pvuii hf  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Name:
    PvuII HF
    Description:
    PvuII HF 25 000 units
    Catalog Number:
    R3151L
    Price:
    249
    Category:
    Restriction Enzymes
    Size:
    25 000 units
    Buy from Supplier


    Structured Review

    New England Biolabs pvuii hf
    PvuII HF
    PvuII HF 25 000 units
    https://www.bioz.com/result/pvuii hf/product/New England Biolabs
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pvuii hf - by Bioz Stars, 2021-06
    96/100 stars

    Images

    1) Product Images from "Recombination regulator PRDM9 influences the instability of its own coding sequence in humans"

    Article Title: Recombination regulator PRDM9 influences the instability of its own coding sequence in humans

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1220813110

    De novo mutation at PRDM9 . ( A ) Restriction sites used for size-enriching ZnF repeat array mutants, plus primers (blue arrows) for single molecule amplification of the array (boxes). Using HpaI and PvuII ensured that any residual partial digest products
    Figure Legend Snippet: De novo mutation at PRDM9 . ( A ) Restriction sites used for size-enriching ZnF repeat array mutants, plus primers (blue arrows) for single molecule amplification of the array (boxes). Using HpaI and PvuII ensured that any residual partial digest products

    Techniques Used: Mutagenesis, Amplification

    2) Product Images from "Antimicrobial Resistance in Escherichia coli and Resistance Genes in Coliphages from a Small Animal Clinic and in a Patient Dog with Chronic Urinary Tract Infection"

    Article Title: Antimicrobial Resistance in Escherichia coli and Resistance Genes in Coliphages from a Small Animal Clinic and in a Patient Dog with Chronic Urinary Tract Infection

    Journal: Antibiotics

    doi: 10.3390/antibiotics9100652

    Restriction profile of phage DNA using PvuII . This gel documents 12 restricted phages in which three restriction profiles could be distinguished. Slot 1 and 14 molecular weight marker, slot 2, 3, 7, 8, 9 restriction profile 1 (RP1), slot 4, 5, 6, 10, 11, 13 restriction profile 2 (RP2), slot 12 restriction profile 3 (RP3).
    Figure Legend Snippet: Restriction profile of phage DNA using PvuII . This gel documents 12 restricted phages in which three restriction profiles could be distinguished. Slot 1 and 14 molecular weight marker, slot 2, 3, 7, 8, 9 restriction profile 1 (RP1), slot 4, 5, 6, 10, 11, 13 restriction profile 2 (RP2), slot 12 restriction profile 3 (RP3).

    Techniques Used: Molecular Weight, Marker

    3) Product Images from "A novel zinc-finger nuclease platform with a sequence-specific cleavage module"

    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr1112

    Kinetic analysis of the ZF-PvuII fusion enzymes cleaving an addressed substrate [black triangle; 250 bp PCR product containing either the tripartite (Z12P12Z) or bipartite (P12Z) target sites] and an unaddressed substrate [open diamond; 450 bp PCR product containing a single PvuII site (P)] in competition in a near equimolar stoichiometry (20 nM addressed substrate/20 nM unaddressed substrate/18 nM enzyme). The gel electrophoretic analysis of samples withdrawn from the incubation mixture at defined time intervals is shown as an insert of the activity versus time profile. ( A ) Preferential DNA cleavage (addressed versus unaddressed) by ZF-PvuII G46 (Z12P12Z versus P). ( B ) Preferential cleavage by ZF-scPvuII G46 (P12Z versus P). ( C ) Preferential DNA cleavage by ZF-PvuII G46/F94 (Z12P12Z versus P). ( D ) Preferential DNA cleavage by ZF-PvuII G46/A83/F94 (Z12P12Z versus P).
    Figure Legend Snippet: Kinetic analysis of the ZF-PvuII fusion enzymes cleaving an addressed substrate [black triangle; 250 bp PCR product containing either the tripartite (Z12P12Z) or bipartite (P12Z) target sites] and an unaddressed substrate [open diamond; 450 bp PCR product containing a single PvuII site (P)] in competition in a near equimolar stoichiometry (20 nM addressed substrate/20 nM unaddressed substrate/18 nM enzyme). The gel electrophoretic analysis of samples withdrawn from the incubation mixture at defined time intervals is shown as an insert of the activity versus time profile. ( A ) Preferential DNA cleavage (addressed versus unaddressed) by ZF-PvuII G46 (Z12P12Z versus P). ( B ) Preferential cleavage by ZF-scPvuII G46 (P12Z versus P). ( C ) Preferential DNA cleavage by ZF-PvuII G46/F94 (Z12P12Z versus P). ( D ) Preferential DNA cleavage by ZF-PvuII G46/A83/F94 (Z12P12Z versus P).

    Techniques Used: Polymerase Chain Reaction, Incubation, Activity Assay

    ZF-PvuII G46/A83/F94 mediated DNA cleavage in mammalian cells. ( A ) Schematic of the ZF-PvuII G46/A83/F94 target sites. The addressed Z12P12Z target site harbors an inverted repeat of ZF-binding sites separated by 12-bp spacer sequences that flank a central PvuII site. The unaddressed target site 21P21 is structured identically but lacks the ZF-binding sites. ( B ) Expression levels of ZF-PvuII G46/A83/F94 and PvuII G46/A83/F94. Cell lysates of transfected HEK293T cells were probed with antibodies against HA-tag or EGFP. ( C and D ) Cleavage activity in cellula . Cleavage of target plasmids in transfected HEK293T cells was assessed by detecting nuclease-induced mutations due to imperfect repair of DNA DSBs by NHEJ. PCR fragments encompassing the target site were either subjected to digestion with the mismatch-sensitive T7 endonuclease 1 (C) or PvuII (D).
    Figure Legend Snippet: ZF-PvuII G46/A83/F94 mediated DNA cleavage in mammalian cells. ( A ) Schematic of the ZF-PvuII G46/A83/F94 target sites. The addressed Z12P12Z target site harbors an inverted repeat of ZF-binding sites separated by 12-bp spacer sequences that flank a central PvuII site. The unaddressed target site 21P21 is structured identically but lacks the ZF-binding sites. ( B ) Expression levels of ZF-PvuII G46/A83/F94 and PvuII G46/A83/F94. Cell lysates of transfected HEK293T cells were probed with antibodies against HA-tag or EGFP. ( C and D ) Cleavage activity in cellula . Cleavage of target plasmids in transfected HEK293T cells was assessed by detecting nuclease-induced mutations due to imperfect repair of DNA DSBs by NHEJ. PCR fragments encompassing the target site were either subjected to digestion with the mismatch-sensitive T7 endonuclease 1 (C) or PvuII (D).

