Neisseria meningitidis Strains Belonging to the ET-15 Clone ▿
    Article Snippet: Paragraph title: Cloning and inverse PCR. ... DNA fragments of the ET-15 strain DE9246 hybridizing to the IS 1301 probe were obtained through isolation from agarose gel after digestion with the restriction endonucleases HincII, BstUI, BsaBI, or MspAI1a (New England Biolabs) using a QIAquick gel extraction kit (QIAGEN).

    Amplification:

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: The pSicor-mCherry-T2A-Pro-TRIMCypA vector used in the CsA washout assay was constructed with a modified pSicor-mCherry-T2A backbone (Addgene no. 31845), and proline-TRIMCypA was PCR amplified from a pLHA-TRIMCypA-SN vector ( ) and inserted into the pSicor vector downstream of T2A by using the XmaI and EcoRI restriction enzymes (New England Biolabs). .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs).

    Article Title: Multiplex PCR Detection of Waterborne Intestinal Protozoa: Microsporidia, Cyclospora, and Cryptosporidium
    Article Snippet: Amplified DNA was analyzed by electrophoresis in a 2% (w/v) agarose gel stained with ethidium bromide (0.5 µg/ml) and visualized under ImageQuant300 (GE Healthcare, Giles, UK). .. An aliquot (5 µl) of the second-round PCR product of E. intestinalsis or C. parvum was used for enzyme digestion with BsaBI or BsiEI (New England BioLabs, Massachusetts, USA) at 60℃ for 2 hr.

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: The pSicor-mCherry-T2A-Pro-TRIMCypA vector used in the CsA washout assay was constructed with a modified pSicor-mCherry-T2A backbone (Addgene no. 31845), and proline-TRIMCypA was PCR amplified from a pLHA-TRIMCypA-SN vector ( ) and inserted into the pSicor vector downstream of T2A by using the XmaI and EcoRI restriction enzymes (New England Biolabs). .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs).

    Article Title: Polymorphisms in gene encoding TRPV1-receptor involved in pain perception are unrelated to chronic pancreatitis
    Article Snippet: Amplification was performed in a 25 μl mixture containing 200 ng of genomic DNA 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100, 0.25 mM dNTPs, 0.20 μM each primer, 2.5 U Taq polymerase, and 1.5 mM MgCl2 , except the mixture of rs224534 which contained a concentration of 2.0 mM MgCl2 . .. SNP rs222747 (c.945C > G) was detected using BsaBI (New England Biolabs, Ipswich, USA) digestion of the PCR products resulting in the following fragments: C/C, 269 + 162 bp; C/G, 431 + 269 + 162 bp; G/G, 431 bp.

    Mass Spectrometry:

    Article Title: Polymorphisms in gene encoding TRPV1-receptor involved in pain perception are unrelated to chronic pancreatitis
    Article Snippet: SNP rs222747 (c.945C > G) was detected using BsaBI (New England Biolabs, Ipswich, USA) digestion of the PCR products resulting in the following fragments: C/C, 269 + 162 bp; C/G, 431 + 269 + 162 bp; G/G, 431 bp. .. All digested products were subjected to electrophoresis on a 3.5% pronarose MS-8 gel (Hispanagar, Burgos, Spain) and detected by ethidium bromide.

    Synthesized:

    Article Title: Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism
    Article Snippet: The pLNCX2-CD95R6MUT vector was synthesized by replacing a 403 bp fragment of the CD95 ORF insert from the pLNCX2-CD95-WT vector ( ) with a corresponding 403 bp fragment that had eight silent mutation substitutions at the shR6 site (5’- GTGTCGCTGTAAACCAAACTT - > 5’- ATGTCGCTGCAAGCCCAATTT -3’) using BstXI (NEB #R0113) and BamHI (NEB #R3136) restriction enzymes (mutant insert was synthesized in a pIDTblue vector with 5’ end BstXI site and 3’ end BamHI RE site). .. BsaBI (NEB #R0537) and SphI-HF (NEB #R3182) were used to digest both the pTIP-shR6 vector (to excise the shR6 insert) and the double-stranded shRNA DNA cassette insert followed by ligation with T4 DNA ligase.

    Construct:

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs). .. QuikChange mutagenesis was used to make mutations in the pDEST-RTp51-syn-V5-6×His vector, the pFC32K-RTp66 NanoBRET vector, or the pGCHIV-1NL4 .3 shuttle vector (contains a partial HIV-1 sequence) with Phusion polymerase (New England Biolabs) and complementary primers with the required nucleotide changes.

