amplicons  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    SalI HF
    Description:
    SalI HF 10 000 units
    Catalog Number:
    r3138l
    Price:
    261
    Size:
    10 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs amplicons
    SalI HF
    SalI HF 10 000 units
    https://www.bioz.com/result/amplicons/product/New England Biolabs
    Average 95 stars, based on 70 article reviews
    Price from $9.99 to $1999.99
    amplicons - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Efficient single-copy HDR by 5’ modified long dsDNA donors
    Article Snippet: The dnmt1 gfp plasmid was cloned with homology flanks (5’ HF 402 bp, primers dnmt1 5’HF f/dnmt1 5’HF r; 3’ HF 405 bp, dnmt1 3’HF f/dnmt1 3’HF r) that were PCR amplified with Q5 polymerase (New England Biolabs, 30 cycles) from wild-type medaka genomic DNA. mgfp-flexible linker was amplified with primers mgfpf/mgfpr. .. The respective restriction enzyme was used to digest the amplicons (5’HF: SalI HF (New England Biolabs), AgeI HF (New England Biolabs); mgfp-flexible linker : AgeI HF (New England Biolabs), SpeI HF (New England Biolabs); 3’HF: SpeI HF (New England Biolabs), NotI HF (New England Biolabs)) followed by gel purification (Analytik Jena) and ligation into pCS2+ ( ) (digested with SalI HF (New England Biolabs), NotI HF (New England Biolabs)).

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were contransformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified before experiments.

    Article Title: The distribution of fitness effects among synonymous mutations in a gene under directional selection
    Article Snippet: .. DNA fragments were digested with SalI-HF and XbaI and cloned into a pUC19 vector using T4 DNA Ligase (NEB). .. Inserted DNA fragments were sequenced using Sanger sequencing to identify possible transcriptional start sites in gtsA and gtsB .

    Article Title: Escherichia coli Pyruvate Dehydrogenase Complex Is an Important Component of CXCL10-Mediated Antimicrobial Activity
    Article Snippet: The aceE amplification products were doubly digested with SphI-HF and SalI-HF (New England BioLabs, Ipswich, MA, USA), purified, and ligated into pBR322 that had also been digested with SphI-HF and SalI-HF. .. After the pUVA411 cloning site was sequenced to verify appropriate aceE insertion, pUVA411 and pBR322 were individually transformed into electrocompetent E. coli ΔaceE and parent strain bacteria as described above.

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: Paragraph title: Minimal Library Cloning ... The plasmid backbone, pLibacceptorV2 was digested using SbfI-HF and SalI-HF with the addition of rSAP (NEB #M0371S).

    Centrifugation:

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: Therefore, 15 μg of the mammalian STARRseq plasmid (a kind gift of A.Stark) ( ) were digested with AgeI-HF and SalI-HF (NEB) for 8h at 37°C, column purified (Nucleospin purification columns, 740609250, Machery-Nagel), eluted in 30 μl elution buffer and used as a vector in a Gibson reaction, using 2 μL of digested plasmid, 5 μL purified PCR product, 3 μL H20 and 10 μL of a home-made Gibson reaction (100mM Tris-HCl, 10mM MgCl2, 0.2 mM dNTP (each), 0.5U Phusion DNA polymerase (NEB), 0.16U 5′ T5 exonuclease (Epicenter), 2 Gibson reactions per library. .. After incubation at 50°C for 1 hour, Gibson reaction were pooled and precipitated by addition of 1 μL Glycogen (20 μg/μl, Roche, 1090139300), 5 μL NaOAc (3M) and 125 μL ice-cold 100% ethanol, incubation at −20°C for 1 hour and centrifugation for 1 hour at 13200 rpm at 4°C, followed by a final wash in 70% ethanol.

    Amplification:

    Article Title: Efficient single-copy HDR by 5’ modified long dsDNA donors
    Article Snippet: The dnmt1 gfp plasmid was cloned with homology flanks (5’ HF 402 bp, primers dnmt1 5’HF f/dnmt1 5’HF r; 3’ HF 405 bp, dnmt1 3’HF f/dnmt1 3’HF r) that were PCR amplified with Q5 polymerase (New England Biolabs, 30 cycles) from wild-type medaka genomic DNA. mgfp-flexible linker was amplified with primers mgfpf/mgfpr. .. The respective restriction enzyme was used to digest the amplicons (5’HF: SalI HF (New England Biolabs), AgeI HF (New England Biolabs); mgfp-flexible linker : AgeI HF (New England Biolabs), SpeI HF (New England Biolabs); 3’HF: SpeI HF (New England Biolabs), NotI HF (New England Biolabs)) followed by gel purification (Analytik Jena) and ligation into pCS2+ ( ) (digested with SalI HF (New England Biolabs), NotI HF (New England Biolabs)).

    Article Title: CRISPR-mediated gene silencing reveals involvement of the archaeal S-layer in cell division and virus infection
    Article Snippet: This region was amplified (DNA extracted from S. islandicus M.16.4 obtained from the Rachel Whitaker Laboratory) using primers SlaBM164_FW and SlaBM164_SalI_RV, thereby adding a Sal I restriction site to its 3′-end (Supplementary Table ). .. The thereby assembled complementation cassette was gel-purified, verified by sequencing and further cleaved by Eag I-HF (NEB) and SalI-HF (NEB) following manual’s instructions.

    Article Title: Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases
    Article Snippet: The bound fragments (the 5´- and 3´-fragments of the amplified ds cDNAs carrying a terminal biotin) were thoroughly washed and their ends repaired using the NEBNext End Repair system (New England Biolabs). .. A SalI digestion using SalI HF (New England Biolabs) was carried out to cut, and thus to release, the 3´-fragments.

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: The fragment before and containing the H2 was amplified with the pCTFwd Recomb and appropriate PreH2 primers, and the fragment after and also containing the H2 was amplified using the pcTRev Recomb and proper PostH2 primers (Primer sequences in Supplementary Table 1). .. The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs).