    Techniques Used: Binding Assay, Expressing, Transfection, Activity Assay, Non-Homologous End Joining, Polymerase Chain Reaction

    4) Product Images from "TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting"

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0082539

    Engineered highly specific endonucleases that can be used for gene targeting by introducing a double-strand break into a complex genome and thereby stimulating homologous recombination. With the exception of engineered homing endonucleases (“meganucleases”) in which the function of DNA binding and DNA cleavage is present in the same polypeptide chain [ 77 ], the other engineered nucleases consist of separate DNA-binding (green) and DNA-cleavage (blue) modules. Zinc finger nucleases and TALE nucleases usually have the non-specific cleavage domain of the restriction endonuclease FokI as DNA-cleavage module, but as shown recently and in the present paper the restriction endonuclease PvuII can also be used for this purpose [ 54 ]. PvuII has also been employed in TFO-linked nucleases [ 49 ] and in protein fusions (with catalytically inactive I-SceI) [ 53 ] as DNA-cleavage module. Zinc finger nucleases, TALE nucleases and TFO-linked nucleases are programmable, as are the RNA-mediated nucleases [ 36 ] [modified after [ 3 ]] .
    Figure Legend Snippet: Engineered highly specific endonucleases that can be used for gene targeting by introducing a double-strand break into a complex genome and thereby stimulating homologous recombination. With the exception of engineered homing endonucleases (“meganucleases”) in which the function of DNA binding and DNA cleavage is present in the same polypeptide chain [ 77 ], the other engineered nucleases consist of separate DNA-binding (green) and DNA-cleavage (blue) modules. Zinc finger nucleases and TALE nucleases usually have the non-specific cleavage domain of the restriction endonuclease FokI as DNA-cleavage module, but as shown recently and in the present paper the restriction endonuclease PvuII can also be used for this purpose [ 54 ]. PvuII has also been employed in TFO-linked nucleases [ 49 ] and in protein fusions (with catalytically inactive I-SceI) [ 53 ] as DNA-cleavage module. Zinc finger nucleases, TALE nucleases and TFO-linked nucleases are programmable, as are the RNA-mediated nucleases [ 36 ] [modified after [ 3 ]] .

    Techniques Used: Homologous Recombination, Binding Assay, Zinc-Fingers, Modification

    Analysis of competition cleavage experiments with AvrBs3-PvuII fusion proteins. ( A ) Competition cleavage experiments with AvrBs3-28-L-PvuII T46G under physiological ionic strength. Shown is the cleavage pattern with supercoiled plasmid DNA with an addressed site (8 nM) in competition with a PCR fragment (unP) with an unaddressed site (32 nM). The experiment was carried out with a variable excess of enzyme over plasmid substrate (0.25 to 40-fold). The enzyme shows complete cleavage of the addressed substrate but no cleavage of the unaddressed substrate, even in an overnight incubation with a 40-fold excess of enzyme over the addressed plasmid substrate (8 nM) and 10-fold excess over the unaddressed PCR substrate (32 nM). The brackets indicate the positions where one would expect the products of cleavage of the unaddressed PCR substrate. oc, open circle; lin, linearized; sc, supercoiled. ( B ) Quantitative determination of the preference of AvrBs3-28-L-PvuII T46G for an addressed (T3-6bp-P-6bp-T3) over an unaddressed site (-P-). The reactions were performed in triplicate under physiological conditions with 20 nM enzyme and 20 nM addressed substrate (squares) and unaddressed substrate (circles), both PCR fragments were radioactively labelled with [α 32 P]dATP. The insert shows the primary data: the electrophoretic analysis of the cleavage reaction products using an Instant Imager. From the fit, a cleavage preference of > 34,000-fold was determined.
    Figure Legend Snippet: Analysis of competition cleavage experiments with AvrBs3-PvuII fusion proteins. ( A ) Competition cleavage experiments with AvrBs3-28-L-PvuII T46G under physiological ionic strength. Shown is the cleavage pattern with supercoiled plasmid DNA with an addressed site (8 nM) in competition with a PCR fragment (unP) with an unaddressed site (32 nM). The experiment was carried out with a variable excess of enzyme over plasmid substrate (0.25 to 40-fold). The enzyme shows complete cleavage of the addressed substrate but no cleavage of the unaddressed substrate, even in an overnight incubation with a 40-fold excess of enzyme over the addressed plasmid substrate (8 nM) and 10-fold excess over the unaddressed PCR substrate (32 nM). The brackets indicate the positions where one would expect the products of cleavage of the unaddressed PCR substrate. oc, open circle; lin, linearized; sc, supercoiled. ( B ) Quantitative determination of the preference of AvrBs3-28-L-PvuII T46G for an addressed (T3-6bp-P-6bp-T3) over an unaddressed site (-P-). The reactions were performed in triplicate under physiological conditions with 20 nM enzyme and 20 nM addressed substrate (squares) and unaddressed substrate (circles), both PCR fragments were radioactively labelled with [α 32 P]dATP. The insert shows the primary data: the electrophoretic analysis of the cleavage reaction products using an Instant Imager. From the fit, a cleavage preference of > 34,000-fold was determined.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Incubation

    Activity and toxicity of TALE-PvuII fusion proteins in human cells. ( A ) PCR was performed with the plasmid from the HEK293 cells resulting in a DNA fragment of 517 bp. * indicates the cleavage site of PvuII. ( B ) Analysis of the PCR product (14.5 nM) after digestion with 20 U of PvuII for 1 h. A cleavage-resistant band indicates the loss of the PvuII site by NHEJ and confirms the activity of the TALE-PvuII fusion proteins. ( C ) Cell toxicity of the PvuII-based TALENs. After co-transfection of a mCherry expression plasmid, cell survival rate was calculated as the decrease in the number of mCherry-positive cells from day 2 to day 5 by flow cytometry, normalized to cells transfected with an I-SceI expression vector. * Statistically significant differences in toxicities between I-SceI and TALE-PvuII fusion proteins are indicated (P-values) .
    Figure Legend Snippet: Activity and toxicity of TALE-PvuII fusion proteins in human cells. ( A ) PCR was performed with the plasmid from the HEK293 cells resulting in a DNA fragment of 517 bp. * indicates the cleavage site of PvuII. ( B ) Analysis of the PCR product (14.5 nM) after digestion with 20 U of PvuII for 1 h. A cleavage-resistant band indicates the loss of the PvuII site by NHEJ and confirms the activity of the TALE-PvuII fusion proteins. ( C ) Cell toxicity of the PvuII-based TALENs. After co-transfection of a mCherry expression plasmid, cell survival rate was calculated as the decrease in the number of mCherry-positive cells from day 2 to day 5 by flow cytometry, normalized to cells transfected with an I-SceI expression vector. * Statistically significant differences in toxicities between I-SceI and TALE-PvuII fusion proteins are indicated (P-values) .

