pbad33  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
    Name:
    SalI HF
    Description:

    Catalog Number:
    R3138
    Price:
    266
    Category:
    Restriction Enzymes
    Applications:
    DNA Manipulation
    Size:
    10000 units
    		Buy from Supplier

    Structured Review

    New England Biolabs pbad33
    SalI HF

    https://www.bioz.com/result/pbad33/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pbad33 - by Bioz Stars, 2021-07
    95/100 stars

    Images

    1) Product Images from "gbpA and chiA genes are not uniformly distributed amongst diverse Vibrio cholerae"

    Article Title: gbpA and chiA genes are not uniformly distributed amongst diverse Vibrio cholerae

    Journal: bioRxiv

    doi: 10.1101/2021.02.11.430729

    Molecular cloning of chiA-3 and expression of ChiA-3-6xHis. (a): Schematic of cloning strategy used to amplify and insert chiA-3 directionally into the pBAD33 multiple cloning site (MCS), under the arabinose-inducible P BAD promoter, and to incorporate a C-terminal 6xHis tag as a translational fusion. A linker sequence was not incorporated between the C-terminus of ChiA-3 and the 6xHis tag. Figures are not to scale. (b): InstantBlue-stained acrylamide gel of proteins present in supernatants and cell pellet lysates from cultures grown at 23 °C supplemented with arabinose (induction +) or glucose (induction -). No induced bands were easily discerned. (c): Western immunoblot produced from an identically-loaded acrylamide gel to that presented in (b), run in parallel with the gel in (b), and probed with an α-6xHis antibody (see Methods). A band corresponding to the expected molecular weight of ChiA-3-6xHis (48.51 kDa) was detected in the cell pellet lysate of E. coli harbouring pMJD157 only (plasmid +). This size is consistent with the retention of the fusion protein without the cleavage of the putative signal sequence. Protein ladders: NEB #P7719S and #P7717S. EV = empty vector (pBAD33).
    Figure Legend Snippet: Molecular cloning of chiA-3 and expression of ChiA-3-6xHis. (a): Schematic of cloning strategy used to amplify and insert chiA-3 directionally into the pBAD33 multiple cloning site (MCS), under the arabinose-inducible P BAD promoter, and to incorporate a C-terminal 6xHis tag as a translational fusion. A linker sequence was not incorporated between the C-terminus of ChiA-3 and the 6xHis tag. Figures are not to scale. (b): InstantBlue-stained acrylamide gel of proteins present in supernatants and cell pellet lysates from cultures grown at 23 °C supplemented with arabinose (induction +) or glucose (induction -). No induced bands were easily discerned. (c): Western immunoblot produced from an identically-loaded acrylamide gel to that presented in (b), run in parallel with the gel in (b), and probed with an α-6xHis antibody (see Methods). A band corresponding to the expected molecular weight of ChiA-3-6xHis (48.51 kDa) was detected in the cell pellet lysate of E. coli harbouring pMJD157 only (plasmid +). This size is consistent with the retention of the fusion protein without the cleavage of the putative signal sequence. Protein ladders: NEB #P7719S and #P7717S. EV = empty vector (pBAD33).

    Techniques Used: Molecular Cloning, Expressing, Clone Assay, Sequencing, Staining, Acrylamide Gel Assay, Western Blot, Produced, Molecular Weight, Plasmid Preparation

    Related Articles

    Plasmid Preparation:

    Article Title:
    Article Snippet: The DNA fragments encoding 112-nt and 129-nt human pre–miR-34a (miRBase ID: MI0000268) were amplified from human genomic DNA by PCR using the primers 5′-AGT AAT TTA CGT CGA CGG CCA GCT GTG AGT GTT TCT TTG G-3′ and 5′-CGG CCG CAA CCA TCG ACG TCT GGG CCC CAC AAC GTG CAG CAC TT-3′, and 5′-AGT AAT TTA CGT CGA CGT GGA CCG GCC AGC TGT GAG TGT T-3′ and 5′-CGG CCG CAA CCA TCG ACG TCA TCT TCC CTC TTG GGC CCC ACA ACG-3′ (IDT, Coralville, IA), respectively. .. The amplicons were inserted into the pBSMrnaSeph vector (kindly provided by Dr. Luc Ponchon, Université Paris Descartes; ) linearized with SalI-HF and AatII (New England Biolabs, Ipswich, MA). .. Target tRNA/mir-34a expression plasmids were confirmed by sequencing analyses at UC Davis Genome Center.