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: After PCR amplification (cycle conditions: 98° 2 min, (98°C 10 s, 62°C 30 s, 72°C 30 s) x 15, 72°C 5 min, 4°C hold), PCR reactions were pooled, purified using AMPure XP beads (1.8x), eluted in 30 μL 0.1xTE and used for Gibson assembly. .. Therefore, 15 μg of the mammalian STARRseq plasmid (a kind gift of A.Stark) ( ) were digested with AgeI-HF and SalI-HF (NEB) for 8h at 37°C, column purified (Nucleospin purification columns, 740609250, Machery-Nagel), eluted in 30 μl elution buffer and used as a vector in a Gibson reaction, using 2 μL of digested plasmid, 5 μL purified PCR product, 3 μL H20 and 10 μL of a home-made Gibson reaction (100mM Tris-HCl, 10mM MgCl2, 0.2 mM dNTP (each), 0.5U Phusion DNA polymerase (NEB), 0.16U 5′ T5 exonuclease (Epicenter), 2 Gibson reactions per library.

    Article Title: The distribution of fitness effects among synonymous mutations in a gene under directional selection
    Article Snippet: 2nd round amplification products were run on 2% agarose gel and expected bands (150–400 base pairs) were excised and purified using Qiaquick Gel Extraction Kit (Qiagen). .. DNA fragments were digested with SalI-HF and XbaI and cloned into a pUC19 vector using T4 DNA Ligase (NEB).

    Article Title: Escherichia coli Pyruvate Dehydrogenase Complex Is an Important Component of CXCL10-Mediated Antimicrobial Activity
    Article Snippet: .. The aceE amplification products were doubly digested with SphI-HF and SalI-HF (New England BioLabs, Ipswich, MA, USA), purified, and ligated into pBR322 that had also been digested with SphI-HF and SalI-HF. .. The prepared vector/aceE insert was transformed into Alpha-select E. coli (Bioline, Taunton, MA, USA) for propagation.

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: For barcoding, 1 ng of this eluate was amplified for 10 cycles using primers GU72 and GU73. .. The plasmid backbone, pLibacceptorV2 was digested using SbfI-HF and SalI-HF with the addition of rSAP (NEB #M0371S).

    Article Title: Merkel Cell Polyomavirus and Two Novel Polyomaviruses Are Chronically Shed from Human Skin
    Article Snippet: The purified DNA was digested with NotI or SalI-HF (NEB) and Plasmid Safe (exonuclease V, Epicentre) then ethanol precipitated. .. The pelleted DNA was redissolved and amplified using an Illustra TempliPhi RCA kit (GE Healthcare).

    Construct:

    Article Title: CRISPR-mediated gene silencing reveals involvement of the archaeal S-layer in cell division and virus infection
    Article Snippet: Paragraph title: Design of genetic constructs ... The thereby assembled complementation cassette was gel-purified, verified by sequencing and further cleaved by Eag I-HF (NEB) and SalI-HF (NEB) following manual’s instructions.

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: Designed overlap sequences were located at the two ends of the scFv construct as well as directly in the H2 region. .. The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs).

    Electrophoresis:

    Article Title: Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases
    Article Snippet: The outcome of the latter reaction was run on a 1.2% agarose gel with SYBR Safe (Life / Invitrogen) in an E-Gel electrophoresis system (Life / Invitrogen). .. A SalI digestion using SalI HF (New England Biolabs) was carried out to cut, and thus to release, the 3´-fragments.

    Incubation:

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: Therefore, 15 μg of the mammalian STARRseq plasmid (a kind gift of A.Stark) ( ) were digested with AgeI-HF and SalI-HF (NEB) for 8h at 37°C, column purified (Nucleospin purification columns, 740609250, Machery-Nagel), eluted in 30 μl elution buffer and used as a vector in a Gibson reaction, using 2 μL of digested plasmid, 5 μL purified PCR product, 3 μL H20 and 10 μL of a home-made Gibson reaction (100mM Tris-HCl, 10mM MgCl2, 0.2 mM dNTP (each), 0.5U Phusion DNA polymerase (NEB), 0.16U 5′ T5 exonuclease (Epicenter), 2 Gibson reactions per library. .. After incubation at 50°C for 1 hour, Gibson reaction were pooled and precipitated by addition of 1 μL Glycogen (20 μg/μl, Roche, 1090139300), 5 μL NaOAc (3M) and 125 μL ice-cold 100% ethanol, incubation at −20°C for 1 hour and centrifugation for 1 hour at 13200 rpm at 4°C, followed by a final wash in 70% ethanol.

    TALENs:

    Article Title: PITX2 deficiency and associated human disease: insights from the zebrafish model
    Article Snippet: Disruptions in this region were predicted to impact the SalI restriction site (GTCGAC) found between the TALENs. .. Digestion by SalI-HF (New England Biolabs, Ipswich, MA) established TALEN cutting efficiency and detected four generated mutant lines [c.190_197delATGTCGAC, p.(Met64*); c.193_195delTCG, p.(Ser65del); c.191_196delTGTCGA, p.(Met64_Ser65del); c.191_199delTGTCGACTA, p.(Met64_Thr66del)].

    Expressing:

    Article Title: CRISPR-mediated gene silencing reveals involvement of the archaeal S-layer in cell division and virus infection
    Article Snippet: The sequence chosen for slaB -M.16.4 expression contained the slaB -M.16.4 coding sequence (CDS), as well as the 11 bp 5′-UTR containing a RBS , as well as the putative terminator sequence downstream to the CDS (genome coordinates: 1615528–1614238, GenBank: CP001402.1). .. The thereby assembled complementation cassette was gel-purified, verified by sequencing and further cleaved by Eag I-HF (NEB) and SalI-HF (NEB) following manual’s instructions.

    Transformation Assay:

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were contransformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified before experiments.