    Techniques Used: Activity Assay, Polymerase Chain Reaction, Plasmid Preparation, Non-Homologous End Joining, TALENs, Cotransfection, Expressing, Flow Cytometry, Cytometry, Transfection

    Analysis of the cleavage activity of AvrBs3-PvuII fusion proteins. ( A ) and ( B ) Comparison of the cleavage rates of selected AvrBs3-PvuII fusion proteins (as indicated) under low ionic strength: 76 mM (20 mM Tris-Ac, 50 mM K-Ac, 2 mM Mg-Ac, pH 7.5). In the top row the cleavage of the addressed substrate (T3-6bp-P-6bp-T3) is shown, in the bottom row that of the unaddressed substrate (-P-). All cleavage experiments were done with 8 nM DNA and 8 nM enzyme. ( C ) Comparison of the cleavage rates of an unaddressed substrate by selected AvrBs3-PvuII fusion proteins (as indicated) under physiological ionic strength: 143 mM (20 mM Tris-Ac, 120 mM K-Ac, 1 mM Mg-Ac, pH 7.5). The experiments were done with an excess of enzyme, the TALE-scPvuII fusion protein (top, 60 nM enzyme, 6 nM DNA) shows a higher cleavage activity with an unaddressed substrate (-P-) than the homodimeric TALE-PvuII T46G fusion protein (bottom, 80 nM enzyme, 8 nM DNA). See the appearance of nicked and linearized DNA with AvrBs3-28-L-scPvuII T46G . There is no nicking or cleavage detectable of the unaddressed substrate with AvrBs3-28-L-PvuII T46G . oc, open circle; lin, linearized; sc, supercoiled.
    Figure Legend Snippet: Analysis of the cleavage activity of AvrBs3-PvuII fusion proteins. ( A ) and ( B ) Comparison of the cleavage rates of selected AvrBs3-PvuII fusion proteins (as indicated) under low ionic strength: 76 mM (20 mM Tris-Ac, 50 mM K-Ac, 2 mM Mg-Ac, pH 7.5). In the top row the cleavage of the addressed substrate (T3-6bp-P-6bp-T3) is shown, in the bottom row that of the unaddressed substrate (-P-). All cleavage experiments were done with 8 nM DNA and 8 nM enzyme. ( C ) Comparison of the cleavage rates of an unaddressed substrate by selected AvrBs3-PvuII fusion proteins (as indicated) under physiological ionic strength: 143 mM (20 mM Tris-Ac, 120 mM K-Ac, 1 mM Mg-Ac, pH 7.5). The experiments were done with an excess of enzyme, the TALE-scPvuII fusion protein (top, 60 nM enzyme, 6 nM DNA) shows a higher cleavage activity with an unaddressed substrate (-P-) than the homodimeric TALE-PvuII T46G fusion protein (bottom, 80 nM enzyme, 8 nM DNA). See the appearance of nicked and linearized DNA with AvrBs3-28-L-scPvuII T46G . There is no nicking or cleavage detectable of the unaddressed substrate with AvrBs3-28-L-PvuII T46G . oc, open circle; lin, linearized; sc, supercoiled.

    Techniques Used: Activity Assay

    Analysis of the cleavage activity of AvrBs3-PvuII fusion proteins on AvrBs3 and AvrBs4 substrates. ( A ) Specificity of cleavage analyzed with the T3-6bp-P-6bp-T3 substrate and the T4-6bp-P-6bp-T4 substrate which differ in 11 (8, respectively, considering the degeneracy of the TALE recognition code) out of 19 positions from the AvrBs3 target site. No nicking or cleavage of the AvrBs4 substrate (8 nM) by AvrBs3-28-L-PvuII T46G (8 nM) could be detected. ( B ) Cleavage of a “half-site” substrate by AvrBs3-28-L-PvuII T46G . The “half-site” substrate is a bipartite substrate consisting of an AvrBs3 recognition site and a PvuII recognition site (T3-6bp-P). The sc plasmid (8 nM) with the “half-site” was incubated with an equimolar concentration of AvrBs3-28-L-PvuII T46G (8 nM). The assay was done under physiological ionic strength and in competition with a 32 nM PCR fragment (unP) with one unaddressed PvuII site (-P-). Whereas the “half-site” substrate is cleaved almost to completion, the unaddressed PCR fragment is not cleaved at all. ( C ) The effect of the distance of the AvrBs3 and the PvuII site on the rate of DNA cleavage by various AvrBs3-PvuII fusion proteins. 20 nM radioactively labelled PCR fragments with 2 (T3-2-P-2-T3), 4 (T3-4-P-4-T3), 6 (T3-6-P-6-T3) and 8 (T3-8-P-8-T3) bp between the AvrBs3 and the PvuII site were incubated with 20 nM AvrBs3-28-L-PvuII T46G , AvrBs3-28-PvuII T46G and AvrBs3-L-PvuII T46G for 60 min.
    Figure Legend Snippet: Analysis of the cleavage activity of AvrBs3-PvuII fusion proteins on AvrBs3 and AvrBs4 substrates. ( A ) Specificity of cleavage analyzed with the T3-6bp-P-6bp-T3 substrate and the T4-6bp-P-6bp-T4 substrate which differ in 11 (8, respectively, considering the degeneracy of the TALE recognition code) out of 19 positions from the AvrBs3 target site. No nicking or cleavage of the AvrBs4 substrate (8 nM) by AvrBs3-28-L-PvuII T46G (8 nM) could be detected. ( B ) Cleavage of a “half-site” substrate by AvrBs3-28-L-PvuII T46G . The “half-site” substrate is a bipartite substrate consisting of an AvrBs3 recognition site and a PvuII recognition site (T3-6bp-P). The sc plasmid (8 nM) with the “half-site” was incubated with an equimolar concentration of AvrBs3-28-L-PvuII T46G (8 nM). The assay was done under physiological ionic strength and in competition with a 32 nM PCR fragment (unP) with one unaddressed PvuII site (-P-). Whereas the “half-site” substrate is cleaved almost to completion, the unaddressed PCR fragment is not cleaved at all. ( C ) The effect of the distance of the AvrBs3 and the PvuII site on the rate of DNA cleavage by various AvrBs3-PvuII fusion proteins. 20 nM radioactively labelled PCR fragments with 2 (T3-2-P-2-T3), 4 (T3-4-P-4-T3), 6 (T3-6-P-6-T3) and 8 (T3-8-P-8-T3) bp between the AvrBs3 and the PvuII site were incubated with 20 nM AvrBs3-28-L-PvuII T46G , AvrBs3-28-PvuII T46G and AvrBs3-L-PvuII T46G for 60 min.