    Article Title: Initiation Factor eIF2-independent Mode of c-Src mRNA Translation Occurs via an Internal Ribosome Entry Site *
    Article Snippet: .. The mutant plasmid 5′PV(Δ286–605)-FLuc was constructed by restriction enzyme digestion of the 5′PV-FLuc plasmid with BlpI and BsaBI followed by filling with T4 DNA polymerase and religation with Quick T4 DNA ligase (New England Biolabs). .. The resulting plasmid contains a deletion of 319 bp (nt 286–605) in the PV 5′NCR.

    Article Title: Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism
    Article Snippet: Paragraph title: Plasmids and constructs ... BsaBI (NEB #R0537) and SphI-HF (NEB #R3182) were used to digest both the pTIP-shR6 vector (to excise the shR6 insert) and the double-stranded shRNA DNA cassette insert followed by ligation with T4 DNA ligase.

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs). ..

    Electrophoresis:

    Article Title: Multiplex PCR Detection of Waterborne Intestinal Protozoa: Microsporidia, Cyclospora, and Cryptosporidium
    Article Snippet: Amplified DNA was analyzed by electrophoresis in a 2% (w/v) agarose gel stained with ethidium bromide (0.5 µg/ml) and visualized under ImageQuant300 (GE Healthcare, Giles, UK). .. An aliquot (5 µl) of the second-round PCR product of E. intestinalsis or C. parvum was used for enzyme digestion with BsaBI or BsiEI (New England BioLabs, Massachusetts, USA) at 60℃ for 2 hr.

    Article Title: Polymorphisms in gene encoding TRPV1-receptor involved in pain perception are unrelated to chronic pancreatitis
    Article Snippet: SNP rs222747 (c.945C > G) was detected using BsaBI (New England Biolabs, Ipswich, USA) digestion of the PCR products resulting in the following fragments: C/C, 269 + 162 bp; C/G, 431 + 269 + 162 bp; G/G, 431 bp. .. All digested products were subjected to electrophoresis on a 3.5% pronarose MS-8 gel (Hispanagar, Burgos, Spain) and detected by ethidium bromide.

    Incubation:

    Article Title: Optimization of a genotyping screening based on hydrolysis probes to detect the main mutations related to Leber hereditary optic neuropathy (LHON)
    Article Snippet: .. The reactions using the endonucleases Sfa NI, Bsa BI and Bsa HI were incubated for 2 h at 37 °C, 60 °C and 37 °C, respectively, followed by the enzyme inactivation at 80 °C for 20 min (New England Biolabs, Ipswich, MA). .. The results were analyzed on a 3% UltraPure™ Agarose 1000 gel and stained with ethidium bromide immersion [ , ].

    Luciferase:

    Article Title: Initiation Factor eIF2-independent Mode of c-Src mRNA Translation Occurs via an Internal Ribosome Entry Site *
    Article Snippet: A Dual-Luciferase plasmid construct (p5′Src-RFLuc) was engineered, which contains the Renilla luciferase (RLuc) gene and stop codon upstream of the c-Src 5′NCR in the original plasmid p5′Src-FLuc. .. The mutant plasmid 5′PV(Δ286–605)-FLuc was constructed by restriction enzyme digestion of the 5′PV-FLuc plasmid with BlpI and BsaBI followed by filling with T4 DNA polymerase and religation with Quick T4 DNA ligase (New England Biolabs).

    Article Title: Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism
    Article Snippet: BsaBI (NEB #R0537) and SphI-HF (NEB #R3182) were used to digest both the pTIP-shR6 vector (to excise the shR6 insert) and the double-stranded shRNA DNA cassette insert followed by ligation with T4 DNA ligase. .. A vector expressing an shRNA against Renilla luciferase was used as control ( ).

    Expressing:

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: For NanoBRET (Promega), the pFC32K-RTp66-NanoLuc expression vector was used to express RTp66 with a NanoLuc fusion at the C terminus, and a pFN21-HaloTag-eEF1A vector was used to express eEF1A with a HaloTag fusion at the N terminus. .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs).

