restriction endonuclease pvuii hf  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    PvuII HF
    PvuII HF 25 000 units
    Catalog Number:
    25 000 units
    Restriction Enzymes
    Buy from Supplier

    Structured Review

    New England Biolabs restriction endonuclease pvuii hf
    PvuII HF
    PvuII HF 25 000 units endonuclease pvuii hf/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    restriction endonuclease pvuii hf - by Bioz Stars, 2020-04
    99/100 stars


    Related Articles

    Clone Assay:

    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module
    Article Snippet: After 18 h, cells were transfected using polyethylenimin (PEI) as described before ( ) with 1 µg of addressed (Z12P12Z) or unaddressed (21P21) target plasmid [target sequences cloned into the plasmid pRK5.mCherry ( ); see ], respectively, and 4 µg of ZF-PvuII G46/A83/F94 or PvuII G46/A83/F94 encoding expression plasmids [the respective genes had been cloned in the plasmid pRK5 ( )]. .. Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB).

    Article Title: Antibody neutralization of retargeted measles viruses
    Article Snippet: Paragraph title: Cloning of MV-H82.αEGFR ... TheIEGR-AAQPA-EGFR.scFv-AAA-RGSHHHHHH C-terminal linker and EGFR.scFv domain, wasadded to H82 by digesting pCG-H82 and pTN-H6-Haa-αEGFR [ ] with Pac1 and PvuII-HF (NewEngland biolabs).


    Article Title: Direct CRISPR spacer acquisition from RNA by a natural reverse-transcriptase-Cas1 fusion protein
    Article Snippet: 50 mL ethanol was added and DNA was pelleted by centrifugation (16,000 × g, 20 min, 4°C), washed twice in 80% ethanol, and resuspended in 500 μL elution buffer (10 mM Tris, pH 8.5). .. 100 μL batches were linearized with PvuII-HF (NEB) to aid denaturation during PCR.

    Article Title: A Reverse Transcriptase-Cas1 Fusion Protein Contains a Cas6 Domain Required for Both CRISPR RNA Biogenesis and RNA Spacer Acquisition
    Article Snippet: Isopropanol (950 μL) was added and the plasmid DNA was pelleted by centrifugation (16,000 × g, 20 min, 4°C), washed twice in 80% ethanol, and resuspended in 200 μL 1x NEB Cutsmart Buffer. .. Samples were treated with 50 μg/mL RNase A (Life Technologies) at 37°C for 30 min, linearized with PvuII-HF (New England Biolabs) at 37°C for 60 min (to aid denaturation during PCR), and treated with 200 μg/mL Protease K at 50°C for 30 min.


    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module
    Article Snippet: The region encompassing the PvuII-binding site on the target plasmid was amplified by PCR using 10 ng of total DNA as a template, along with 0.5 μM of each primer (#1535 5′-ATCCACGCTGTTTTGACCTC and #1536 5′- ACATGAACTGAGGGGACAGG), 200 µM dNTPs, and 1 U of Phire Hot Start DNA Polymerase (Fisher Scientific) in 1× reaction buffer for 25 cycles. .. Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB).

    Article Title: A markerless gene deletion and integration system for Thermoanaerobacter ethanolicus
    Article Snippet: Analytical methods PCR amplification and colony PCR were both performed with Phusion High-Fidelity PCR Master Mix with HF Buffer (#M0531L, NEB). .. Backbone plasmid digestion was performed with PvuII-HF (#R3151S, NEB) in CutSmart Buffer (#B7204S, NEB) at 50 °C for 15 min. Gel purification was performed on 1 % agarose gel with 0.01 % (v/v) SYBR Safe DNA Gel Stain florescent indicator (#S33102, Thermo Fisher Scientific) and recovered using Zymoclean Gel DNA Recovery Kit (#D4002, Zymo Research).

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting
    Article Snippet: The region of 517 bp surrounding the PvuII site was amplified by PCR using 50 ng of total DNA as template, along with 0.2 µM of each primer (5’-gtatcgtccattccgacagcatc and 5’- ctcgccgaaaatgacccagag ), 200 mM dNTPs, and 1 U of Phusion high fidelity DNA polymerase for 30 cycles. .. PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs).

    Article Title: A Comprehensive Assessment of the Genetic Determinants in Salmonella Typhimurium for Resistance to Hydrogen Peroxide Using Proteogenomics
    Article Snippet: .. To remove the Tn5-junction sequences originated from the plasmid in the Tn-seq amplicon libraries, genomic DNA was digested with PvuII-HF (New England Biolabs), which digests immediately outside the inverted repeats on both sides of Tn5 in pBAM1, and purified with DNA Clean & Concentrator-5 kit (Zymo Reaerch). .. Then, a linear PCR extension was performed using a Tn5-specific primer in order to produce single stranded DNA corresponding to Tn5-junction sequences.