    Techniques Used: Activity Assay, Plasmid Preparation, Incubation, Concentration Assay, Polymerase Chain Reaction

    TALE-PvuII fusion proteins. ( A ) Scheme of the architecture of TALE–PvuII fusion proteins. Left: wtPvuII, a homodimer in which the DNA-binding module of a TALE protein is fused via a linker of defined length. Right: scPvuII, a monomeric nuclease in which the DNA-binding module of a TALE protein is fused via a linker of defined length. ( B ) Model of a TALE–wtPvuII fusion protein. The fusion protein is a dimer of identical subunits, each composed of a PvuII subunit and a TALE protein. This model was constructed by aligning the structures of the individual proteins [pdb 1pvi [ 74 ] and pdb 3ugm [ 76 ]] on a DNA composed of the PvuII recognition site and two TALE target sites up- and downstream of the PvuII recognition site, separated by 6 bp. The C-termini of the PvuII subunits and the N-termini of the TALE protein are separated by about 3 nm. This distance must be covered by a peptide linker of suitable length. The image was generated with PyMol.
    Figure Legend Snippet: TALE-PvuII fusion proteins. ( A ) Scheme of the architecture of TALE–PvuII fusion proteins. Left: wtPvuII, a homodimer in which the DNA-binding module of a TALE protein is fused via a linker of defined length. Right: scPvuII, a monomeric nuclease in which the DNA-binding module of a TALE protein is fused via a linker of defined length. ( B ) Model of a TALE–wtPvuII fusion protein. The fusion protein is a dimer of identical subunits, each composed of a PvuII subunit and a TALE protein. This model was constructed by aligning the structures of the individual proteins [pdb 1pvi [ 74 ] and pdb 3ugm [ 76 ]] on a DNA composed of the PvuII recognition site and two TALE target sites up- and downstream of the PvuII recognition site, separated by 6 bp. The C-termini of the PvuII subunits and the N-termini of the TALE protein are separated by about 3 nm. This distance must be covered by a peptide linker of suitable length. The image was generated with PyMol.

    Techniques Used: Binding Assay, Construct, Generated

    Related Articles

    Incubation:

    Article Title: Mapping DNA polymerase errors by single-molecule sequencing
    Article Snippet: A control 20-mer oligonucleotide (IDT: 5′-CTA CCT GTG GAC GGC TGC GA-3, 99.9% purity by mass spectrometry) was ligated into the M13mp7(L2) plasmid in a similar manner to create the control substrate. .. Generation of replication product For each reaction involving double-stranded template DNA, 1–10 ng of template was digested using 1U of either BsmI (pBeloBac11), BseRI and BspHI (pOPINP) or PvuII-HF (M13mp7(L2)) (New England Biolabs) with incubation for 10 min at 37°C. ..

    Ethanol Precipitation:

    Article Title: Recombination regulator PRDM9 influences the instability of its own coding sequence in humans
    Article Snippet: .. Aliquots of 25 μg DNA were digested with 240 U HpaI plus 240 U PvuII-HF (New England BioLabs) in 500 μL NEB4 buffer at 37 °C for 2.5 h. Digested DNA was recovered by ethanol precipitation, dissolved in 5 mM Tris-HCl, pH 7.5, and 15 μg DNA was loaded into a 2.5-cm-wide slot in a 40-cm-long 0.9% (wt/vol) SeaKem HGT (Lonza) agarose gel in 0.5 × tris-borate EDTA buffer containing 0.5 μg/mL ethidium bromide. .. Adjacent size markers were 4 μg λ DNA × HindIII plus 2 μg ϕX174 DNA × HaeIII, together with 2 μg of ladder ML ( ) consisting of PCR products matched in size and GC content to HpaI–PvuII fragments encoding PRDM9 ZnF arrays with 11–17 repeats.

    Agarose Gel Electrophoresis:

    Article Title: Recombination regulator PRDM9 influences the instability of its own coding sequence in humans
    Article Snippet: .. Aliquots of 25 μg DNA were digested with 240 U HpaI plus 240 U PvuII-HF (New England BioLabs) in 500 μL NEB4 buffer at 37 °C for 2.5 h. Digested DNA was recovered by ethanol precipitation, dissolved in 5 mM Tris-HCl, pH 7.5, and 15 μg DNA was loaded into a 2.5-cm-wide slot in a 40-cm-long 0.9% (wt/vol) SeaKem HGT (Lonza) agarose gel in 0.5 × tris-borate EDTA buffer containing 0.5 μg/mL ethidium bromide. .. Adjacent size markers were 4 μg λ DNA × HindIII plus 2 μg ϕX174 DNA × HaeIII, together with 2 μg of ladder ML ( ) consisting of PCR products matched in size and GC content to HpaI–PvuII fragments encoding PRDM9 ZnF arrays with 11–17 repeats.

    Plasmid Preparation:

    Article Title: Chemical rescue of mutant proteins in living cells by naturally occurring small molecules
    Article Snippet: Absorbance at 615 nm was measured with a BioTek Cytation 3 plate reader. .. Plasmid was isolated from the remainder of the original 5-mL culture of the R599A culture using standard methods and digested with PvuI-HF (New England Biolabs #R3151) according to manufacturer’s instructions. .. Digested DNA was separated by 1% agarose gel electrophoresis in Tris-acetate EDTA buffer and visualized with ethidium bromide.

    Isolation:

    Article Title: Chemical rescue of mutant proteins in living cells by naturally occurring small molecules
    Article Snippet: Absorbance at 615 nm was measured with a BioTek Cytation 3 plate reader. .. Plasmid was isolated from the remainder of the original 5-mL culture of the R599A culture using standard methods and digested with PvuI-HF (New England Biolabs #R3151) according to manufacturer’s instructions. .. Digested DNA was separated by 1% agarose gel electrophoresis in Tris-acetate EDTA buffer and visualized with ethidium bromide.

    Purification:

    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module
    Article Snippet: The region encompassing the PvuII-binding site on the target plasmid was amplified by PCR using 10 ng of total DNA as a template, along with 0.5 μM of each primer (#1535 5′-ATCCACGCTGTTTTGACCTC and #1536 5′- ACATGAACTGAGGGGACAGG), 200 µM dNTPs, and 1 U of Phire Hot Start DNA Polymerase (Fisher Scientific) in 1× reaction buffer for 25 cycles. .. Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB). .. For the T7E1 assay, DNA was denatured at 95°C for 5 min, slowly cooled down to room temperature to allow for formation of heteroduplex DNA, treated with 5 U of T7E1 for 20 min at 37°C and fragments were separated on a 2% agarose gel.