    Article Title: Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism
    Article Snippet: Dox-inducible vectors expressing shRNAs were constructed by subcloning an annealed double-stranded DNA insert containing the sequence encoding the shRNA hairpin (sense strand: 5’- TGGCTTTATATATCTCCCTATCAGTGATAGAGATCGNNNNNNNNNNNNNNNNNNNNNCTCGAGnnnnnnnnnnnnnnnnnnnnnTTTTTGTACCGAGCTCGGATCCACTAGTCCAGTGTGGGCATGCTGCGTTGACATTGATT -3’ ) into the pTIP-shR6 vector ( ). .. BsaBI (NEB #R0537) and SphI-HF (NEB #R3182) were used to digest both the pTIP-shR6 vector (to excise the shR6 insert) and the double-stranded shRNA DNA cassette insert followed by ligation with T4 DNA ligase.

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: For NanoBRET (Promega), the pFC32K-RTp66-NanoLuc expression vector was used to express RTp66 with a NanoLuc fusion at the C terminus, and a pFN21-HaloTag-eEF1A vector was used to express eEF1A with a HaloTag fusion at the N terminus. .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs).

    Modification:

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: The pSicor-mCherry-T2A-Pro-TRIMCypA vector used in the CsA washout assay was constructed with a modified pSicor-mCherry-T2A backbone (Addgene no. 31845), and proline-TRIMCypA was PCR amplified from a pLHA-TRIMCypA-SN vector ( ) and inserted into the pSicor vector downstream of T2A by using the XmaI and EcoRI restriction enzymes (New England Biolabs). .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs).

    Article Title: Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism
    Article Snippet: The Venus-CD95L ORF and Venus-CD95 ORF (full length) sensor vectors were created by sub-cloning the Venus-CD95L or the Venus-CD95 inserts (synthesized as a minigene by IDT with flanking XbaI RE site on the 5’ end and EcoRI RE site at the 3’ end in the pIDTblue vector), which are composed of the Venus ORF followed by either the CD95L ORF (accession number ) or the CD95 ORF (accession number ) as an artificial 3’UTR (both lacking the A in the start codon), respectively, into the modified CD510B vector ( ) using XbaI and EcoRI. .. BsaBI (NEB #R0537) and SphI-HF (NEB #R3182) were used to digest both the pTIP-shR6 vector (to excise the shR6 insert) and the double-stranded shRNA DNA cassette insert followed by ligation with T4 DNA ligase.

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: The pSicor-mCherry-T2A-Pro-TRIMCypA vector used in the CsA washout assay was constructed with a modified pSicor-mCherry-T2A backbone (Addgene no. 31845), and proline-TRIMCypA was PCR amplified from a pLHA-TRIMCypA-SN vector ( ) and inserted into the pSicor vector downstream of T2A by using the XmaI and EcoRI restriction enzymes (New England Biolabs). .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs).

    Derivative Assay:

    Article Title: Initiation Factor eIF2-independent Mode of c-Src mRNA Translation Occurs via an Internal Ribosome Entry Site *
    Article Snippet: The mutant plasmids p5′SrcΔ1-FLuc, p5′SrcΔ2-FLuc, and p5′SrcΔ3-FLuc are derived from the p5′Src-FLuc except that these plasmids have deletions of 19 (nt 216–350), 253 (nt 95–348), and 171 bases (nt 47–216) in the c-Src motif, respectively. .. The mutant plasmid 5′PV(Δ286–605)-FLuc was constructed by restriction enzyme digestion of the 5′PV-FLuc plasmid with BlpI and BsaBI followed by filling with T4 DNA polymerase and religation with Quick T4 DNA ligase (New England Biolabs).

    Inverse PCR:

    Article Title: IS1301 Fingerprint Analysis of Neisseria meningitidis Strains Belonging to the ET-15 Clone ▿
    Article Snippet: Paragraph title: Cloning and inverse PCR. ... DNA fragments of the ET-15 strain DE9246 hybridizing to the IS 1301 probe were obtained through isolation from agarose gel after digestion with the restriction endonucleases HincII, BstUI, BsaBI, or MspAI1a (New England Biolabs) using a QIAquick gel extraction kit (QIAGEN).

    Ligation:

    Article Title: Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism
    Article Snippet: .. BsaBI (NEB #R0537) and SphI-HF (NEB #R3182) were used to digest both the pTIP-shR6 vector (to excise the shR6 insert) and the double-stranded shRNA DNA cassette insert followed by ligation with T4 DNA ligase. ..

    Article Title: IS1301 Fingerprint Analysis of Neisseria meningitidis Strains Belonging to the ET-15 Clone ▿
    Article Snippet: DNA fragments of the ET-15 strain DE9246 hybridizing to the IS 1301 probe were obtained through isolation from agarose gel after digestion with the restriction endonucleases HincII, BstUI, BsaBI, or MspAI1a (New England Biolabs) using a QIAquick gel extraction kit (QIAGEN). .. Fragments were either cloned into the vector pBluescript SK+ (Stratagene, Heidelberg, Germany) or subjected to an inverse PCR as follows: ligation with T4 ligase (New England Biolabs) followed by PCR with the outbound IS 1301 primers RH1 and RH2 ( ).