    Article Title: Escherichia coli Pyruvate Dehydrogenase Complex Is an Important Component of CXCL10-Mediated Antimicrobial Activity
    Article Snippet: The aceE amplification products were doubly digested with SphI-HF and SalI-HF (New England BioLabs, Ipswich, MA, USA), purified, and ligated into pBR322 that had also been digested with SphI-HF and SalI-HF. .. The prepared vector/aceE insert was transformed into Alpha-select E. coli (Bioline, Taunton, MA, USA) for propagation.

    Gel Purification:

    Article Title: Efficient single-copy HDR by 5’ modified long dsDNA donors
    Article Snippet: .. The respective restriction enzyme was used to digest the amplicons (5’HF: SalI HF (New England Biolabs), AgeI HF (New England Biolabs); mgfp-flexible linker : AgeI HF (New England Biolabs), SpeI HF (New England Biolabs); 3’HF: SpeI HF (New England Biolabs), NotI HF (New England Biolabs)) followed by gel purification (Analytik Jena) and ligation into pCS2+ ( ) (digested with SalI HF (New England Biolabs), NotI HF (New England Biolabs)). .. The rx1 gfp plasmid was cloned with homology flanks (5’HF 430 bp, primers rx1 5’HF f/rx1 5’HF r; 3’ HF 508 bp, rx1 3’HF f/rx1 3’HF r) that were PCR amplified with Q5 polymerase (New England Biolabs, 30 cycles) from wild-type medaka genomic DNA.

    Article Title: CRISPR-mediated gene silencing reveals involvement of the archaeal S-layer in cell division and virus infection
    Article Snippet: AraS and slaB -M.16.4 PCR products were gel-purified (Monarch Gel purification kit, NEB) and subsequently fused at the homologous overlap region using primers araFW_EagI and SlaBM164_SalI_RV, in a touch-down PCR reaction (Supplementary Table ). .. The thereby assembled complementation cassette was gel-purified, verified by sequencing and further cleaved by Eag I-HF (NEB) and SalI-HF (NEB) following manual’s instructions.

    Electroporation:

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: Therefore, 15 μg of the mammalian STARRseq plasmid (a kind gift of A.Stark) ( ) were digested with AgeI-HF and SalI-HF (NEB) for 8h at 37°C, column purified (Nucleospin purification columns, 740609250, Machery-Nagel), eluted in 30 μl elution buffer and used as a vector in a Gibson reaction, using 2 μL of digested plasmid, 5 μL purified PCR product, 3 μL H20 and 10 μL of a home-made Gibson reaction (100mM Tris-HCl, 10mM MgCl2, 0.2 mM dNTP (each), 0.5U Phusion DNA polymerase (NEB), 0.16U 5′ T5 exonuclease (Epicenter), 2 Gibson reactions per library. .. After air drying, DNA pellet was dissolved in 10 μL water and used for electroporation into electrocompetent MegaX DH10β E.coli bacteria (Invitrogen), according to manufacturer’s instructions, using a Biorad pulser.

    Transfection:

    Article Title: Extremely Low Organ Toxicity and Strong Antitumor Activity of miR-34-Regulated Oncolytic Coxsackievirus B3
    Article Snippet: Production of Recombinant Viruses Plasmids containing the full-length miRT-CVB cDNA were linearized with SalI-HF (NEB, Ipswich, MA, USA), and the reaction was terminated by adding 1/10th volume of ammonium acetate solution (5 M) and two volumes of ethanol. .. H1299 cells were transfected with 50 μg RNA of each virus using Lipofectamine 3000 (Thermo Fisher Scientific).

    Ligation:

    Article Title: Efficient single-copy HDR by 5’ modified long dsDNA donors
    Article Snippet: .. The respective restriction enzyme was used to digest the amplicons (5’HF: SalI HF (New England Biolabs), AgeI HF (New England Biolabs); mgfp-flexible linker : AgeI HF (New England Biolabs), SpeI HF (New England Biolabs); 3’HF: SpeI HF (New England Biolabs), NotI HF (New England Biolabs)) followed by gel purification (Analytik Jena) and ligation into pCS2+ ( ) (digested with SalI HF (New England Biolabs), NotI HF (New England Biolabs)). .. The rx1 gfp plasmid was cloned with homology flanks (5’HF 430 bp, primers rx1 5’HF f/rx1 5’HF r; 3’ HF 508 bp, rx1 3’HF f/rx1 3’HF r) that were PCR amplified with Q5 polymerase (New England Biolabs, 30 cycles) from wild-type medaka genomic DNA.

    Article Title: Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases
    Article Snippet: 25 μl of the amplification product (i.e. half of the reaction) was immobilized on 20 μl streptavidin-coated beads (Dynabeads MyOne Streptavidin C1; Life / Invitrogen) and processed to a final sequencing library according to the previously published protocol [ ] with the difference that the SalI digestion and ADP2 ligation were performed separately with immobilization and three washes with 50 μl EBT in-between. .. A SalI digestion using SalI HF (New England Biolabs) was carried out to cut, and thus to release, the 3´-fragments.

    Generated:

    Article Title: Efficient single-copy HDR by 5’ modified long dsDNA donors
    Article Snippet: Donor plasmids Rx2 and actb template plasmids for gfp donor cassette amplification are described in and were generated by GoldenGATE assembly into the pGGDestSC-ATG destination vector (addgene #49322) according to . .. The respective restriction enzyme was used to digest the amplicons (5’HF: SalI HF (New England Biolabs), AgeI HF (New England Biolabs); mgfp-flexible linker : AgeI HF (New England Biolabs), SpeI HF (New England Biolabs); 3’HF: SpeI HF (New England Biolabs), NotI HF (New England Biolabs)) followed by gel purification (Analytik Jena) and ligation into pCS2+ ( ) (digested with SalI HF (New England Biolabs), NotI HF (New England Biolabs)).

    Article Title: The distribution of fitness effects among synonymous mutations in a gene under directional selection
    Article Snippet: First strand gts operon cDNA was generated using primer SP1 and cDNA was amplified using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). .. DNA fragments were digested with SalI-HF and XbaI and cloned into a pUC19 vector using T4 DNA Ligase (NEB).