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting
    Article Snippet: The region of 517 bp surrounding the PvuII site was amplified by PCR using 50 ng of total DNA as template, along with 0.2 µM of each primer (5’-gtatcgtccattccgacagcatc and 5’- ctcgccgaaaatgacccagag ), 200 mM dNTPs, and 1 U of Phusion high fidelity DNA polymerase for 30 cycles. .. PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs). .. Cytotoxicity assay in HEK293T cells Nuclease-associated toxicity was determined basically as previously described [ ].

    Polymerase Chain Reaction:

    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module
    Article Snippet: The region encompassing the PvuII-binding site on the target plasmid was amplified by PCR using 10 ng of total DNA as a template, along with 0.5 μM of each primer (#1535 5′-ATCCACGCTGTTTTGACCTC and #1536 5′- ACATGAACTGAGGGGACAGG), 200 µM dNTPs, and 1 U of Phire Hot Start DNA Polymerase (Fisher Scientific) in 1× reaction buffer for 25 cycles. .. Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB). .. For the T7E1 assay, DNA was denatured at 95°C for 5 min, slowly cooled down to room temperature to allow for formation of heteroduplex DNA, treated with 5 U of T7E1 for 20 min at 37°C and fragments were separated on a 2% agarose gel.

    Article Title: Type III CRISPR-Cas systems can provide redundancy to counteract viral escape from type I systems
    Article Snippet: Isopropanol (950 μL) was added and the plasmid DNA was pelleted by centrifugation (16,000 x g, 20 min, 4°C), washed twice in 80% ethanol, and resuspended in 200 μL 1x NEB Cutsmart Buffer. .. Samples were treated with 50 μg/mL RNase A (Life Technologies) at 37°C for 30 min, linearized with PvuII-HF (NEB) at 37°C for 60 min (to aid denaturation during PCR), and treated with 200 μg/mL Protease K at 50°C for 30 min. .. Finally, each digest was purified using a Zymo gDNA Clean and Concentrator column.

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting
    Article Snippet: The region of 517 bp surrounding the PvuII site was amplified by PCR using 50 ng of total DNA as template, along with 0.2 µM of each primer (5’-gtatcgtccattccgacagcatc and 5’- ctcgccgaaaatgacccagag ), 200 mM dNTPs, and 1 U of Phusion high fidelity DNA polymerase for 30 cycles. .. PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs). .. Cytotoxicity assay in HEK293T cells Nuclease-associated toxicity was determined basically as previously described [ ].

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    New England Biolabs pvuii hf
    De novo mutation at PRDM9 . ( A ) Restriction sites used for size-enriching ZnF repeat array mutants, plus primers (blue arrows) for single molecule amplification of the array (boxes). Using <t>HpaI</t> and <t>PvuII</t> ensured that any residual partial digest products
    Pvuii Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pvuii hf/product/New England Biolabs
    Average 96 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pvuii hf - by Bioz Stars, 2021-06
    96/100 stars
      Buy from Supplier

    Image Search Results


    De novo mutation at PRDM9 . ( A ) Restriction sites used for size-enriching ZnF repeat array mutants, plus primers (blue arrows) for single molecule amplification of the array (boxes). Using HpaI and PvuII ensured that any residual partial digest products

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Recombination regulator PRDM9 influences the instability of its own coding sequence in humans

    doi: 10.1073/pnas.1220813110

    Figure Lengend Snippet: De novo mutation at PRDM9 . ( A ) Restriction sites used for size-enriching ZnF repeat array mutants, plus primers (blue arrows) for single molecule amplification of the array (boxes). Using HpaI and PvuII ensured that any residual partial digest products

    Article Snippet: Aliquots of 25 μg DNA were digested with 240 U HpaI plus 240 U PvuII-HF (New England BioLabs) in 500 μL NEB4 buffer at 37 °C for 2.5 h. Digested DNA was recovered by ethanol precipitation, dissolved in 5 mM Tris-HCl, pH 7.5, and 15 μg DNA was loaded into a 2.5-cm-wide slot in a 40-cm-long 0.9% (wt/vol) SeaKem HGT (Lonza) agarose gel in 0.5 × tris-borate EDTA buffer containing 0.5 μg/mL ethidium bromide.

    Techniques: Mutagenesis, Amplification

    Restriction profile of phage DNA using PvuII . This gel documents 12 restricted phages in which three restriction profiles could be distinguished. Slot 1 and 14 molecular weight marker, slot 2, 3, 7, 8, 9 restriction profile 1 (RP1), slot 4, 5, 6, 10, 11, 13 restriction profile 2 (RP2), slot 12 restriction profile 3 (RP3).

    Journal: Antibiotics

    Article Title: Antimicrobial Resistance in Escherichia coli and Resistance Genes in Coliphages from a Small Animal Clinic and in a Patient Dog with Chronic Urinary Tract Infection

    doi: 10.3390/antibiotics9100652

    Figure Lengend Snippet: Restriction profile of phage DNA using PvuII . This gel documents 12 restricted phages in which three restriction profiles could be distinguished. Slot 1 and 14 molecular weight marker, slot 2, 3, 7, 8, 9 restriction profile 1 (RP1), slot 4, 5, 6, 10, 11, 13 restriction profile 2 (RP2), slot 12 restriction profile 3 (RP3).

    Article Snippet: Restriction was performed with 500 ng phage DNA using 20 U PvuII-HF® (20,000 units/mL in 1X CutSmart® Buffer NEB #R3151, New England Biolabs) as recommended by the producer.

    Techniques: Molecular Weight, Marker

    Kinetic analysis of the ZF-PvuII fusion enzymes cleaving an addressed substrate [black triangle; 250 bp PCR product containing either the tripartite (Z12P12Z) or bipartite (P12Z) target sites] and an unaddressed substrate [open diamond; 450 bp PCR product containing a single PvuII site (P)] in competition in a near equimolar stoichiometry (20 nM addressed substrate/20 nM unaddressed substrate/18 nM enzyme). The gel electrophoretic analysis of samples withdrawn from the incubation mixture at defined time intervals is shown as an insert of the activity versus time profile. ( A ) Preferential DNA cleavage (addressed versus unaddressed) by ZF-PvuII G46 (Z12P12Z versus P). ( B ) Preferential cleavage by ZF-scPvuII G46 (P12Z versus P). ( C ) Preferential DNA cleavage by ZF-PvuII G46/F94 (Z12P12Z versus P). ( D ) Preferential DNA cleavage by ZF-PvuII G46/A83/F94 (Z12P12Z versus P).