    Article Title: A Reverse Transcriptase-Cas1 Fusion Protein Contains a Cas6 Domain Required for Both CRISPR RNA Biogenesis and RNA Spacer Acquisition
    Article Snippet: Chilled neutralization buffer (600 μL of 3 M CH3 COOK, 2 M CH3 COOH) was added and lysates were immediately transferred to ice to prevent digestion of genomic DNA. .. Samples were treated with 50 μg/mL RNase A (Life Technologies) at 37°C for 30 min, linearized with PvuII-HF (New England Biolabs) at 37°C for 60 min (to aid denaturation during PCR), and treated with 200 μg/mL Protease K at 50°C for 30 min.


    Article Title: A markerless gene deletion and integration system for Thermoanaerobacter ethanolicus
    Article Snippet: Backbone plasmid digestion was performed with PvuII-HF (#R3151S, NEB) in CutSmart Buffer (#B7204S, NEB) at 50 °C for 15 min. Gel purification was performed on 1 % agarose gel with 0.01 % (v/v) SYBR Safe DNA Gel Stain florescent indicator (#S33102, Thermo Fisher Scientific) and recovered using Zymoclean Gel DNA Recovery Kit (#D4002, Zymo Research). .. Plasmids were constructed with Gibson Assembly Master Mix (#E2611L, NEB) at 50 °C for 1 h. Gels were run on Owl Easy Cast Mini Gel Electrophoresis Systems (#B1A, Thermo Scientific) for 35–40 min at 120 volts with Owl Compact Power Supply (#EC300XL, Thermo Scientific) and imaged on a Molecular Imager Gel Doc XR + System (#1708195EDU, Bio-Rad).


    Article Title: Genome-Wide Distribution of RNA-DNA Hybrids Identifies RNase H Targets in tRNA Genes, Retrotransposons and Mitochondria
    Article Snippet: .. 2 µg DNA were incubated overnight at 37°C in presence of 200 units of restriction endonuclease PvuII-HF (NEB, R3151). .. DNA samples were resolved on a standard 1% agarose gel (stained with ethidium bromide) in 1× TBE.


    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module
    Article Snippet: After 18 h, cells were transfected using polyethylenimin (PEI) as described before ( ) with 1 µg of addressed (Z12P12Z) or unaddressed (21P21) target plasmid [target sequences cloned into the plasmid pRK5.mCherry ( ); see ], respectively, and 4 µg of ZF-PvuII G46/A83/F94 or PvuII G46/A83/F94 encoding expression plasmids [the respective genes had been cloned in the plasmid pRK5 ( )]. .. Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB).


    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module
    Article Snippet: Cellular plasmid cleavage assay HEK293T cells were cultured in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum and penicillin/streptomycin (Invitrogen). .. Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB).

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting
    Article Snippet: Plasmid cleavage assay in HEK293T cells HEK293T cells were cultured in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Invitrogen). .. PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs).

    Transformation Assay:

    Article Title: Epigenetic regulation of condensin-mediated genome organization during the cell cycle and upon DNA damage through histone H3 lysine 56 acetylation
    Article Snippet: Plasmid pAL19 was digested by Pvu II-HF (New England Biolabs). .. Logarithmically growing cells were transformed with 1 μg of linear or circular pAL19 using electroporation.


    Article Title: Genome-Wide Distribution of RNA-DNA Hybrids Identifies RNase H Targets in tRNA Genes, Retrotransposons and Mitochondria
    Article Snippet: 2 µg DNA were incubated overnight at 37°C in presence of 200 units of restriction endonuclease PvuII-HF (NEB, R3151). .. DNA random priming probes were prepared using DECAprime II Random Primed DNA Labelling Kit (Ambion, Invitrogen, AM1455; for primer sequences see ), hybridized overnight at 42°C in Hybridization Buffer (50% formamide, 5× SSC, 5× Denhardt's solution, 0.5% SDS and 100 µg/ml sonicated salmon sperm DNA), and washed at 55°C with 2× SSC, 0.1% SDS and 0.1× SSC, 0.1% SDS.

    High Performance Liquid Chromatography:

    Article Title: A markerless gene deletion and integration system for Thermoanaerobacter ethanolicus
    Article Snippet: Backbone plasmid digestion was performed with PvuII-HF (#R3151S, NEB) in CutSmart Buffer (#B7204S, NEB) at 50 °C for 15 min. Gel purification was performed on 1 % agarose gel with 0.01 % (v/v) SYBR Safe DNA Gel Stain florescent indicator (#S33102, Thermo Fisher Scientific) and recovered using Zymoclean Gel DNA Recovery Kit (#D4002, Zymo Research). .. Fermentation metabolite concentrations were determined using a Waters HPLC system equipped with an Aminex HPX-87H column (Bio-Rad Laboratories, Hercules, CA) operated at 60 °C.