    Article Title: PITX2 deficiency and associated human disease: insights from the zebrafish model
    Article Snippet: .. Digestion by SalI-HF (New England Biolabs, Ipswich, MA) established TALEN cutting efficiency and detected four generated mutant lines [c.190_197delATGTCGAC, p.(Met64*); c.193_195delTCG, p.(Ser65del); c.191_196delTGTCGA, p.(Met64_Ser65del); c.191_199delTGTCGACTA, p.(Met64_Thr66del)]. .. Sanger sequencing confirmed the four potential mutations as well as identified one additional line [c.193_195dupTCG, p.(Ser65dup)].

    Polymerase Chain Reaction:

    Article Title: Efficient single-copy HDR by 5’ modified long dsDNA donors
    Article Snippet: The dnmt1 gfp plasmid was cloned with homology flanks (5’ HF 402 bp, primers dnmt1 5’HF f/dnmt1 5’HF r; 3’ HF 405 bp, dnmt1 3’HF f/dnmt1 3’HF r) that were PCR amplified with Q5 polymerase (New England Biolabs, 30 cycles) from wild-type medaka genomic DNA. mgfp-flexible linker was amplified with primers mgfpf/mgfpr. .. The respective restriction enzyme was used to digest the amplicons (5’HF: SalI HF (New England Biolabs), AgeI HF (New England Biolabs); mgfp-flexible linker : AgeI HF (New England Biolabs), SpeI HF (New England Biolabs); 3’HF: SpeI HF (New England Biolabs), NotI HF (New England Biolabs)) followed by gel purification (Analytik Jena) and ligation into pCS2+ ( ) (digested with SalI HF (New England Biolabs), NotI HF (New England Biolabs)).

    Article Title: CRISPR-mediated gene silencing reveals involvement of the archaeal S-layer in cell division and virus infection
    Article Snippet: AraS and slaB -M.16.4 PCR products were gel-purified (Monarch Gel purification kit, NEB) and subsequently fused at the homologous overlap region using primers araFW_EagI and SlaBM164_SalI_RV, in a touch-down PCR reaction (Supplementary Table ). .. The thereby assembled complementation cassette was gel-purified, verified by sequencing and further cleaved by Eag I-HF (NEB) and SalI-HF (NEB) following manual’s instructions.

    Article Title: Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases
    Article Snippet: A SalI digestion using SalI HF (New England Biolabs) was carried out to cut, and thus to release, the 3´-fragments. .. The dual-adaptor carrying products (STRT handle on one end and the ligated adaptor on the other) were then PCR amplified using 2 units of Phusion polymerase (Thermo Fisher Scientific / Finnzymes; Vantaa, Finland) in a 100 μl reaction (divided into two 50 μl reactions) containing 1 μM of forward primer (carrying the STRT handle fused to one of the Illumina adaptors; for sequence see ), 1 μM of reverse primer (encompassing the ligated adaptor sequence fused to the other Illumina adaptor; for sequence see ), 200 μM dNTPs in 1x Phusion HF buffer (Thermo Fisher Scientific / Finnzymes).

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: .. Therefore, 15 μg of the mammalian STARRseq plasmid (a kind gift of A.Stark) ( ) were digested with AgeI-HF and SalI-HF (NEB) for 8h at 37°C, column purified (Nucleospin purification columns, 740609250, Machery-Nagel), eluted in 30 μl elution buffer and used as a vector in a Gibson reaction, using 2 μL of digested plasmid, 5 μL purified PCR product, 3 μL H20 and 10 μL of a home-made Gibson reaction (100mM Tris-HCl, 10mM MgCl2, 0.2 mM dNTP (each), 0.5U Phusion DNA polymerase (NEB), 0.16U 5′ T5 exonuclease (Epicenter), 2 Gibson reactions per library. .. After incubation at 50°C for 1 hour, Gibson reaction were pooled and precipitated by addition of 1 μL Glycogen (20 μg/μl, Roche, 1090139300), 5 μL NaOAc (3M) and 125 μL ice-cold 100% ethanol, incubation at −20°C for 1 hour and centrifugation for 1 hour at 13200 rpm at 4°C, followed by a final wash in 70% ethanol.

    Article Title: The distribution of fitness effects among synonymous mutations in a gene under directional selection
    Article Snippet: RNA concentration was quantified using NanoDrop 2000 Spectrophotometer (Thermo Scientific). cDNA synthesis, cDNA purification and poly(A) tailing were completed using 5’/3’ Random Amplification of cDNA ends (RACE) kit, 2nd generation (Roche) and Wizard SV Gel and PCR Clean-Up System (Promega). .. DNA fragments were digested with SalI-HF and XbaI and cloned into a pUC19 vector using T4 DNA Ligase (NEB).

    Article Title: Escherichia coli Pyruvate Dehydrogenase Complex Is an Important Component of CXCL10-Mediated Antimicrobial Activity
    Article Snippet: PCR cycle conditions were as follows: 98°C for 30 s, 98°C for 10 s, 68°C for 15 s, and 72°C for 45 s (32 cycles) and then 72°C for 7 min. .. The aceE amplification products were doubly digested with SphI-HF and SalI-HF (New England BioLabs, Ipswich, MA, USA), purified, and ligated into pBR322 that had also been digested with SphI-HF and SalI-HF.

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: The plasmid backbone, pLibacceptorV2 was digested using SbfI-HF and SalI-HF with the addition of rSAP (NEB #M0371S). .. Unless stated otherwise, all plasmids were isolated using a Qiagen Plasmid Plus Maxiprep Kit (#12963) and concentrated using a Promega Wizard SV Gel and PCR Clean-up System (#A9281).

    Article Title: Merkel Cell Polyomavirus and Two Novel Polyomaviruses Are Chronically Shed from Human Skin
    Article Snippet: DNA was extracted from swab specimens using QIAquick PCR purification columns (Qiagen). .. The purified DNA was digested with NotI or SalI-HF (NEB) and Plasmid Safe (exonuclease V, Epicentre) then ethanol precipitated.