    Co-Immunoprecipitation Assay:

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: For expression of HIV-1 RTp51 in cells for co-IP, a destination mammalian expression vector containing a codon-optimized RT sequence with a C-terminal V5 and 6×His tag was used as previously described ( ). .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs).

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: For expression of HIV-1 RTp51 in cells for co-IP, a destination mammalian expression vector containing a codon-optimized RT sequence with a C-terminal V5 and 6×His tag was used as previously described ( ). .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs).

    Generated:

    Article Title: Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism
    Article Snippet: BsaBI (NEB #R0537) and SphI-HF (NEB #R3182) were used to digest both the pTIP-shR6 vector (to excise the shR6 insert) and the double-stranded shRNA DNA cassette insert followed by ligation with T4 DNA ligase. .. The poly-N represents the two 21 bp sequences that transcribe for the sense ( N ) and antisense ( n ) shRNA. miR-30 based shRNAs were generated by The Gene Editing and Screening Core, at Memorial Sloan Kettering, NY, by converting the 21mers expressed in the pLKO and pTIP vectors into 22mers followed by cloning into the Dox-inducible LT3REPIR vector as described ( ).

    DNA Sequencing:

    Article Title: Initiation Factor eIF2-independent Mode of c-Src mRNA Translation Occurs via an Internal Ribosome Entry Site *
    Article Snippet: The sequence of each construct was verified by restriction enzyme digestion and the Big Dye DNA sequencing method (Applied Biosystems). .. The mutant plasmid 5′PV(Δ286–605)-FLuc was constructed by restriction enzyme digestion of the 5′PV-FLuc plasmid with BlpI and BsaBI followed by filling with T4 DNA polymerase and religation with Quick T4 DNA ligase (New England Biolabs).

    Article Title: IS1301 Fingerprint Analysis of Neisseria meningitidis Strains Belonging to the ET-15 Clone ▿
    Article Snippet: DNA fragments of the ET-15 strain DE9246 hybridizing to the IS 1301 probe were obtained through isolation from agarose gel after digestion with the restriction endonucleases HincII, BstUI, BsaBI, or MspAI1a (New England Biolabs) using a QIAquick gel extraction kit (QIAGEN). .. DNA sequencing of the regions flanking the insertion sites was performed with the primers RH1 and RH2 or JE1 (5′-CGATGCTTTACTTGGCTTGCT-3′) and JE2 (5′-CTCGCCATTGTTTGTGTTTGC-3′).

    Sequencing:

    Article Title: Optimization of a genotyping screening based on hydrolysis probes to detect the main mutations related to Leber hereditary optic neuropathy (LHON)
    Article Snippet: Paragraph title: RFLP-PCR and Sanger sequencing ... The reactions using the endonucleases Sfa NI, Bsa BI and Bsa HI were incubated for 2 h at 37 °C, 60 °C and 37 °C, respectively, followed by the enzyme inactivation at 80 °C for 20 min (New England Biolabs, Ipswich, MA).

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: For expression of HIV-1 RTp51 in cells for co-IP, a destination mammalian expression vector containing a codon-optimized RT sequence with a C-terminal V5 and 6×His tag was used as previously described ( ). .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs).

    Article Title: Initiation Factor eIF2-independent Mode of c-Src mRNA Translation Occurs via an Internal Ribosome Entry Site *
    Article Snippet: The sequence of each construct was verified by restriction enzyme digestion and the Big Dye DNA sequencing method (Applied Biosystems). .. The mutant plasmid 5′PV(Δ286–605)-FLuc was constructed by restriction enzyme digestion of the 5′PV-FLuc plasmid with BlpI and BsaBI followed by filling with T4 DNA polymerase and religation with Quick T4 DNA ligase (New England Biolabs).

    Article Title: Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism
    Article Snippet: Dox-inducible vectors expressing shRNAs were constructed by subcloning an annealed double-stranded DNA insert containing the sequence encoding the shRNA hairpin (sense strand: 5’- TGGCTTTATATATCTCCCTATCAGTGATAGAGATCGNNNNNNNNNNNNNNNNNNNNNCTCGAGnnnnnnnnnnnnnnnnnnnnnTTTTTGTACCGAGCTCGGATCCACTAGTCCAGTGTGGGCATGCTGCGTTGACATTGATT -3’ ) into the pTIP-shR6 vector ( ). .. BsaBI (NEB #R0537) and SphI-HF (NEB #R3182) were used to digest both the pTIP-shR6 vector (to excise the shR6 insert) and the double-stranded shRNA DNA cassette insert followed by ligation with T4 DNA ligase.