    Article Title: Epigenetic regulation of condensin-mediated genome organization during the cell cycle and upon DNA damage through histone H3 lysine 56 acetylation
    Article Snippet: Plasmid pAL19 was digested by Pvu II-HF (New England Biolabs). .. Logarithmically growing cells were transformed with 1 μg of linear or circular pAL19 using electroporation.


    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module
    Article Snippet: Cells were harvested 4 days after transfection, total DNA was extracted using QIAamp DNA Mini Kit (Qiagen) and 500 ng subjected to incomplete digestion with 20 U of PvuII-HF (New England BioLabs). .. Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB).

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting
    Article Snippet: Cells were harvested 3 days after transfection, and total DNA extracted using the QIAamp DNA Mini Kit (Qiagen). .. PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs).

    Southern Blot:

    Article Title: Genome-Wide Distribution of RNA-DNA Hybrids Identifies RNase H Targets in tRNA Genes, Retrotransposons and Mitochondria
    Article Snippet: Paragraph title: Southern blot analysis of Ty1 cDNA ... 2 µg DNA were incubated overnight at 37°C in presence of 200 units of restriction endonuclease PvuII-HF (NEB, R3151).

    Cell Culture:

    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module
    Article Snippet: Cellular plasmid cleavage assay HEK293T cells were cultured in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum and penicillin/streptomycin (Invitrogen). .. Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB).

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting
    Article Snippet: Plasmid cleavage assay in HEK293T cells HEK293T cells were cultured in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Invitrogen). .. PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs).


    Article Title: Iron-dependent essential genes in Salmonella Typhimurium
    Article Snippet: .. To remove the pseudo Tn5 mutants generated by chromosomal integration of pBAM1, genomic DNA was digested with PvuII-HF (New England Biolabs), and purified with DNA Clean & Concentrator-5 kit (Zymo Research). .. Then, a linear PCR extension was performed using Tn5-DPO (5’-AAGCTTGCATGCCTGCAGGTIIIIICTAGAGGATC-3′).

    Article Title: Antibody neutralization of retargeted measles viruses
    Article Snippet: First, the H mutant (H82) was generated by engineering escape mutationsin the Hemagglutin (H) gene (Accession ) encoded in the pCG plasmid(pCG-H). .. TheIEGR-AAQPA-EGFR.scFv-AAA-RGSHHHHHH C-terminal linker and EGFR.scFv domain, wasadded to H82 by digesting pCG-H82 and pTN-H6-Haa-αEGFR [ ] with Pac1 and PvuII-HF (NewEngland biolabs).

    Non-Homologous End Joining:

    Article Title: Epigenetic regulation of condensin-mediated genome organization during the cell cycle and upon DNA damage through histone H3 lysine 56 acetylation
    Article Snippet: Procedure for the NHEJ assay in fission yeast was previously established ( ; ). .. Plasmid pAL19 was digested by Pvu II-HF (New England Biolabs).

    Polymerase Chain Reaction:

    Article Title: Iron-dependent essential genes in Salmonella Typhimurium
    Article Snippet: To remove the pseudo Tn5 mutants generated by chromosomal integration of pBAM1, genomic DNA was digested with PvuII-HF (New England Biolabs), and purified with DNA Clean & Concentrator-5 kit (Zymo Research). .. Then, a linear PCR extension was performed using Tn5-DPO (5’-AAGCTTGCATGCCTGCAGGTIIIIICTAGAGGATC-3′).

    Article Title: Direct CRISPR spacer acquisition from RNA by a natural reverse-transcriptase-Cas1 fusion protein
    Article Snippet: .. 100 μL batches were linearized with PvuII-HF (NEB) to aid denaturation during PCR. .. Finally, each digest was purified using a Zymo gDNA Clean & Concentrator column.

    Article Title: A Reverse Transcriptase-Cas1 Fusion Protein Contains a Cas6 Domain Required for Both CRISPR RNA Biogenesis and RNA Spacer Acquisition
    Article Snippet: .. Samples were treated with 50 μg/mL RNase A (Life Technologies) at 37°C for 30 min, linearized with PvuII-HF (New England Biolabs) at 37°C for 60 min (to aid denaturation during PCR), and treated with 200 μg/mL Protease K at 50°C for 30 min. .. Finally, each digest was purified using a Zymo gDNA Clean and Concentrator column.

    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module
    Article Snippet: .. Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB). .. For the T7E1 assay, DNA was denatured at 95°C for 5 min, slowly cooled down to room temperature to allow for formation of heteroduplex DNA, treated with 5 U of T7E1 for 20 min at 37°C and fragments were separated on a 2% agarose gel.

    Article Title: A markerless gene deletion and integration system for Thermoanaerobacter ethanolicus
    Article Snippet: Analytical methods PCR amplification and colony PCR were both performed with Phusion High-Fidelity PCR Master Mix with HF Buffer (#M0531L, NEB). .. Backbone plasmid digestion was performed with PvuII-HF (#R3151S, NEB) in CutSmart Buffer (#B7204S, NEB) at 50 °C for 15 min. Gel purification was performed on 1 % agarose gel with 0.01 % (v/v) SYBR Safe DNA Gel Stain florescent indicator (#S33102, Thermo Fisher Scientific) and recovered using Zymoclean Gel DNA Recovery Kit (#D4002, Zymo Research).