    Journal: Nucleic Acids Research

    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module

    doi: 10.1093/nar/gkr1112

    Figure Lengend Snippet: Kinetic analysis of the ZF-PvuII fusion enzymes cleaving an addressed substrate [black triangle; 250 bp PCR product containing either the tripartite (Z12P12Z) or bipartite (P12Z) target sites] and an unaddressed substrate [open diamond; 450 bp PCR product containing a single PvuII site (P)] in competition in a near equimolar stoichiometry (20 nM addressed substrate/20 nM unaddressed substrate/18 nM enzyme). The gel electrophoretic analysis of samples withdrawn from the incubation mixture at defined time intervals is shown as an insert of the activity versus time profile. ( A ) Preferential DNA cleavage (addressed versus unaddressed) by ZF-PvuII G46 (Z12P12Z versus P). ( B ) Preferential cleavage by ZF-scPvuII G46 (P12Z versus P). ( C ) Preferential DNA cleavage by ZF-PvuII G46/F94 (Z12P12Z versus P). ( D ) Preferential DNA cleavage by ZF-PvuII G46/A83/F94 (Z12P12Z versus P).

    Article Snippet: Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB).

    Techniques: Polymerase Chain Reaction, Incubation, Activity Assay

    ZF-PvuII G46/A83/F94 mediated DNA cleavage in mammalian cells. ( A ) Schematic of the ZF-PvuII G46/A83/F94 target sites. The addressed Z12P12Z target site harbors an inverted repeat of ZF-binding sites separated by 12-bp spacer sequences that flank a central PvuII site. The unaddressed target site 21P21 is structured identically but lacks the ZF-binding sites. ( B ) Expression levels of ZF-PvuII G46/A83/F94 and PvuII G46/A83/F94. Cell lysates of transfected HEK293T cells were probed with antibodies against HA-tag or EGFP. ( C and D ) Cleavage activity in cellula . Cleavage of target plasmids in transfected HEK293T cells was assessed by detecting nuclease-induced mutations due to imperfect repair of DNA DSBs by NHEJ. PCR fragments encompassing the target site were either subjected to digestion with the mismatch-sensitive T7 endonuclease 1 (C) or PvuII (D).

    Journal: Nucleic Acids Research

    Article Title: A novel zinc-finger nuclease platform with a sequence-specific cleavage module

    doi: 10.1093/nar/gkr1112

    Figure Lengend Snippet: ZF-PvuII G46/A83/F94 mediated DNA cleavage in mammalian cells. ( A ) Schematic of the ZF-PvuII G46/A83/F94 target sites. The addressed Z12P12Z target site harbors an inverted repeat of ZF-binding sites separated by 12-bp spacer sequences that flank a central PvuII site. The unaddressed target site 21P21 is structured identically but lacks the ZF-binding sites. ( B ) Expression levels of ZF-PvuII G46/A83/F94 and PvuII G46/A83/F94. Cell lysates of transfected HEK293T cells were probed with antibodies against HA-tag or EGFP. ( C and D ) Cleavage activity in cellula . Cleavage of target plasmids in transfected HEK293T cells was assessed by detecting nuclease-induced mutations due to imperfect repair of DNA DSBs by NHEJ. PCR fragments encompassing the target site were either subjected to digestion with the mismatch-sensitive T7 endonuclease 1 (C) or PvuII (D).

    Article Snippet: Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) and then digested with either PvuII-HF or the mismatch-sensitive T7 endonuclease I (T7E1; NEB).

    Techniques: Binding Assay, Expressing, Transfection, Activity Assay, Non-Homologous End Joining, Polymerase Chain Reaction

    Engineered highly specific endonucleases that can be used for gene targeting by introducing a double-strand break into a complex genome and thereby stimulating homologous recombination. With the exception of engineered homing endonucleases (“meganucleases”) in which the function of DNA binding and DNA cleavage is present in the same polypeptide chain [ 77 ], the other engineered nucleases consist of separate DNA-binding (green) and DNA-cleavage (blue) modules. Zinc finger nucleases and TALE nucleases usually have the non-specific cleavage domain of the restriction endonuclease FokI as DNA-cleavage module, but as shown recently and in the present paper the restriction endonuclease PvuII can also be used for this purpose [ 54 ]. PvuII has also been employed in TFO-linked nucleases [ 49 ] and in protein fusions (with catalytically inactive I-SceI) [ 53 ] as DNA-cleavage module. Zinc finger nucleases, TALE nucleases and TFO-linked nucleases are programmable, as are the RNA-mediated nucleases [ 36 ] [modified after [ 3 ]] .

    Journal: PLoS ONE

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting

    doi: 10.1371/journal.pone.0082539

    Figure Lengend Snippet: Engineered highly specific endonucleases that can be used for gene targeting by introducing a double-strand break into a complex genome and thereby stimulating homologous recombination. With the exception of engineered homing endonucleases (“meganucleases”) in which the function of DNA binding and DNA cleavage is present in the same polypeptide chain [ 77 ], the other engineered nucleases consist of separate DNA-binding (green) and DNA-cleavage (blue) modules. Zinc finger nucleases and TALE nucleases usually have the non-specific cleavage domain of the restriction endonuclease FokI as DNA-cleavage module, but as shown recently and in the present paper the restriction endonuclease PvuII can also be used for this purpose [ 54 ]. PvuII has also been employed in TFO-linked nucleases [ 49 ] and in protein fusions (with catalytically inactive I-SceI) [ 53 ] as DNA-cleavage module. Zinc finger nucleases, TALE nucleases and TFO-linked nucleases are programmable, as are the RNA-mediated nucleases [ 36 ] [modified after [ 3 ]] .

    Article Snippet: PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs).

    Techniques: Homologous Recombination, Binding Assay, Zinc-Fingers, Modification

    Analysis of competition cleavage experiments with AvrBs3-PvuII fusion proteins. ( A ) Competition cleavage experiments with AvrBs3-28-L-PvuII T46G under physiological ionic strength. Shown is the cleavage pattern with supercoiled plasmid DNA with an addressed site (8 nM) in competition with a PCR fragment (unP) with an unaddressed site (32 nM). The experiment was carried out with a variable excess of enzyme over plasmid substrate (0.25 to 40-fold). The enzyme shows complete cleavage of the addressed substrate but no cleavage of the unaddressed substrate, even in an overnight incubation with a 40-fold excess of enzyme over the addressed plasmid substrate (8 nM) and 10-fold excess over the unaddressed PCR substrate (32 nM). The brackets indicate the positions where one would expect the products of cleavage of the unaddressed PCR substrate. oc, open circle; lin, linearized; sc, supercoiled. ( B ) Quantitative determination of the preference of AvrBs3-28-L-PvuII T46G for an addressed (T3-6bp-P-6bp-T3) over an unaddressed site (-P-). The reactions were performed in triplicate under physiological conditions with 20 nM enzyme and 20 nM addressed substrate (squares) and unaddressed substrate (circles), both PCR fragments were radioactively labelled with [α 32 P]dATP. The insert shows the primary data: the electrophoretic analysis of the cleavage reaction products using an Instant Imager. From the fit, a cleavage preference of > 34,000-fold was determined.