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: For expression of HIV-1 RTp51 in cells for co-IP, a destination mammalian expression vector containing a codon-optimized RT sequence with a C-terminal V5 and 6×His tag was used as previously described ( ). .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs).

    Article Title: Polymorphisms in gene encoding TRPV1-receptor involved in pain perception are unrelated to chronic pancreatitis
    Article Snippet: Primers flanking the SNPs were designed on the basis of publicly available nucleotide sequence of human TRPV1 (Additional file ). .. SNP rs222747 (c.945C > G) was detected using BsaBI (New England Biolabs, Ipswich, USA) digestion of the PCR products resulting in the following fragments: C/C, 269 + 162 bp; C/G, 431 + 269 + 162 bp; G/G, 431 bp.

    Mutagenesis:

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs). .. QuikChange mutagenesis was used to make mutations in the pDEST-RTp51-syn-V5-6×His vector, the pFC32K-RTp66 NanoBRET vector, or the pGCHIV-1NL4 .3 shuttle vector (contains a partial HIV-1 sequence) with Phusion polymerase (New England Biolabs) and complementary primers with the required nucleotide changes.

    Article Title: Initiation Factor eIF2-independent Mode of c-Src mRNA Translation Occurs via an Internal Ribosome Entry Site *
    Article Snippet: .. The mutant plasmid 5′PV(Δ286–605)-FLuc was constructed by restriction enzyme digestion of the 5′PV-FLuc plasmid with BlpI and BsaBI followed by filling with T4 DNA polymerase and religation with Quick T4 DNA ligase (New England Biolabs). .. The resulting plasmid contains a deletion of 319 bp (nt 286–605) in the PV 5′NCR.

    Article Title: Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism
    Article Snippet: The pLNCX2-CD95R6MUT vector was synthesized by replacing a 403 bp fragment of the CD95 ORF insert from the pLNCX2-CD95-WT vector ( ) with a corresponding 403 bp fragment that had eight silent mutation substitutions at the shR6 site (5’- GTGTCGCTGTAAACCAAACTT - > 5’- ATGTCGCTGCAAGCCCAATTT -3’) using BstXI (NEB #R0113) and BamHI (NEB #R3136) restriction enzymes (mutant insert was synthesized in a pIDTblue vector with 5’ end BstXI site and 3’ end BamHI RE site). .. BsaBI (NEB #R0537) and SphI-HF (NEB #R3182) were used to digest both the pTIP-shR6 vector (to excise the shR6 insert) and the double-stranded shRNA DNA cassette insert followed by ligation with T4 DNA ligase.

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs). ..

    Isolation:

    Article Title: IS1301 Fingerprint Analysis of Neisseria meningitidis Strains Belonging to the ET-15 Clone ▿
    Article Snippet: .. DNA fragments of the ET-15 strain DE9246 hybridizing to the IS 1301 probe were obtained through isolation from agarose gel after digestion with the restriction endonucleases HincII, BstUI, BsaBI, or MspAI1a (New England Biolabs) using a QIAquick gel extraction kit (QIAGEN). .. Fragments were either cloned into the vector pBluescript SK+ (Stratagene, Heidelberg, Germany) or subjected to an inverse PCR as follows: ligation with T4 ligase (New England Biolabs) followed by PCR with the outbound IS 1301 primers RH1 and RH2 ( ).

    Subcloning:

    Article Title: Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism
    Article Snippet: Dox-inducible vectors expressing shRNAs were constructed by subcloning an annealed double-stranded DNA insert containing the sequence encoding the shRNA hairpin (sense strand: 5’- TGGCTTTATATATCTCCCTATCAGTGATAGAGATCGNNNNNNNNNNNNNNNNNNNNNCTCGAGnnnnnnnnnnnnnnnnnnnnnTTTTTGTACCGAGCTCGGATCCACTAGTCCAGTGTGGGCATGCTGCGTTGACATTGATT -3’ ) into the pTIP-shR6 vector ( ). .. BsaBI (NEB #R0537) and SphI-HF (NEB #R3182) were used to digest both the pTIP-shR6 vector (to excise the shR6 insert) and the double-stranded shRNA DNA cassette insert followed by ligation with T4 DNA ligase.