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting
    Article Snippet: .. PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs). .. Cytotoxicity assay in HEK293T cells Nuclease-associated toxicity was determined basically as previously described [ ].

    Article Title: A Comprehensive Assessment of the Genetic Determinants in Salmonella Typhimurium for Resistance to Hydrogen Peroxide Using Proteogenomics
    Article Snippet: To remove the Tn5-junction sequences originated from the plasmid in the Tn-seq amplicon libraries, genomic DNA was digested with PvuII-HF (New England Biolabs), which digests immediately outside the inverted repeats on both sides of Tn5 in pBAM1, and purified with DNA Clean & Concentrator-5 kit (Zymo Reaerch). .. Then, a linear PCR extension was performed using a Tn5-specific primer in order to produce single stranded DNA corresponding to Tn5-junction sequences.

    Article Title: Recombination regulator PRDM9 influences the instability of its own coding sequence in humans
    Article Snippet: Aliquots of 25 μg DNA were digested with 240 U HpaI plus 240 U PvuII-HF (New England BioLabs) in 500 μL NEB4 buffer at 37 °C for 2.5 h. Digested DNA was recovered by ethanol precipitation, dissolved in 5 mM Tris-HCl, pH 7.5, and 15 μg DNA was loaded into a 2.5-cm-wide slot in a 40-cm-long 0.9% (wt/vol) SeaKem HGT (Lonza) agarose gel in 0.5 × tris-borate EDTA buffer containing 0.5 μg/mL ethidium bromide. .. Adjacent size markers were 4 μg λ DNA × HindIII plus 2 μg ϕX174 DNA × HaeIII, together with 2 μg of ladder ML ( ) consisting of PCR products matched in size and GC content to HpaI–PvuII fragments encoding PRDM9 ZnF arrays with 11–17 repeats.


    Article Title: Genome-Wide Distribution of RNA-DNA Hybrids Identifies RNase H Targets in tRNA Genes, Retrotransposons and Mitochondria
    Article Snippet: 2 µg DNA were incubated overnight at 37°C in presence of 200 units of restriction endonuclease PvuII-HF (NEB, R3151). .. DNA random priming probes were prepared using DECAprime II Random Primed DNA Labelling Kit (Ambion, Invitrogen, AM1455; for primer sequences see ), hybridized overnight at 42°C in Hybridization Buffer (50% formamide, 5× SSC, 5× Denhardt's solution, 0.5% SDS and 100 µg/ml sonicated salmon sperm DNA), and washed at 55°C with 2× SSC, 0.1% SDS and 0.1× SSC, 0.1% SDS.

    Gel Purification:

    Article Title: A markerless gene deletion and integration system for Thermoanaerobacter ethanolicus
    Article Snippet: .. Backbone plasmid digestion was performed with PvuII-HF (#R3151S, NEB) in CutSmart Buffer (#B7204S, NEB) at 50 °C for 15 min. Gel purification was performed on 1 % agarose gel with 0.01 % (v/v) SYBR Safe DNA Gel Stain florescent indicator (#S33102, Thermo Fisher Scientific) and recovered using Zymoclean Gel DNA Recovery Kit (#D4002, Zymo Research). .. Plasmids were constructed with Gibson Assembly Master Mix (#E2611L, NEB) at 50 °C for 1 h. Gels were run on Owl Easy Cast Mini Gel Electrophoresis Systems (#B1A, Thermo Scientific) for 35–40 min at 120 volts with Owl Compact Power Supply (#EC300XL, Thermo Scientific) and imaged on a Molecular Imager Gel Doc XR + System (#1708195EDU, Bio-Rad).

    Cleavage Assay:

    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module
    Article Snippet: Paragraph title: Cellular plasmid cleavage assay ... Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB).

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting
    Article Snippet: Paragraph title: Plasmid cleavage assay in HEK293T cells ... PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs).

    Nucleic Acid Electrophoresis:

    Article Title: A markerless gene deletion and integration system for Thermoanaerobacter ethanolicus
    Article Snippet: Backbone plasmid digestion was performed with PvuII-HF (#R3151S, NEB) in CutSmart Buffer (#B7204S, NEB) at 50 °C for 15 min. Gel purification was performed on 1 % agarose gel with 0.01 % (v/v) SYBR Safe DNA Gel Stain florescent indicator (#S33102, Thermo Fisher Scientific) and recovered using Zymoclean Gel DNA Recovery Kit (#D4002, Zymo Research). .. Plasmids were constructed with Gibson Assembly Master Mix (#E2611L, NEB) at 50 °C for 1 h. Gels were run on Owl Easy Cast Mini Gel Electrophoresis Systems (#B1A, Thermo Scientific) for 35–40 min at 120 volts with Owl Compact Power Supply (#EC300XL, Thermo Scientific) and imaged on a Molecular Imager Gel Doc XR + System (#1708195EDU, Bio-Rad).