    Journal: PLoS ONE

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting

    doi: 10.1371/journal.pone.0082539

    Figure Lengend Snippet: Analysis of competition cleavage experiments with AvrBs3-PvuII fusion proteins. ( A ) Competition cleavage experiments with AvrBs3-28-L-PvuII T46G under physiological ionic strength. Shown is the cleavage pattern with supercoiled plasmid DNA with an addressed site (8 nM) in competition with a PCR fragment (unP) with an unaddressed site (32 nM). The experiment was carried out with a variable excess of enzyme over plasmid substrate (0.25 to 40-fold). The enzyme shows complete cleavage of the addressed substrate but no cleavage of the unaddressed substrate, even in an overnight incubation with a 40-fold excess of enzyme over the addressed plasmid substrate (8 nM) and 10-fold excess over the unaddressed PCR substrate (32 nM). The brackets indicate the positions where one would expect the products of cleavage of the unaddressed PCR substrate. oc, open circle; lin, linearized; sc, supercoiled. ( B ) Quantitative determination of the preference of AvrBs3-28-L-PvuII T46G for an addressed (T3-6bp-P-6bp-T3) over an unaddressed site (-P-). The reactions were performed in triplicate under physiological conditions with 20 nM enzyme and 20 nM addressed substrate (squares) and unaddressed substrate (circles), both PCR fragments were radioactively labelled with [α 32 P]dATP. The insert shows the primary data: the electrophoretic analysis of the cleavage reaction products using an Instant Imager. From the fit, a cleavage preference of > 34,000-fold was determined.

    Article Snippet: PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs).

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Incubation

    Activity and toxicity of TALE-PvuII fusion proteins in human cells. ( A ) PCR was performed with the plasmid from the HEK293 cells resulting in a DNA fragment of 517 bp. * indicates the cleavage site of PvuII. ( B ) Analysis of the PCR product (14.5 nM) after digestion with 20 U of PvuII for 1 h. A cleavage-resistant band indicates the loss of the PvuII site by NHEJ and confirms the activity of the TALE-PvuII fusion proteins. ( C ) Cell toxicity of the PvuII-based TALENs. After co-transfection of a mCherry expression plasmid, cell survival rate was calculated as the decrease in the number of mCherry-positive cells from day 2 to day 5 by flow cytometry, normalized to cells transfected with an I-SceI expression vector. * Statistically significant differences in toxicities between I-SceI and TALE-PvuII fusion proteins are indicated (P-values) .

    Journal: PLoS ONE

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting

    doi: 10.1371/journal.pone.0082539

    Figure Lengend Snippet: Activity and toxicity of TALE-PvuII fusion proteins in human cells. ( A ) PCR was performed with the plasmid from the HEK293 cells resulting in a DNA fragment of 517 bp. * indicates the cleavage site of PvuII. ( B ) Analysis of the PCR product (14.5 nM) after digestion with 20 U of PvuII for 1 h. A cleavage-resistant band indicates the loss of the PvuII site by NHEJ and confirms the activity of the TALE-PvuII fusion proteins. ( C ) Cell toxicity of the PvuII-based TALENs. After co-transfection of a mCherry expression plasmid, cell survival rate was calculated as the decrease in the number of mCherry-positive cells from day 2 to day 5 by flow cytometry, normalized to cells transfected with an I-SceI expression vector. * Statistically significant differences in toxicities between I-SceI and TALE-PvuII fusion proteins are indicated (P-values) .

    Article Snippet: PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs).

    Techniques: Activity Assay, Polymerase Chain Reaction, Plasmid Preparation, Non-Homologous End Joining, TALENs, Cotransfection, Expressing, Flow Cytometry, Cytometry, Transfection

    Analysis of the cleavage activity of AvrBs3-PvuII fusion proteins. ( A ) and ( B ) Comparison of the cleavage rates of selected AvrBs3-PvuII fusion proteins (as indicated) under low ionic strength: 76 mM (20 mM Tris-Ac, 50 mM K-Ac, 2 mM Mg-Ac, pH 7.5). In the top row the cleavage of the addressed substrate (T3-6bp-P-6bp-T3) is shown, in the bottom row that of the unaddressed substrate (-P-). All cleavage experiments were done with 8 nM DNA and 8 nM enzyme. ( C ) Comparison of the cleavage rates of an unaddressed substrate by selected AvrBs3-PvuII fusion proteins (as indicated) under physiological ionic strength: 143 mM (20 mM Tris-Ac, 120 mM K-Ac, 1 mM Mg-Ac, pH 7.5). The experiments were done with an excess of enzyme, the TALE-scPvuII fusion protein (top, 60 nM enzyme, 6 nM DNA) shows a higher cleavage activity with an unaddressed substrate (-P-) than the homodimeric TALE-PvuII T46G fusion protein (bottom, 80 nM enzyme, 8 nM DNA). See the appearance of nicked and linearized DNA with AvrBs3-28-L-scPvuII T46G . There is no nicking or cleavage detectable of the unaddressed substrate with AvrBs3-28-L-PvuII T46G . oc, open circle; lin, linearized; sc, supercoiled.

    Journal: PLoS ONE

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting

    doi: 10.1371/journal.pone.0082539

    Figure Lengend Snippet: Analysis of the cleavage activity of AvrBs3-PvuII fusion proteins. ( A ) and ( B ) Comparison of the cleavage rates of selected AvrBs3-PvuII fusion proteins (as indicated) under low ionic strength: 76 mM (20 mM Tris-Ac, 50 mM K-Ac, 2 mM Mg-Ac, pH 7.5). In the top row the cleavage of the addressed substrate (T3-6bp-P-6bp-T3) is shown, in the bottom row that of the unaddressed substrate (-P-). All cleavage experiments were done with 8 nM DNA and 8 nM enzyme. ( C ) Comparison of the cleavage rates of an unaddressed substrate by selected AvrBs3-PvuII fusion proteins (as indicated) under physiological ionic strength: 143 mM (20 mM Tris-Ac, 120 mM K-Ac, 1 mM Mg-Ac, pH 7.5). The experiments were done with an excess of enzyme, the TALE-scPvuII fusion protein (top, 60 nM enzyme, 6 nM DNA) shows a higher cleavage activity with an unaddressed substrate (-P-) than the homodimeric TALE-PvuII T46G fusion protein (bottom, 80 nM enzyme, 8 nM DNA). See the appearance of nicked and linearized DNA with AvrBs3-28-L-scPvuII T46G . There is no nicking or cleavage detectable of the unaddressed substrate with AvrBs3-28-L-PvuII T46G . oc, open circle; lin, linearized; sc, supercoiled.