    Article Title: PITX2 deficiency and associated human disease: insights from the zebrafish model
    Article Snippet: The genomic fragment surrounding the homeobox was PCR-amplified using primers s- 5’-CCCTCACGCACACTTCTCTA-3’ and a- 5’-GCATTAAGCTGATAGGCTATCTTG-3’. .. Digestion by SalI-HF (New England Biolabs, Ipswich, MA) established TALEN cutting efficiency and detected four generated mutant lines [c.190_197delATGTCGAC, p.(Met64*); c.193_195delTCG, p.(Ser65del); c.191_196delTGTCGA, p.(Met64_Ser65del); c.191_199delTGTCGACTA, p.(Met64_Thr66del)].

    Injection:

    Article Title: PITX2 deficiency and associated human disease: insights from the zebrafish model
    Article Snippet: TALEN mRNA was injected into 1–4 cell stage wildtype zebrafish embryos to generate mosaic founders, which when bred generated F1 heterozygous pitx2 mutant embryos that went on to produce F2 homozygous embryos used for further study. .. Digestion by SalI-HF (New England Biolabs, Ipswich, MA) established TALEN cutting efficiency and detected four generated mutant lines [c.190_197delATGTCGAC, p.(Met64*); c.193_195delTCG, p.(Ser65del); c.191_196delTGTCGA, p.(Met64_Ser65del); c.191_199delTGTCGACTA, p.(Met64_Thr66del)].

    Recombinant:

    Article Title: Extremely Low Organ Toxicity and Strong Antitumor Activity of miR-34-Regulated Oncolytic Coxsackievirus B3
    Article Snippet: .. Production of Recombinant Viruses Plasmids containing the full-length miRT-CVB cDNA were linearized with SalI-HF (NEB, Ipswich, MA, USA), and the reaction was terminated by adding 1/10th volume of ammonium acetate solution (5 M) and two volumes of ethanol. .. Transcription reaction was performed using the MEGAscript T7 Transcription kit (Thermo Fisher Scientific, Waltham, MA, USA) and purified by phenol-chloroform extraction and ethanol precipitation.

    ChIP-sequencing:

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: Paragraph title: ChIP-seq, ChIP-STARR-seq plasmid library preparation ... Therefore, 15 μg of the mammalian STARRseq plasmid (a kind gift of A.Stark) ( ) were digested with AgeI-HF and SalI-HF (NEB) for 8h at 37°C, column purified (Nucleospin purification columns, 740609250, Machery-Nagel), eluted in 30 μl elution buffer and used as a vector in a Gibson reaction, using 2 μL of digested plasmid, 5 μL purified PCR product, 3 μL H20 and 10 μL of a home-made Gibson reaction (100mM Tris-HCl, 10mM MgCl2, 0.2 mM dNTP (each), 0.5U Phusion DNA polymerase (NEB), 0.16U 5′ T5 exonuclease (Epicenter), 2 Gibson reactions per library.

    Mutagenesis:

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: Paragraph title: Mutant construction ... The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs).

    Article Title: Escherichia coli Pyruvate Dehydrogenase Complex Is an Important Component of CXCL10-Mediated Antimicrobial Activity
    Article Snippet: The resulting markerless deletion mutant, the ΔaceE strain, exhibited increased resistance to CXCL10 compared to the parent strain. .. The aceE amplification products were doubly digested with SphI-HF and SalI-HF (New England BioLabs, Ipswich, MA, USA), purified, and ligated into pBR322 that had also been digested with SphI-HF and SalI-HF.

    Article Title: PITX2 deficiency and associated human disease: insights from the zebrafish model
    Article Snippet: .. Digestion by SalI-HF (New England Biolabs, Ipswich, MA) established TALEN cutting efficiency and detected four generated mutant lines [c.190_197delATGTCGAC, p.(Met64*); c.193_195delTCG, p.(Ser65del); c.191_196delTGTCGA, p.(Met64_Ser65del); c.191_199delTGTCGACTA, p.(Met64_Thr66del)]. .. Sanger sequencing confirmed the four potential mutations as well as identified one additional line [c.193_195dupTCG, p.(Ser65dup)].

    Isolation:

    Article Title: The distribution of fitness effects among synonymous mutations in a gene under directional selection
    Article Snippet: Paragraph title: RNA isolation and identification of transcriptional start sites ... DNA fragments were digested with SalI-HF and XbaI and cloned into a pUC19 vector using T4 DNA Ligase (NEB).

    Article Title: Escherichia coli Pyruvate Dehydrogenase Complex Is an Important Component of CXCL10-Mediated Antimicrobial Activity
    Article Snippet: The aceE amplification products were doubly digested with SphI-HF and SalI-HF (New England BioLabs, Ipswich, MA, USA), purified, and ligated into pBR322 that had also been digested with SphI-HF and SalI-HF. .. This aceE complementation vector (pUVA411) and the empty-vector control (pBR322) were isolated from Alpha-select transformants grown in the presence of ampicillin using the QIAprep Spin miniprep kit (Qiagen, Germantown, MD, USA).

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: The plasmid backbone, pLibacceptorV2 was digested using SbfI-HF and SalI-HF with the addition of rSAP (NEB #M0371S). .. Unless stated otherwise, all plasmids were isolated using a Qiagen Plasmid Plus Maxiprep Kit (#12963) and concentrated using a Promega Wizard SV Gel and PCR Clean-up System (#A9281).

    Purification:

    Article Title: Extremely Low Organ Toxicity and Strong Antitumor Activity of miR-34-Regulated Oncolytic Coxsackievirus B3
    Article Snippet: Production of Recombinant Viruses Plasmids containing the full-length miRT-CVB cDNA were linearized with SalI-HF (NEB, Ipswich, MA, USA), and the reaction was terminated by adding 1/10th volume of ammonium acetate solution (5 M) and two volumes of ethanol. .. Transcription reaction was performed using the MEGAscript T7 Transcription kit (Thermo Fisher Scientific, Waltham, MA, USA) and purified by phenol-chloroform extraction and ethanol precipitation.