    Article Title: Antibody neutralization of retargeted measles viruses
    Article Snippet: Mutations in H82 are as follows: L284S, E395K, E398G, E535N, H536A,A537T, Y310C, D416N, S546N, R547A, S550T, F552N, Y553G, P554T, S590N, G592S.Mutations were added sequentially by site-directed mutagenesis using theQuikChange® Lightning Site-Directed Mutagenesis Kit (AgilentTechnologies) as per manufacture’s directions. .. TheIEGR-AAQPA-EGFR.scFv-AAA-RGSHHHHHH C-terminal linker and EGFR.scFv domain, wasadded to H82 by digesting pCG-H82 and pTN-H6-Haa-αEGFR [ ] with Pac1 and PvuII-HF (NewEngland biolabs).

    Random Primed:

    Article Title: Genome-Wide Distribution of RNA-DNA Hybrids Identifies RNase H Targets in tRNA Genes, Retrotransposons and Mitochondria
    Article Snippet: 2 µg DNA were incubated overnight at 37°C in presence of 200 units of restriction endonuclease PvuII-HF (NEB, R3151). .. DNA random priming probes were prepared using DECAprime II Random Primed DNA Labelling Kit (Ambion, Invitrogen, AM1455; for primer sequences see ), hybridized overnight at 42°C in Hybridization Buffer (50% formamide, 5× SSC, 5× Denhardt's solution, 0.5% SDS and 100 µg/ml sonicated salmon sperm DNA), and washed at 55°C with 2× SSC, 0.1% SDS and 0.1× SSC, 0.1% SDS.

    Flow Cytometry:

    Article Title: A markerless gene deletion and integration system for Thermoanaerobacter ethanolicus
    Article Snippet: Backbone plasmid digestion was performed with PvuII-HF (#R3151S, NEB) in CutSmart Buffer (#B7204S, NEB) at 50 °C for 15 min. Gel purification was performed on 1 % agarose gel with 0.01 % (v/v) SYBR Safe DNA Gel Stain florescent indicator (#S33102, Thermo Fisher Scientific) and recovered using Zymoclean Gel DNA Recovery Kit (#D4002, Zymo Research). .. The mobile phase was 5 mM H2 SO4 at a flow rate of 0.6 mL/min.


    Article Title: Iron-dependent essential genes in Salmonella Typhimurium
    Article Snippet: .. To remove the pseudo Tn5 mutants generated by chromosomal integration of pBAM1, genomic DNA was digested with PvuII-HF (New England Biolabs), and purified with DNA Clean & Concentrator-5 kit (Zymo Research). .. Then, a linear PCR extension was performed using Tn5-DPO (5’-AAGCTTGCATGCCTGCAGGTIIIIICTAGAGGATC-3′).

    Article Title: Direct CRISPR spacer acquisition from RNA by a natural reverse-transcriptase-Cas1 fusion protein
    Article Snippet: Samples were treated with 20 μg/mL RNase A (Life Technologies) at 37°C for 30 min, further digested with 150 μg/mL Protease K in 0.5% SDS at 50°C for 30 min, and purified by organic extraction. .. 100 μL batches were linearized with PvuII-HF (NEB) to aid denaturation during PCR.

    Article Title: A Reverse Transcriptase-Cas1 Fusion Protein Contains a Cas6 Domain Required for Both CRISPR RNA Biogenesis and RNA Spacer Acquisition
    Article Snippet: Samples were treated with 50 μg/mL RNase A (Life Technologies) at 37°C for 30 min, linearized with PvuII-HF (New England Biolabs) at 37°C for 60 min (to aid denaturation during PCR), and treated with 200 μg/mL Protease K at 50°C for 30 min. .. Finally, each digest was purified using a Zymo gDNA Clean and Concentrator column.

    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module
    Article Snippet: .. Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB). .. For the T7E1 assay, DNA was denatured at 95°C for 5 min, slowly cooled down to room temperature to allow for formation of heteroduplex DNA, treated with 5 U of T7E1 for 20 min at 37°C and fragments were separated on a 2% agarose gel.

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting
    Article Snippet: .. PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs). .. Cytotoxicity assay in HEK293T cells Nuclease-associated toxicity was determined basically as previously described [ ].

    Article Title: A Comprehensive Assessment of the Genetic Determinants in Salmonella Typhimurium for Resistance to Hydrogen Peroxide Using Proteogenomics
    Article Snippet: .. To remove the Tn5-junction sequences originated from the plasmid in the Tn-seq amplicon libraries, genomic DNA was digested with PvuII-HF (New England Biolabs), which digests immediately outside the inverted repeats on both sides of Tn5 in pBAM1, and purified with DNA Clean & Concentrator-5 kit (Zymo Reaerch). .. Then, a linear PCR extension was performed using a Tn5-specific primer in order to produce single stranded DNA corresponding to Tn5-junction sequences.