    Size-exclusion Chromatography:

    Article Title: Multiplex PCR Detection of Waterborne Intestinal Protozoa: Microsporidia, Cyclospora, and Cryptosporidium
    Article Snippet: Both amplifications were performed using a C-1000 DNA thermal cycler (Bio-Rad, Hercules, California, USA) with initial denaturation at 94℃ for 5 min, followed by 35 cycles at 94℃ for 30 sec, 53℃ for 30 sec, and 72℃ for 90 sec and a final extension at 72℃ for 10 min. .. An aliquot (5 µl) of the second-round PCR product of E. intestinalsis or C. parvum was used for enzyme digestion with BsaBI or BsiEI (New England BioLabs, Massachusetts, USA) at 60℃ for 2 hr.

    Purification:

    Article Title: Optimization of a genotyping screening based on hydrolysis probes to detect the main mutations related to Leber hereditary optic neuropathy (LHON)
    Article Snippet: The reactions using the endonucleases Sfa NI, Bsa BI and Bsa HI were incubated for 2 h at 37 °C, 60 °C and 37 °C, respectively, followed by the enzyme inactivation at 80 °C for 20 min (New England Biolabs, Ipswich, MA). .. Sanger sequencing was performed using the same primers as in the TaqMan® OpenArrayTM Genotyping , and the fragments were purified according to the EDTA/ethanol standard protocol.

    Polymerase Chain Reaction:

    Article Title: Optimization of a genotyping screening based on hydrolysis probes to detect the main mutations related to Leber hereditary optic neuropathy (LHON)
    Article Snippet: RFLP-PCR and Sanger sequencing The three main mutations were previously screened using restriction fragment length polymorphism PCR (RFLP-PCR) [ ]. .. The reactions using the endonucleases Sfa NI, Bsa BI and Bsa HI were incubated for 2 h at 37 °C, 60 °C and 37 °C, respectively, followed by the enzyme inactivation at 80 °C for 20 min (New England Biolabs, Ipswich, MA).

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: The pSicor-mCherry-T2A-Pro-TRIMCypA vector used in the CsA washout assay was constructed with a modified pSicor-mCherry-T2A backbone (Addgene no. 31845), and proline-TRIMCypA was PCR amplified from a pLHA-TRIMCypA-SN vector ( ) and inserted into the pSicor vector downstream of T2A by using the XmaI and EcoRI restriction enzymes (New England Biolabs). .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs).

    Article Title: Multiplex PCR Detection of Waterborne Intestinal Protozoa: Microsporidia, Cyclospora, and Cryptosporidium
    Article Snippet: .. An aliquot (5 µl) of the second-round PCR product of E. intestinalsis or C. parvum was used for enzyme digestion with BsaBI or BsiEI (New England BioLabs, Massachusetts, USA) at 60℃ for 2 hr. .. DNA fragments were analyzed by electrophoresis in a 2% (w/v) agarose gel as described above.

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: The pSicor-mCherry-T2A-Pro-TRIMCypA vector used in the CsA washout assay was constructed with a modified pSicor-mCherry-T2A backbone (Addgene no. 31845), and proline-TRIMCypA was PCR amplified from a pLHA-TRIMCypA-SN vector ( ) and inserted into the pSicor vector downstream of T2A by using the XmaI and EcoRI restriction enzymes (New England Biolabs). .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs).

    Article Title: IS1301 Fingerprint Analysis of Neisseria meningitidis Strains Belonging to the ET-15 Clone ▿
    Article Snippet: DNA fragments of the ET-15 strain DE9246 hybridizing to the IS 1301 probe were obtained through isolation from agarose gel after digestion with the restriction endonucleases HincII, BstUI, BsaBI, or MspAI1a (New England Biolabs) using a QIAquick gel extraction kit (QIAGEN). .. Fragments were either cloned into the vector pBluescript SK+ (Stratagene, Heidelberg, Germany) or subjected to an inverse PCR as follows: ligation with T4 ligase (New England Biolabs) followed by PCR with the outbound IS 1301 primers RH1 and RH2 ( ).

    Article Title: Polymorphisms in gene encoding TRPV1-receptor involved in pain perception are unrelated to chronic pancreatitis
    Article Snippet: .. SNP rs222747 (c.945C > G) was detected using BsaBI (New England Biolabs, Ipswich, USA) digestion of the PCR products resulting in the following fragments: C/C, 269 + 162 bp; C/G, 431 + 269 + 162 bp; G/G, 431 bp. .. To detect SNP rs224534 (c.1406C > T) PCR products were digested with BsrI (New England Biolabs, Ipswich, USA) resulting in the following fragments: C/C, 191 + 115 + 21 bp; C/T, 191 + 136 + 115 + 21 bp; T/T, 191 + 136 bp.