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: .. Therefore, 15 μg of the mammalian STARRseq plasmid (a kind gift of A.Stark) ( ) were digested with AgeI-HF and SalI-HF (NEB) for 8h at 37°C, column purified (Nucleospin purification columns, 740609250, Machery-Nagel), eluted in 30 μl elution buffer and used as a vector in a Gibson reaction, using 2 μL of digested plasmid, 5 μL purified PCR product, 3 μL H20 and 10 μL of a home-made Gibson reaction (100mM Tris-HCl, 10mM MgCl2, 0.2 mM dNTP (each), 0.5U Phusion DNA polymerase (NEB), 0.16U 5′ T5 exonuclease (Epicenter), 2 Gibson reactions per library. .. After incubation at 50°C for 1 hour, Gibson reaction were pooled and precipitated by addition of 1 μL Glycogen (20 μg/μl, Roche, 1090139300), 5 μL NaOAc (3M) and 125 μL ice-cold 100% ethanol, incubation at −20°C for 1 hour and centrifugation for 1 hour at 13200 rpm at 4°C, followed by a final wash in 70% ethanol.

    Article Title: The distribution of fitness effects among synonymous mutations in a gene under directional selection
    Article Snippet: 2nd round amplification products were run on 2% agarose gel and expected bands (150–400 base pairs) were excised and purified using Qiaquick Gel Extraction Kit (Qiagen). .. DNA fragments were digested with SalI-HF and XbaI and cloned into a pUC19 vector using T4 DNA Ligase (NEB).

    Article Title: Escherichia coli Pyruvate Dehydrogenase Complex Is an Important Component of CXCL10-Mediated Antimicrobial Activity
    Article Snippet: .. The aceE amplification products were doubly digested with SphI-HF and SalI-HF (New England BioLabs, Ipswich, MA, USA), purified, and ligated into pBR322 that had also been digested with SphI-HF and SalI-HF. .. The prepared vector/aceE insert was transformed into Alpha-select E. coli (Bioline, Taunton, MA, USA) for propagation.

    Article Title: Merkel Cell Polyomavirus and Two Novel Polyomaviruses Are Chronically Shed from Human Skin
    Article Snippet: .. The purified DNA was digested with NotI or SalI-HF (NEB) and Plasmid Safe (exonuclease V, Epicentre) then ethanol precipitated. .. The pelleted DNA was redissolved and amplified using an Illustra TempliPhi RCA kit (GE Healthcare).

    Sequencing:

    Article Title: CRISPR-mediated gene silencing reveals involvement of the archaeal S-layer in cell division and virus infection
    Article Snippet: .. The thereby assembled complementation cassette was gel-purified, verified by sequencing and further cleaved by Eag I-HF (NEB) and SalI-HF (NEB) following manual’s instructions. ..

    Article Title: Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases
    Article Snippet: Paragraph title: Sequence analysis at the template-switching junction ... A SalI digestion using SalI HF (New England Biolabs) was carried out to cut, and thus to release, the 3´-fragments.

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were contransformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified before experiments.

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: Therefore, DNA was diluted to a total volume of 10 μL in 0.1xTE and used as an input in 8 × 50 μL PCR reactions using Phusion Polymerase, High-fidelity buffer (M0530L, NEB) and primers 147 STARRseq libr FW (TAGAGCATGCACCGGACACTCTTTCCCTACACGACGCTCTTCCGATCT) and 148 STARRseq libr RV (GGCCGAATTCGTCGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) , which prime on the adaptor sequences and add a 5′and 3′ 15 nucleotide homology sequence to the reaction products which are used for Gibson assembly. .. Therefore, 15 μg of the mammalian STARRseq plasmid (a kind gift of A.Stark) ( ) were digested with AgeI-HF and SalI-HF (NEB) for 8h at 37°C, column purified (Nucleospin purification columns, 740609250, Machery-Nagel), eluted in 30 μl elution buffer and used as a vector in a Gibson reaction, using 2 μL of digested plasmid, 5 μL purified PCR product, 3 μL H20 and 10 μL of a home-made Gibson reaction (100mM Tris-HCl, 10mM MgCl2, 0.2 mM dNTP (each), 0.5U Phusion DNA polymerase (NEB), 0.16U 5′ T5 exonuclease (Epicenter), 2 Gibson reactions per library.

    Article Title: The distribution of fitness effects among synonymous mutations in a gene under directional selection
    Article Snippet: DNA fragments were digested with SalI-HF and XbaI and cloned into a pUC19 vector using T4 DNA Ligase (NEB). .. Inserted DNA fragments were sequenced using Sanger sequencing to identify possible transcriptional start sites in gtsA and gtsB .

    Article Title: PITX2 deficiency and associated human disease: insights from the zebrafish model
    Article Snippet: Digestion by SalI-HF (New England Biolabs, Ipswich, MA) established TALEN cutting efficiency and detected four generated mutant lines [c.190_197delATGTCGAC, p.(Met64*); c.193_195delTCG, p.(Ser65del); c.191_196delTGTCGA, p.(Met64_Ser65del); c.191_199delTGTCGACTA, p.(Met64_Thr66del)]. .. Sanger sequencing confirmed the four potential mutations as well as identified one additional line [c.193_195dupTCG, p.(Ser65dup)].

    Chromatin Immunoprecipitation:

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: Paragraph title: ChIP-seq, ChIP-STARR-seq plasmid library preparation ... Therefore, 15 μg of the mammalian STARRseq plasmid (a kind gift of A.Stark) ( ) were digested with AgeI-HF and SalI-HF (NEB) for 8h at 37°C, column purified (Nucleospin purification columns, 740609250, Machery-Nagel), eluted in 30 μl elution buffer and used as a vector in a Gibson reaction, using 2 μL of digested plasmid, 5 μL purified PCR product, 3 μL H20 and 10 μL of a home-made Gibson reaction (100mM Tris-HCl, 10mM MgCl2, 0.2 mM dNTP (each), 0.5U Phusion DNA polymerase (NEB), 0.16U 5′ T5 exonuclease (Epicenter), 2 Gibson reactions per library.