    Article Title: Primer Extension Reactions for the PCR- based α- complementation Assay
    Article Snippet: .. pBSM13+ (Stratagene) T3 RNA polymerase (Roche Diagnostics, catalog number: P2083) 10x transcription buffer (Roche Diagnostics, catalog number: P2083) High-fidelity PvuII ( PvuII -HF) (New England Biolabs, catalog number: R3151L) High-fidelity EcoRI ( EcoRI -HF) (New England Biolabs, catalog number: R3101L) 10x CutSmart buffer (New England Biolabs, catalog number: R3101L) 6x gel loading dye (New England Biolabs, catalog number: R3101L) NdeI (New England Biolabs, catalog number: R0111L) T4 polynucleotide kinase (PNK) (New England Biolabs, catalog number: M0201L) 10x T4 polynucleotide kinase buffer (New England Biolabs, catalog Number: B0201S) RNasin (RNase inhibitor) (New England Biolabs, catalog number: M0307L) RNase (DNase-free) (Roche Diagnostics, catalog number: 11119915001) RNase-free DNase I (Affymetrix, catalog number: 784111000) Pfu DNA polymerase (Agilent Technologies, catalog number: 600353) 10x Pfu buffer (Agilent Technologies, catalog number: 600353) Ribonucleoside triphosphate set (Roche Diagnostics, catalog number: 11277057001) Deoxynucleoside triphosphate (dNTP) (Roche Diagnostics, catalog number: 11969064001) Gamma [γ-32 P] ATP (PerkinElmer, catalog number: Blu502A001MC) G-25 Macro spin columns (best suited for volumes of 75-150 μl) (Harvard Apparatus, catalog number: 74-3901) RNeasy RNA purification kit (QIAGEN, catalog number: 74104) Phenol: Chloroform: Isoamyl alcohol (25:24:1) (Amresco, catalog number: K169-400ML) Ethanol (VWR Lifesciences, catalog number: EM1.00967.4003) 3M Sodium Acetate (Amresco, catalog number: E521-100ML) Isopropyl alcohol (J.T.Baker® , catalog number: 9037-03) 40% Acrylamide-Bisacrylamide (19:1) solution (VWR International, catalog number: JT4968-0) 40% Acrylamide-Bisacrylamide (29:1) solution (VWR International, catalog number: JT4968-0) Urea (VWR International, catalog number: 97061-926) Ammonium Persulfate (VWR International, catalog number: 97064-594) HIV Reverse Transcriptase, [purified as described in ] Milli-Q quality [RNase, DNase free water (dH2 O)] DNA oligonucleotides were obtained from Integrated DNA Technologies Extension reaction buffer (see Recipes) Elution buffer (see Recipes) 2x SDS loading buffer (see Recipes) .. Eppendorf tubes Micropipette Petri plates Table top centrifuge Incubator Gel apparatus


    Article Title: Iron-dependent essential genes in Salmonella Typhimurium
    Article Snippet: Paragraph title: Preparation of Tn-seq libraries for HiSeq sequencing ... To remove the pseudo Tn5 mutants generated by chromosomal integration of pBAM1, genomic DNA was digested with PvuII-HF (New England Biolabs), and purified with DNA Clean & Concentrator-5 kit (Zymo Research).


    Article Title: A markerless gene deletion and integration system for Thermoanaerobacter ethanolicus
    Article Snippet: .. Backbone plasmid digestion was performed with PvuII-HF (#R3151S, NEB) in CutSmart Buffer (#B7204S, NEB) at 50 °C for 15 min. Gel purification was performed on 1 % agarose gel with 0.01 % (v/v) SYBR Safe DNA Gel Stain florescent indicator (#S33102, Thermo Fisher Scientific) and recovered using Zymoclean Gel DNA Recovery Kit (#D4002, Zymo Research). .. Plasmids were constructed with Gibson Assembly Master Mix (#E2611L, NEB) at 50 °C for 1 h. Gels were run on Owl Easy Cast Mini Gel Electrophoresis Systems (#B1A, Thermo Scientific) for 35–40 min at 120 volts with Owl Compact Power Supply (#EC300XL, Thermo Scientific) and imaged on a Molecular Imager Gel Doc XR + System (#1708195EDU, Bio-Rad).

    Article Title: Genome-Wide Distribution of RNA-DNA Hybrids Identifies RNase H Targets in tRNA Genes, Retrotransposons and Mitochondria
    Article Snippet: 2 µg DNA were incubated overnight at 37°C in presence of 200 units of restriction endonuclease PvuII-HF (NEB, R3151). .. DNA samples were resolved on a standard 1% agarose gel (stained with ethidium bromide) in 1× TBE.