    Article Snippet: PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs).

    Techniques: Activity Assay

    Analysis of the cleavage activity of AvrBs3-PvuII fusion proteins on AvrBs3 and AvrBs4 substrates. ( A ) Specificity of cleavage analyzed with the T3-6bp-P-6bp-T3 substrate and the T4-6bp-P-6bp-T4 substrate which differ in 11 (8, respectively, considering the degeneracy of the TALE recognition code) out of 19 positions from the AvrBs3 target site. No nicking or cleavage of the AvrBs4 substrate (8 nM) by AvrBs3-28-L-PvuII T46G (8 nM) could be detected. ( B ) Cleavage of a “half-site” substrate by AvrBs3-28-L-PvuII T46G . The “half-site” substrate is a bipartite substrate consisting of an AvrBs3 recognition site and a PvuII recognition site (T3-6bp-P). The sc plasmid (8 nM) with the “half-site” was incubated with an equimolar concentration of AvrBs3-28-L-PvuII T46G (8 nM). The assay was done under physiological ionic strength and in competition with a 32 nM PCR fragment (unP) with one unaddressed PvuII site (-P-). Whereas the “half-site” substrate is cleaved almost to completion, the unaddressed PCR fragment is not cleaved at all. ( C ) The effect of the distance of the AvrBs3 and the PvuII site on the rate of DNA cleavage by various AvrBs3-PvuII fusion proteins. 20 nM radioactively labelled PCR fragments with 2 (T3-2-P-2-T3), 4 (T3-4-P-4-T3), 6 (T3-6-P-6-T3) and 8 (T3-8-P-8-T3) bp between the AvrBs3 and the PvuII site were incubated with 20 nM AvrBs3-28-L-PvuII T46G , AvrBs3-28-PvuII T46G and AvrBs3-L-PvuII T46G for 60 min.

    Journal: PLoS ONE

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting

    doi: 10.1371/journal.pone.0082539

    Figure Lengend Snippet: Analysis of the cleavage activity of AvrBs3-PvuII fusion proteins on AvrBs3 and AvrBs4 substrates. ( A ) Specificity of cleavage analyzed with the T3-6bp-P-6bp-T3 substrate and the T4-6bp-P-6bp-T4 substrate which differ in 11 (8, respectively, considering the degeneracy of the TALE recognition code) out of 19 positions from the AvrBs3 target site. No nicking or cleavage of the AvrBs4 substrate (8 nM) by AvrBs3-28-L-PvuII T46G (8 nM) could be detected. ( B ) Cleavage of a “half-site” substrate by AvrBs3-28-L-PvuII T46G . The “half-site” substrate is a bipartite substrate consisting of an AvrBs3 recognition site and a PvuII recognition site (T3-6bp-P). The sc plasmid (8 nM) with the “half-site” was incubated with an equimolar concentration of AvrBs3-28-L-PvuII T46G (8 nM). The assay was done under physiological ionic strength and in competition with a 32 nM PCR fragment (unP) with one unaddressed PvuII site (-P-). Whereas the “half-site” substrate is cleaved almost to completion, the unaddressed PCR fragment is not cleaved at all. ( C ) The effect of the distance of the AvrBs3 and the PvuII site on the rate of DNA cleavage by various AvrBs3-PvuII fusion proteins. 20 nM radioactively labelled PCR fragments with 2 (T3-2-P-2-T3), 4 (T3-4-P-4-T3), 6 (T3-6-P-6-T3) and 8 (T3-8-P-8-T3) bp between the AvrBs3 and the PvuII site were incubated with 20 nM AvrBs3-28-L-PvuII T46G , AvrBs3-28-PvuII T46G and AvrBs3-L-PvuII T46G for 60 min.

    Article Snippet: PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs).

    Techniques: Activity Assay, Plasmid Preparation, Incubation, Concentration Assay, Polymerase Chain Reaction

    TALE-PvuII fusion proteins. ( A ) Scheme of the architecture of TALE–PvuII fusion proteins. Left: wtPvuII, a homodimer in which the DNA-binding module of a TALE protein is fused via a linker of defined length. Right: scPvuII, a monomeric nuclease in which the DNA-binding module of a TALE protein is fused via a linker of defined length. ( B ) Model of a TALE–wtPvuII fusion protein. The fusion protein is a dimer of identical subunits, each composed of a PvuII subunit and a TALE protein. This model was constructed by aligning the structures of the individual proteins [pdb 1pvi [ 74 ] and pdb 3ugm [ 76 ]] on a DNA composed of the PvuII recognition site and two TALE target sites up- and downstream of the PvuII recognition site, separated by 6 bp. The C-termini of the PvuII subunits and the N-termini of the TALE protein are separated by about 3 nm. This distance must be covered by a peptide linker of suitable length. The image was generated with PyMol.

    Journal: PLoS ONE

    Article Title: TALE-PvuII Fusion Proteins - Novel Tools for Gene Targeting

    doi: 10.1371/journal.pone.0082539

    Figure Lengend Snippet: TALE-PvuII fusion proteins. ( A ) Scheme of the architecture of TALE–PvuII fusion proteins. Left: wtPvuII, a homodimer in which the DNA-binding module of a TALE protein is fused via a linker of defined length. Right: scPvuII, a monomeric nuclease in which the DNA-binding module of a TALE protein is fused via a linker of defined length. ( B ) Model of a TALE–wtPvuII fusion protein. The fusion protein is a dimer of identical subunits, each composed of a PvuII subunit and a TALE protein. This model was constructed by aligning the structures of the individual proteins [pdb 1pvi [ 74 ] and pdb 3ugm [ 76 ]] on a DNA composed of the PvuII recognition site and two TALE target sites up- and downstream of the PvuII recognition site, separated by 6 bp. The C-termini of the PvuII subunits and the N-termini of the TALE protein are separated by about 3 nm. This distance must be covered by a peptide linker of suitable length. The image was generated with PyMol.

    Article Snippet: PCR amplicons were cleaned up using the QIAquick PCR Purification Kit (Qiagen) and 100 ng DNA was subjected to digestion with 20 U of PvuII-HF (New England BioLabs).

    Techniques: Binding Assay, Construct, Generated