    Article Title: Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli
    Article Snippet: Following cleaning using a Zymo Clean and Concentrator Kit (# ), the library was digested using NEB’s SbfI-HF and XhoI. .. The plasmid backbone, pLibacceptorV2 was digested using SbfI-HF and SalI-HF with the addition of rSAP (NEB #M0371S). .. The digested library was ligated into pLibacceptorV2 using T7 DNA Ligase (NEB #M0318S), cloned into 5-alpha Electrocompetent E. coli (NEB #C2989K), and plated on LB + kanamycin (25 ug/mL) yielding approximately 1.1 million colonies estimated by plating concomitant dilution plates.

    Article Title: Tissue-specific delivery system via AFF-1-coated pseudotyped Vesicular Stomatitis Virus in C. elegans
    Article Snippet: .. DNA constructs The myo-3p ::EFF-1 plasmid was constructed by cloning the myo-3 promoter region from myo-3p ::mCherry plasmid with Sal I (New England BioLabs CatR3138) and Nhe I (ThermoFisher Cat# FD0974) and inserting it into the hsp16-2 :: EFF-1 plasmid cut with the same enzymes to replace the original heat shock promoter. .. To produce eff-2 (hy51) mutant worms with CRISPR, the following DNA constructs were generated: pBG115 plasmid encoding single guide targeting eff-2 to insert mNeonGreen was generated by cloning eff-2 targeting sequence into the CAS9 plasmid pDD162 with BG84 and BG85 primers.

    Article Title: gbpA and chiA genes are not uniformly distributed amongst diverse Vibrio cholerae
    Article Snippet: .. The amplicon was purified and digested using 30 units of SacI-HF and SalI-HF (NEB, #R3156S and R3138S respectively) at 37 °C for 45 min. pBAD33 was similarly treated with SacI-HF and SalI-HF, and after 15 min incubation at 37 °C, the plasmid digestion was supplemented with 1.5 units of recombinant shrimp alkaline phosphatase (rSAP; NEB #M0371S). .. Digested insert and vector were purified and ligated together at room temperature for 30 min using T4 DNA ligase (NEB, #M0202S) in approximately a 3:1 molar ratio.

    Article Title: Cdc42 and k-Ras Control Endothelial Tubulogenesis through Apical Membrane and Cytoskeletal Polarization: Novel Stimulatory Roles for GTPase Effectors, the Small GTPases, Rac2 and Rap1b, and Inhibitory Influence of Arhgap31 and Rasa1
    Article Snippet: Generation of S-epitope tagged Cherry, Cherry-fusion proteins, and AcGFP-Rasip1 adenoviruses Cdc42, Rac1, Rac2, RhoA, k-Ras, and Rap1b were amplified from cDNA obtained from Missouri S & T cDNA Resource Center (Rolla, MO) and human Rasip1 and PKCɛ were amplified from cDNA obtained from Open Biosystems (Open Biosystems, GE Dharmacon, Lafayette, CO), and standard restriction digest cloning for individual GTPases and PKCɛ into pmCherry-C1 plasmid and Rasip1 into pAcGFP-C1 (Clontech, Mountain View, CA) using EcoRI-HF and BamHI-HF , XhoI and BamHI-HF , and EcoRI-HF and XbaI restriction enzymes respectively (New England Biolabs). .. Amplified S-Cherry, S-Ch-GTPase, S-Ch-PKCɛ, and AcGFP-Rasip1 constructs were subcloned into pShuttle-CMV expression plasmid using NotI-HF , XbaI , XhoI , KpnI-HF and SalI-HF restriction enzymes, respectively (New England Biolabs). .. Recombinant adenoviral vectors were then generated [ ] and propagated as previously described [ ].