    Staining:

    Article Title: Optimization of a genotyping screening based on hydrolysis probes to detect the main mutations related to Leber hereditary optic neuropathy (LHON)
    Article Snippet: The reactions using the endonucleases Sfa NI, Bsa BI and Bsa HI were incubated for 2 h at 37 °C, 60 °C and 37 °C, respectively, followed by the enzyme inactivation at 80 °C for 20 min (New England Biolabs, Ipswich, MA). .. The results were analyzed on a 3% UltraPure™ Agarose 1000 gel and stained with ethidium bromide immersion [ , ].

    Article Title: Multiplex PCR Detection of Waterborne Intestinal Protozoa: Microsporidia, Cyclospora, and Cryptosporidium
    Article Snippet: Amplified DNA was analyzed by electrophoresis in a 2% (w/v) agarose gel stained with ethidium bromide (0.5 µg/ml) and visualized under ImageQuant300 (GE Healthcare, Giles, UK). .. An aliquot (5 µl) of the second-round PCR product of E. intestinalsis or C. parvum was used for enzyme digestion with BsaBI or BsiEI (New England BioLabs, Massachusetts, USA) at 60℃ for 2 hr.

    Plasmid Preparation:

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs). .. QuikChange mutagenesis was used to make mutations in the pDEST-RTp51-syn-V5-6×His vector, the pFC32K-RTp66 NanoBRET vector, or the pGCHIV-1NL4 .3 shuttle vector (contains a partial HIV-1 sequence) with Phusion polymerase (New England Biolabs) and complementary primers with the required nucleotide changes.

    Article Title: Initiation Factor eIF2-independent Mode of c-Src mRNA Translation Occurs via an Internal Ribosome Entry Site *
    Article Snippet: .. The mutant plasmid 5′PV(Δ286–605)-FLuc was constructed by restriction enzyme digestion of the 5′PV-FLuc plasmid with BlpI and BsaBI followed by filling with T4 DNA polymerase and religation with Quick T4 DNA ligase (New England Biolabs). .. The resulting plasmid contains a deletion of 319 bp (nt 286–605) in the PV 5′NCR.

    Article Title: Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism
    Article Snippet: .. BsaBI (NEB #R0537) and SphI-HF (NEB #R3182) were used to digest both the pTIP-shR6 vector (to excise the shR6 insert) and the double-stranded shRNA DNA cassette insert followed by ligation with T4 DNA ligase. ..

    Article Title: HIV-1 Uncoating and Reverse Transcription Require eEF1A Binding to Surface-Exposed Acidic Residues of the Reverse Transcriptase Thumb Domain
    Article Snippet: .. To construct the HIV-1NL4 .3 -Δenv-eGFP proviral plasmid, eGFP was inserted into the env open reading frame of WT or mutant HIV-1NL4.3 ( ) with the BsaBI and NheI restriction enzymes (New England Biolabs). ..

    Article Title: IS1301 Fingerprint Analysis of Neisseria meningitidis Strains Belonging to the ET-15 Clone ▿
    Article Snippet: DNA fragments of the ET-15 strain DE9246 hybridizing to the IS 1301 probe were obtained through isolation from agarose gel after digestion with the restriction endonucleases HincII, BstUI, BsaBI, or MspAI1a (New England Biolabs) using a QIAquick gel extraction kit (QIAGEN). .. Fragments were either cloned into the vector pBluescript SK+ (Stratagene, Heidelberg, Germany) or subjected to an inverse PCR as follows: ligation with T4 ligase (New England Biolabs) followed by PCR with the outbound IS 1301 primers RH1 and RH2 ( ).

    Multiplex Assay:

    Article Title: Multiplex PCR Detection of Waterborne Intestinal Protozoa: Microsporidia, Cyclospora, and Cryptosporidium
    Article Snippet: The second-round multiplex PCR amplification was performed under the same conditions, except 2 µl of template DNA (product of the first-round PCR) was used in a 30-µl final volume. .. An aliquot (5 µl) of the second-round PCR product of E. intestinalsis or C. parvum was used for enzyme digestion with BsaBI or BsiEI (New England BioLabs, Massachusetts, USA) at 60℃ for 2 hr.

    shRNA:

    Article Title: Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism
    Article Snippet: .. BsaBI (NEB #R0537) and SphI-HF (NEB #R3182) were used to digest both the pTIP-shR6 vector (to excise the shR6 insert) and the double-stranded shRNA DNA cassette insert followed by ligation with T4 DNA ligase. ..