    Plasmid Preparation:

    Article Title: Efficient single-copy HDR by 5’ modified long dsDNA donors
    Article Snippet: The dnmt1 gfp plasmid was cloned with homology flanks (5’ HF 402 bp, primers dnmt1 5’HF f/dnmt1 5’HF r; 3’ HF 405 bp, dnmt1 3’HF f/dnmt1 3’HF r) that were PCR amplified with Q5 polymerase (New England Biolabs, 30 cycles) from wild-type medaka genomic DNA. mgfp-flexible linker was amplified with primers mgfpf/mgfpr. .. The respective restriction enzyme was used to digest the amplicons (5’HF: SalI HF (New England Biolabs), AgeI HF (New England Biolabs); mgfp-flexible linker : AgeI HF (New England Biolabs), SpeI HF (New England Biolabs); 3’HF: SpeI HF (New England Biolabs), NotI HF (New England Biolabs)) followed by gel purification (Analytik Jena) and ligation into pCS2+ ( ) (digested with SalI HF (New England Biolabs), NotI HF (New England Biolabs)).

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: .. The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were contransformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified before experiments.

    Article Title: Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells
    Article Snippet: .. Therefore, 15 μg of the mammalian STARRseq plasmid (a kind gift of A.Stark) ( ) were digested with AgeI-HF and SalI-HF (NEB) for 8h at 37°C, column purified (Nucleospin purification columns, 740609250, Machery-Nagel), eluted in 30 μl elution buffer and used as a vector in a Gibson reaction, using 2 μL of digested plasmid, 5 μL purified PCR product, 3 μL H20 and 10 μL of a home-made Gibson reaction (100mM Tris-HCl, 10mM MgCl2, 0.2 mM dNTP (each), 0.5U Phusion DNA polymerase (NEB), 0.16U 5′ T5 exonuclease (Epicenter), 2 Gibson reactions per library. .. After incubation at 50°C for 1 hour, Gibson reaction were pooled and precipitated by addition of 1 μL Glycogen (20 μg/μl, Roche, 1090139300), 5 μL NaOAc (3M) and 125 μL ice-cold 100% ethanol, incubation at −20°C for 1 hour and centrifugation for 1 hour at 13200 rpm at 4°C, followed by a final wash in 70% ethanol.

    Article Title: The distribution of fitness effects among synonymous mutations in a gene under directional selection
    Article Snippet: .. DNA fragments were digested with SalI-HF and XbaI and cloned into a pUC19 vector using T4 DNA Ligase (NEB). .. Inserted DNA fragments were sequenced using Sanger sequencing to identify possible transcriptional start sites in gtsA and gtsB .

    Article Title: Escherichia coli Pyruvate Dehydrogenase Complex Is an Important Component of CXCL10-Mediated Antimicrobial Activity
    Article Snippet: The aceE amplification products were doubly digested with SphI-HF and SalI-HF (New England BioLabs, Ipswich, MA, USA), purified, and ligated into pBR322 that had also been digested with SphI-HF and SalI-HF. .. The prepared vector/aceE insert was transformed into Alpha-select E. coli (Bioline, Taunton, MA, USA) for propagation.

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: .. The plasmid backbone, pLibacceptorV2 was digested using SbfI-HF and SalI-HF with the addition of rSAP (NEB #M0371S). .. The digested library was ligated into pLibacceptorV2 using T7 DNA Ligase (NEB #M0318S), cloned into 5-alpha Electrocompetent E. coli (NEB #C2989K), and plated on LB + kanamycin (25 ug/mL) yielding approximately 1.1 million colonies estimated by plating concomitant dilution plates.

    Article Title: Merkel Cell Polyomavirus and Two Novel Polyomaviruses Are Chronically Shed from Human Skin
    Article Snippet: .. The purified DNA was digested with NotI or SalI-HF (NEB) and Plasmid Safe (exonuclease V, Epicentre) then ethanol precipitated. .. The pelleted DNA was redissolved and amplified using an Illustra TempliPhi RCA kit (GE Healthcare).

    Binding Assay:

    Article Title: Escherichia coli Pyruvate Dehydrogenase Complex Is an Important Component of CXCL10-Mediated Antimicrobial Activity
    Article Snippet: For aceE complementation, the native E. coli parent strain aceE gene, including its native promoter and ribosomal binding site, was amplified using Phusion high-fidelity polymerase (New England BioLabs, Ipswich, MA, USA) according to the manufacturer's instructions, with primer aceE-CF8 containing an SphI restriction site (GACTAGGCATGCCCAGAAGATGTTGTAAATCAAGC) and primer aceE-CR8 containing a SalI restriction site (CTAGTCGTCGACTTTACCTCTTACGCCAGACG). .. The aceE amplification products were doubly digested with SphI-HF and SalI-HF (New England BioLabs, Ipswich, MA, USA), purified, and ligated into pBR322 that had also been digested with SphI-HF and SalI-HF.

    Agarose Gel Electrophoresis:

    Article Title: Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases
    Article Snippet: The outcome of the latter reaction was run on a 1.2% agarose gel with SYBR Safe (Life / Invitrogen) in an E-Gel electrophoresis system (Life / Invitrogen). .. A SalI digestion using SalI HF (New England Biolabs) was carried out to cut, and thus to release, the 3´-fragments.

    Article Title: The distribution of fitness effects among synonymous mutations in a gene under directional selection
    Article Snippet: 2nd round amplification products were run on 2% agarose gel and expected bands (150–400 base pairs) were excised and purified using Qiaquick Gel Extraction Kit (Qiagen). .. DNA fragments were digested with SalI-HF and XbaI and cloned into a pUC19 vector using T4 DNA Ligase (NEB).