    Construct:

    Article Title: Tissue-specific delivery system via AFF-1-coated pseudotyped Vesicular Stomatitis Virus in C. elegans
    Article Snippet: .. DNA constructs The myo-3p ::EFF-1 plasmid was constructed by cloning the myo-3 promoter region from myo-3p ::mCherry plasmid with Sal I (New England BioLabs CatR3138) and Nhe I (ThermoFisher Cat# FD0974) and inserting it into the hsp16-2 :: EFF-1 plasmid cut with the same enzymes to replace the original heat shock promoter. .. To produce eff-2 (hy51) mutant worms with CRISPR, the following DNA constructs were generated: pBG115 plasmid encoding single guide targeting eff-2 to insert mNeonGreen was generated by cloning eff-2 targeting sequence into the CAS9 plasmid pDD162 with BG84 and BG85 primers.

    Article Title: Cdc42 and k-Ras Control Endothelial Tubulogenesis through Apical Membrane and Cytoskeletal Polarization: Novel Stimulatory Roles for GTPase Effectors, the Small GTPases, Rac2 and Rap1b, and Inhibitory Influence of Arhgap31 and Rasa1
    Article Snippet: Generation of S-epitope tagged Cherry, Cherry-fusion proteins, and AcGFP-Rasip1 adenoviruses Cdc42, Rac1, Rac2, RhoA, k-Ras, and Rap1b were amplified from cDNA obtained from Missouri S & T cDNA Resource Center (Rolla, MO) and human Rasip1 and PKCɛ were amplified from cDNA obtained from Open Biosystems (Open Biosystems, GE Dharmacon, Lafayette, CO), and standard restriction digest cloning for individual GTPases and PKCɛ into pmCherry-C1 plasmid and Rasip1 into pAcGFP-C1 (Clontech, Mountain View, CA) using EcoRI-HF and BamHI-HF , XhoI and BamHI-HF , and EcoRI-HF and XbaI restriction enzymes respectively (New England Biolabs). .. Amplified S-Cherry, S-Ch-GTPase, S-Ch-PKCɛ, and AcGFP-Rasip1 constructs were subcloned into pShuttle-CMV expression plasmid using NotI-HF , XbaI , XhoI , KpnI-HF and SalI-HF restriction enzymes, respectively (New England Biolabs). .. Recombinant adenoviral vectors were then generated [ ] and propagated as previously described [ ].

    Clone Assay:

    Article Title: Tissue-specific delivery system via AFF-1-coated pseudotyped Vesicular Stomatitis Virus in C. elegans
    Article Snippet: .. DNA constructs The myo-3p ::EFF-1 plasmid was constructed by cloning the myo-3 promoter region from myo-3p ::mCherry plasmid with Sal I (New England BioLabs CatR3138) and Nhe I (ThermoFisher Cat# FD0974) and inserting it into the hsp16-2 :: EFF-1 plasmid cut with the same enzymes to replace the original heat shock promoter. .. To produce eff-2 (hy51) mutant worms with CRISPR, the following DNA constructs were generated: pBG115 plasmid encoding single guide targeting eff-2 to insert mNeonGreen was generated by cloning eff-2 targeting sequence into the CAS9 plasmid pDD162 with BG84 and BG85 primers.

    Amplification:

    Article Title: gbpA and chiA genes are not uniformly distributed amongst diverse Vibrio cholerae
    Article Snippet: .. The amplicon was purified and digested using 30 units of SacI-HF and SalI-HF (NEB, #R3156S and R3138S respectively) at 37 °C for 45 min. pBAD33 was similarly treated with SacI-HF and SalI-HF, and after 15 min incubation at 37 °C, the plasmid digestion was supplemented with 1.5 units of recombinant shrimp alkaline phosphatase (rSAP; NEB #M0371S). .. Digested insert and vector were purified and ligated together at room temperature for 30 min using T4 DNA ligase (NEB, #M0202S) in approximately a 3:1 molar ratio.