    Plasmid Preparation:

    Article Title: Direct CRISPR spacer acquisition from RNA by a natural reverse-transcriptase-Cas1 fusion protein
    Article Snippet: Plasmid DNA was resuspended in 0.5 mL elution buffer, desalted with Illustra NAP-5 G-25 Sephadex columns (GE Healthcare), and eluted with 1 mL water. .. 100 μL batches were linearized with PvuII-HF (NEB) to aid denaturation during PCR.

    Article Title: A Reverse Transcriptase-Cas1 Fusion Protein Contains a Cas6 Domain Required for Both CRISPR RNA Biogenesis and RNA Spacer Acquisition
    Article Snippet: Isopropanol (950 μL) was added and the plasmid DNA was pelleted by centrifugation (16,000 × g, 20 min, 4°C), washed twice in 80% ethanol, and resuspended in 200 μL 1x NEB Cutsmart Buffer. .. Samples were treated with 50 μg/mL RNase A (Life Technologies) at 37°C for 30 min, linearized with PvuII-HF (New England Biolabs) at 37°C for 60 min (to aid denaturation during PCR), and treated with 200 μg/mL Protease K at 50°C for 30 min.

    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module
    Article Snippet: Paragraph title: Cellular plasmid cleavage assay ... Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB).

    Article Title: A markerless gene deletion and integration system for Thermoanaerobacter ethanolicus
    Article Snippet: .. Backbone plasmid digestion was performed with PvuII-HF (#R3151S, NEB) in CutSmart Buffer (#B7204S, NEB) at 50 °C for 15 min. Gel purification was performed on 1 % agarose gel with 0.01 % (v/v) SYBR Safe DNA Gel Stain florescent indicator (#S33102, Thermo Fisher Scientific) and recovered using Zymoclean Gel DNA Recovery Kit (#D4002, Zymo Research). .. Plasmids were constructed with Gibson Assembly Master Mix (#E2611L, NEB) at 50 °C for 1 h. Gels were run on Owl Easy Cast Mini Gel Electrophoresis Systems (#B1A, Thermo Scientific) for 35–40 min at 120 volts with Owl Compact Power Supply (#EC300XL, Thermo Scientific) and imaged on a Molecular Imager Gel Doc XR + System (#1708195EDU, Bio-Rad).

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting
    Article Snippet: Paragraph title: Plasmid cleavage assay in HEK293T cells ... PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs).

    Article Title: Epigenetic regulation of condensin-mediated genome organization during the cell cycle and upon DNA damage through histone H3 lysine 56 acetylation
    Article Snippet: .. Plasmid pAL19 was digested by Pvu II-HF (New England Biolabs). .. Logarithmically growing cells were transformed with 1 μg of linear or circular pAL19 using electroporation.

    Article Title: A Comprehensive Assessment of the Genetic Determinants in Salmonella Typhimurium for Resistance to Hydrogen Peroxide Using Proteogenomics
    Article Snippet: .. To remove the Tn5-junction sequences originated from the plasmid in the Tn-seq amplicon libraries, genomic DNA was digested with PvuII-HF (New England Biolabs), which digests immediately outside the inverted repeats on both sides of Tn5 in pBAM1, and purified with DNA Clean & Concentrator-5 kit (Zymo Reaerch). .. Then, a linear PCR extension was performed using a Tn5-specific primer in order to produce single stranded DNA corresponding to Tn5-junction sequences.

    Article Title: Antibody neutralization of retargeted measles viruses
    Article Snippet: First, the H mutant (H82) was generated by engineering escape mutationsin the Hemagglutin (H) gene (Accession ) encoded in the pCG plasmid(pCG-H). .. TheIEGR-AAQPA-EGFR.scFv-AAA-RGSHHHHHH C-terminal linker and EGFR.scFv domain, wasadded to H82 by digesting pCG-H82 and pTN-H6-Haa-αEGFR [ ] with Pac1 and PvuII-HF (NewEngland biolabs).

    Agarose Gel Electrophoresis:

    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module
    Article Snippet: Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB). .. For the T7E1 assay, DNA was denatured at 95°C for 5 min, slowly cooled down to room temperature to allow for formation of heteroduplex DNA, treated with 5 U of T7E1 for 20 min at 37°C and fragments were separated on a 2% agarose gel.

    Article Title: A markerless gene deletion and integration system for Thermoanaerobacter ethanolicus
    Article Snippet: .. Backbone plasmid digestion was performed with PvuII-HF (#R3151S, NEB) in CutSmart Buffer (#B7204S, NEB) at 50 °C for 15 min. Gel purification was performed on 1 % agarose gel with 0.01 % (v/v) SYBR Safe DNA Gel Stain florescent indicator (#S33102, Thermo Fisher Scientific) and recovered using Zymoclean Gel DNA Recovery Kit (#D4002, Zymo Research). .. Plasmids were constructed with Gibson Assembly Master Mix (#E2611L, NEB) at 50 °C for 1 h. Gels were run on Owl Easy Cast Mini Gel Electrophoresis Systems (#B1A, Thermo Scientific) for 35–40 min at 120 volts with Owl Compact Power Supply (#EC300XL, Thermo Scientific) and imaged on a Molecular Imager Gel Doc XR + System (#1708195EDU, Bio-Rad).