    Agarose Gel Electrophoresis:

    Article Title: Multiplex PCR Detection of Waterborne Intestinal Protozoa: Microsporidia, Cyclospora, and Cryptosporidium
    Article Snippet: Amplified DNA was analyzed by electrophoresis in a 2% (w/v) agarose gel stained with ethidium bromide (0.5 µg/ml) and visualized under ImageQuant300 (GE Healthcare, Giles, UK). .. An aliquot (5 µl) of the second-round PCR product of E. intestinalsis or C. parvum was used for enzyme digestion with BsaBI or BsiEI (New England BioLabs, Massachusetts, USA) at 60℃ for 2 hr.

    Article Title: IS1301 Fingerprint Analysis of Neisseria meningitidis Strains Belonging to the ET-15 Clone ▿
    Article Snippet: .. DNA fragments of the ET-15 strain DE9246 hybridizing to the IS 1301 probe were obtained through isolation from agarose gel after digestion with the restriction endonucleases HincII, BstUI, BsaBI, or MspAI1a (New England Biolabs) using a QIAquick gel extraction kit (QIAGEN). .. Fragments were either cloned into the vector pBluescript SK+ (Stratagene, Heidelberg, Germany) or subjected to an inverse PCR as follows: ligation with T4 ligase (New England Biolabs) followed by PCR with the outbound IS 1301 primers RH1 and RH2 ( ).

    Concentration Assay:

    Article Title: Mechanism of Bidirectional Leading-Strand Synthesis Establishment at Eukaryotic DNA Replication Origins
    Article Snippet: To determine the distribution of nascent leading-strand initiation sites, deproteinized replication products from chromatin reactions were cleaved with the restriction enzymes XbaI, NotI, SacI, PsiI, EcoRV or BsaBI (NEB) in Cut Smart buffer, for 30 minutes at 37°C. .. Digests were stopped by adding EDTA to final concentration of 50 mM, followed by deprotinization with proteinase K - SDS treatment and phenol-chloroform extraction as described above.

    Article Title: Polymorphisms in gene encoding TRPV1-receptor involved in pain perception are unrelated to chronic pancreatitis
    Article Snippet: Amplification was performed in a 25 μl mixture containing 200 ng of genomic DNA 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100, 0.25 mM dNTPs, 0.20 μM each primer, 2.5 U Taq polymerase, and 1.5 mM MgCl2 , except the mixture of rs224534 which contained a concentration of 2.0 mM MgCl2 . .. SNP rs222747 (c.945C > G) was detected using BsaBI (New England Biolabs, Ipswich, USA) digestion of the PCR products resulting in the following fragments: C/C, 269 + 162 bp; C/G, 431 + 269 + 162 bp; G/G, 431 bp.

    Article Title: Mechanism of Bidirectional Leading-Strand Synthesis Establishment at Eukaryotic DNA Replication Origins
    Article Snippet: Leading-strand initiation site mapping To determine the distribution of nascent leading-strand initiation sites, deproteinized replication products from chromatin reactions were cleaved with the restriction enzymes XbaI, NotI, SacI, PsiI, EcoRV or BsaBI (NEB) in Cut Smart buffer, for 30 minutes at 37°C. .. Digests were stopped by adding EDTA to final concentration of 50 mM, followed by deprotinization with proteinase K - SDS treatment and phenol-chloroform extraction as described above.

    Gel Extraction:

    Article Title: IS1301 Fingerprint Analysis of Neisseria meningitidis Strains Belonging to the ET-15 Clone ▿
    Article Snippet: .. DNA fragments of the ET-15 strain DE9246 hybridizing to the IS 1301 probe were obtained through isolation from agarose gel after digestion with the restriction endonucleases HincII, BstUI, BsaBI, or MspAI1a (New England Biolabs) using a QIAquick gel extraction kit (QIAGEN). .. Fragments were either cloned into the vector pBluescript SK+ (Stratagene, Heidelberg, Germany) or subjected to an inverse PCR as follows: ligation with T4 ligase (New England Biolabs) followed by PCR with the outbound IS 1301 primers RH1 and RH2 ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs sphi hf
    Sphi Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sphi hf/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    sphi hf - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results