    Article Title: Cdc42 and k-Ras Control Endothelial Tubulogenesis through Apical Membrane and Cytoskeletal Polarization: Novel Stimulatory Roles for GTPase Effectors, the Small GTPases, Rac2 and Rap1b, and Inhibitory Influence of Arhgap31 and Rasa1
    Article Snippet: Generation of S-epitope tagged Cherry, Cherry-fusion proteins, and AcGFP-Rasip1 adenoviruses Cdc42, Rac1, Rac2, RhoA, k-Ras, and Rap1b were amplified from cDNA obtained from Missouri S & T cDNA Resource Center (Rolla, MO) and human Rasip1 and PKCɛ were amplified from cDNA obtained from Open Biosystems (Open Biosystems, GE Dharmacon, Lafayette, CO), and standard restriction digest cloning for individual GTPases and PKCɛ into pmCherry-C1 plasmid and Rasip1 into pAcGFP-C1 (Clontech, Mountain View, CA) using EcoRI-HF and BamHI-HF , XhoI and BamHI-HF , and EcoRI-HF and XbaI restriction enzymes respectively (New England Biolabs). .. Amplified S-Cherry, S-Ch-GTPase, S-Ch-PKCɛ, and AcGFP-Rasip1 constructs were subcloned into pShuttle-CMV expression plasmid using NotI-HF , XbaI , XhoI , KpnI-HF and SalI-HF restriction enzymes, respectively (New England Biolabs). .. Recombinant adenoviral vectors were then generated [ ] and propagated as previously described [ ].

    Purification:

    Article Title: gbpA and chiA genes are not uniformly distributed amongst diverse Vibrio cholerae
    Article Snippet: .. The amplicon was purified and digested using 30 units of SacI-HF and SalI-HF (NEB, #R3156S and R3138S respectively) at 37 °C for 45 min. pBAD33 was similarly treated with SacI-HF and SalI-HF, and after 15 min incubation at 37 °C, the plasmid digestion was supplemented with 1.5 units of recombinant shrimp alkaline phosphatase (rSAP; NEB #M0371S). .. Digested insert and vector were purified and ligated together at room temperature for 30 min using T4 DNA ligase (NEB, #M0202S) in approximately a 3:1 molar ratio.

    Article Title: Non-NAD-like PARP-1 inhibitors in prostate cancer treatment
    Article Snippet: Following PCR primers were used: T7 F: GTAATACGACTCACTATAGGGC and hPARG SalI R: TTATGTCGACTGGTCCCTGTCCTTTGCCCTG. .. The PCR fragment was digested with SalI HF (R3138, New England Biolab, USA) and SmaI (R0141, New England Biolab, USA), purified with Qiaquick PCR purification kit (28104, Qiagen, The Netherlands). .. The vector pEYFP-N3 (Clontech, USA) were cut with Hind III, then treated with Klenow (M0210L, New England Biolab, USA) according to product manual, purified with Qiaquick PCR purification kit, digested with SalI HF, purified with Qiaquick PCR purification kit again.

    Incubation:

    Article Title: gbpA and chiA genes are not uniformly distributed amongst diverse Vibrio cholerae
    Article Snippet: .. The amplicon was purified and digested using 30 units of SacI-HF and SalI-HF (NEB, #R3156S and R3138S respectively) at 37 °C for 45 min. pBAD33 was similarly treated with SacI-HF and SalI-HF, and after 15 min incubation at 37 °C, the plasmid digestion was supplemented with 1.5 units of recombinant shrimp alkaline phosphatase (rSAP; NEB #M0371S). .. Digested insert and vector were purified and ligated together at room temperature for 30 min using T4 DNA ligase (NEB, #M0202S) in approximately a 3:1 molar ratio.