    Article Title: Genome-Wide Distribution of RNA-DNA Hybrids Identifies RNase H Targets in tRNA Genes, Retrotransposons and Mitochondria
    Article Snippet: 2 µg DNA were incubated overnight at 37°C in presence of 200 units of restriction endonuclease PvuII-HF (NEB, R3151). .. DNA samples were resolved on a standard 1% agarose gel (stained with ethidium bromide) in 1× TBE.

    Article Title: Recombination regulator PRDM9 influences the instability of its own coding sequence in humans
    Article Snippet: .. Aliquots of 25 μg DNA were digested with 240 U HpaI plus 240 U PvuII-HF (New England BioLabs) in 500 μL NEB4 buffer at 37 °C for 2.5 h. Digested DNA was recovered by ethanol precipitation, dissolved in 5 mM Tris-HCl, pH 7.5, and 15 μg DNA was loaded into a 2.5-cm-wide slot in a 40-cm-long 0.9% (wt/vol) SeaKem HGT (Lonza) agarose gel in 0.5 × tris-borate EDTA buffer containing 0.5 μg/mL ethidium bromide. .. Adjacent size markers were 4 μg λ DNA × HindIII plus 2 μg ϕX174 DNA × HaeIII, together with 2 μg of ladder ML ( ) consisting of PCR products matched in size and GC content to HpaI–PvuII fragments encoding PRDM9 ZnF arrays with 11–17 repeats.

    Ethanol Precipitation:

    Article Title: Recombination regulator PRDM9 influences the instability of its own coding sequence in humans
    Article Snippet: .. Aliquots of 25 μg DNA were digested with 240 U HpaI plus 240 U PvuII-HF (New England BioLabs) in 500 μL NEB4 buffer at 37 °C for 2.5 h. Digested DNA was recovered by ethanol precipitation, dissolved in 5 mM Tris-HCl, pH 7.5, and 15 μg DNA was loaded into a 2.5-cm-wide slot in a 40-cm-long 0.9% (wt/vol) SeaKem HGT (Lonza) agarose gel in 0.5 × tris-borate EDTA buffer containing 0.5 μg/mL ethidium bromide. .. Adjacent size markers were 4 μg λ DNA × HindIII plus 2 μg ϕX174 DNA × HaeIII, together with 2 μg of ladder ML ( ) consisting of PCR products matched in size and GC content to HpaI–PvuII fragments encoding PRDM9 ZnF arrays with 11–17 repeats.

    Alkaline Lysis:

    Article Title: A Reverse Transcriptase-Cas1 Fusion Protein Contains a Cas6 Domain Required for Both CRISPR RNA Biogenesis and RNA Spacer Acquisition
    Article Snippet: Cells were harvested by centrifugation (4,000 × g, 30 min, 4°C) and homogenized in 300 μL alkaline lysis buffer (40 mM glucose, 10 mM Tris-HCl, pH 7.5, 4 mM EDTA, 0.1 N NaOH, 0.5% SDS) at 50°C by vortexing until clear (10-15 min). .. Samples were treated with 50 μg/mL RNase A (Life Technologies) at 37°C for 30 min, linearized with PvuII-HF (New England Biolabs) at 37°C for 60 min (to aid denaturation during PCR), and treated with 200 μg/mL Protease K at 50°C for 30 min.


    Article Title: Recombination regulator PRDM9 influences the instability of its own coding sequence in humans
    Article Snippet: Paragraph title: DNA Fractionation. ... Aliquots of 25 μg DNA were digested with 240 U HpaI plus 240 U PvuII-HF (New England BioLabs) in 500 μL NEB4 buffer at 37 °C for 2.5 h. Digested DNA was recovered by ethanol precipitation, dissolved in 5 mM Tris-HCl, pH 7.5, and 15 μg DNA was loaded into a 2.5-cm-wide slot in a 40-cm-long 0.9% (wt/vol) SeaKem HGT (Lonza) agarose gel in 0.5 × tris-borate EDTA buffer containing 0.5 μg/mL ethidium bromide.


    Article Title: Genome-Wide Distribution of RNA-DNA Hybrids Identifies RNase H Targets in tRNA Genes, Retrotransposons and Mitochondria
    Article Snippet: Southern blot analysis of Ty1 cDNA Total genomic DNA were extracted by standard glass-bead/phenol lysis (e.g. see ). .. 2 µg DNA were incubated overnight at 37°C in presence of 200 units of restriction endonuclease PvuII-HF (NEB, R3151).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs pvuii hf
    Pvuii Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more hf/product/New England Biolabs
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    pvuii hf - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results