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: This product was then ran on a 2% TAE agarose gel and approximately 200 bp amplicons were extracted using a Zymoclean Gel DNA Recovery Kit (#D4008). .. The plasmid backbone, pLibacceptorV2 was digested using SbfI-HF and SalI-HF with the addition of rSAP (NEB #M0371S).

    Ethanol Precipitation:

    Article Title: Extremely Low Organ Toxicity and Strong Antitumor Activity of miR-34-Regulated Oncolytic Coxsackievirus B3
    Article Snippet: Production of Recombinant Viruses Plasmids containing the full-length miRT-CVB cDNA were linearized with SalI-HF (NEB, Ipswich, MA, USA), and the reaction was terminated by adding 1/10th volume of ammonium acetate solution (5 M) and two volumes of ethanol. .. Transcription reaction was performed using the MEGAscript T7 Transcription kit (Thermo Fisher Scientific, Waltham, MA, USA) and purified by phenol-chloroform extraction and ethanol precipitation.

    Spectrophotometry:

    Article Title: The distribution of fitness effects among synonymous mutations in a gene under directional selection
    Article Snippet: RNA concentration was quantified using NanoDrop 2000 Spectrophotometer (Thermo Scientific). cDNA synthesis, cDNA purification and poly(A) tailing were completed using 5’/3’ Random Amplification of cDNA ends (RACE) kit, 2nd generation (Roche) and Wizard SV Gel and PCR Clean-Up System (Promega). .. DNA fragments were digested with SalI-HF and XbaI and cloned into a pUC19 vector using T4 DNA Ligase (NEB).

    Activation Assay:

    Article Title: Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases
    Article Snippet: A SalI digestion using SalI HF (New England Biolabs) was carried out to cut, and thus to release, the 3´-fragments. .. The cycling was performed in a PTC-200 thermocycler (MJ Research) with enzyme activation at 98°C for 30 s, 14 cycles of denaturation at 98°C for 10 s, annealing at 65°C for 30 s and extension at 72°C for 30 s and a final elongation at 72°C for 5 min.

    Produced:

    Article Title: PITX2 deficiency and associated human disease: insights from the zebrafish model
    Article Snippet: TALENs were produced per the protocol of Sanjana et al . ( ). .. Digestion by SalI-HF (New England Biolabs, Ipswich, MA) established TALEN cutting efficiency and detected four generated mutant lines [c.190_197delATGTCGAC, p.(Met64*); c.193_195delTCG, p.(Ser65del); c.191_196delTGTCGA, p.(Met64_Ser65del); c.191_199delTGTCGACTA, p.(Met64_Thr66del)].

    Concentration Assay:

    Article Title: The distribution of fitness effects among synonymous mutations in a gene under directional selection
    Article Snippet: RNA concentration was quantified using NanoDrop 2000 Spectrophotometer (Thermo Scientific). cDNA synthesis, cDNA purification and poly(A) tailing were completed using 5’/3’ Random Amplification of cDNA ends (RACE) kit, 2nd generation (Roche) and Wizard SV Gel and PCR Clean-Up System (Promega). .. DNA fragments were digested with SalI-HF and XbaI and cloned into a pUC19 vector using T4 DNA Ligase (NEB).

    Gel Extraction:

    Article Title: The distribution of fitness effects among synonymous mutations in a gene under directional selection
    Article Snippet: 2nd round amplification products were run on 2% agarose gel and expected bands (150–400 base pairs) were excised and purified using Qiaquick Gel Extraction Kit (Qiagen). .. DNA fragments were digested with SalI-HF and XbaI and cloned into a pUC19 vector using T4 DNA Ligase (NEB).

    Homologous Recombination:

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: .. The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were contransformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified before experiments.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs sali hf
    Restriction map of a FLASH plasmid harboring an extension unit Extension units are released from their plasmid vectors using a quadruple digest. In the example shown, the extension unit contains coding sequence for four TALE repeats (colored rectangles). Digestion of the plasmid with BbsI and <t>BamHI</t> releases the unit from the plasmid with appropriate overhangs for use in the FLASH assembly method. Digestion of the plasmid with the additional restriction enzymes XbaI and <t>SalI</t> prevents the released unit fragment religating back into the vector, thereby eliminating the need to gel purify the fragment.
    Sali Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sali hf/product/New England Biolabs
    Average 95 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    sali hf - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Restriction map of a FLASH plasmid harboring an extension unit Extension units are released from their plasmid vectors using a quadruple digest. In the example shown, the extension unit contains coding sequence for four TALE repeats (colored rectangles). Digestion of the plasmid with BbsI and BamHI releases the unit from the plasmid with appropriate overhangs for use in the FLASH assembly method. Digestion of the plasmid with the additional restriction enzymes XbaI and SalI prevents the released unit fragment religating back into the vector, thereby eliminating the need to gel purify the fragment.

    Journal: Current protocols in molecular biology / edited by Frederick M. Ausubel ... [et al.]

    Article Title: Engineering Customized TALE Nucleases (TALENs) and TALE Transcription Factors by Fast Ligation-based Automatable Solid-phase High-throughput (FLASH) Assembly

    doi: 10.1002/0471142727.mb1216s103

    Figure Lengend Snippet: Restriction map of a FLASH plasmid harboring an extension unit Extension units are released from their plasmid vectors using a quadruple digest. In the example shown, the extension unit contains coding sequence for four TALE repeats (colored rectangles). Digestion of the plasmid with BbsI and BamHI releases the unit from the plasmid with appropriate overhangs for use in the FLASH assembly method. Digestion of the plasmid with the additional restriction enzymes XbaI and SalI prevents the released unit fragment religating back into the vector, thereby eliminating the need to gel purify the fragment.

    Article Snippet: ) 100X Bovine Serum Albumin (BSA) (10 mg/ml) (NEB cat. no. B9001S) Restriction enzymes (NEB): BamHI-HF (cat. no. R3136L) XbaI (cat. no. R0145L) BbsI (cat. no. R0539L) SalI-HF (cat. no. R3138L).

    Techniques: Plasmid Preparation, Sequencing