    Recombinant:

    Article Title: gbpA and chiA genes are not uniformly distributed amongst diverse Vibrio cholerae
    Article Snippet: .. The amplicon was purified and digested using 30 units of SacI-HF and SalI-HF (NEB, #R3156S and R3138S respectively) at 37 °C for 45 min. pBAD33 was similarly treated with SacI-HF and SalI-HF, and after 15 min incubation at 37 °C, the plasmid digestion was supplemented with 1.5 units of recombinant shrimp alkaline phosphatase (rSAP; NEB #M0371S). .. Digested insert and vector were purified and ligated together at room temperature for 30 min using T4 DNA ligase (NEB, #M0202S) in approximately a 3:1 molar ratio.

    Expressing:

    Article Title: Cdc42 and k-Ras Control Endothelial Tubulogenesis through Apical Membrane and Cytoskeletal Polarization: Novel Stimulatory Roles for GTPase Effectors, the Small GTPases, Rac2 and Rap1b, and Inhibitory Influence of Arhgap31 and Rasa1
    Article Snippet: Generation of S-epitope tagged Cherry, Cherry-fusion proteins, and AcGFP-Rasip1 adenoviruses Cdc42, Rac1, Rac2, RhoA, k-Ras, and Rap1b were amplified from cDNA obtained from Missouri S & T cDNA Resource Center (Rolla, MO) and human Rasip1 and PKCɛ were amplified from cDNA obtained from Open Biosystems (Open Biosystems, GE Dharmacon, Lafayette, CO), and standard restriction digest cloning for individual GTPases and PKCɛ into pmCherry-C1 plasmid and Rasip1 into pAcGFP-C1 (Clontech, Mountain View, CA) using EcoRI-HF and BamHI-HF , XhoI and BamHI-HF , and EcoRI-HF and XbaI restriction enzymes respectively (New England Biolabs). .. Amplified S-Cherry, S-Ch-GTPase, S-Ch-PKCɛ, and AcGFP-Rasip1 constructs were subcloned into pShuttle-CMV expression plasmid using NotI-HF , XbaI , XhoI , KpnI-HF and SalI-HF restriction enzymes, respectively (New England Biolabs). .. Recombinant adenoviral vectors were then generated [ ] and propagated as previously described [ ].

    Polymerase Chain Reaction:

    Article Title: Non-NAD-like PARP-1 inhibitors in prostate cancer treatment
    Article Snippet: Following PCR primers were used: T7 F: GTAATACGACTCACTATAGGGC and hPARG SalI R: TTATGTCGACTGGTCCCTGTCCTTTGCCCTG. .. The PCR fragment was digested with SalI HF (R3138, New England Biolab, USA) and SmaI (R0141, New England Biolab, USA), purified with Qiaquick PCR purification kit (28104, Qiagen, The Netherlands). .. The vector pEYFP-N3 (Clontech, USA) were cut with Hind III, then treated with Klenow (M0210L, New England Biolab, USA) according to product manual, purified with Qiaquick PCR purification kit, digested with SalI HF, purified with Qiaquick PCR purification kit again.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • pbad33  (New England Biolabs)
    95
    New England Biolabs pbad33
    Molecular cloning of chiA-3 and expression of ChiA-3-6xHis. (a): Schematic of cloning strategy used to amplify and insert chiA-3 directionally into the <t>pBAD33</t> multiple cloning site (MCS), under the arabinose-inducible P BAD promoter, and to incorporate a C-terminal 6xHis tag as a translational fusion. A linker sequence was not incorporated between the C-terminus of ChiA-3 and the 6xHis tag. Figures are not to scale. (b): InstantBlue-stained acrylamide gel of proteins present in supernatants and cell pellet lysates from cultures grown at 23 °C supplemented with arabinose (induction +) or glucose (induction -). No induced bands were easily discerned. (c): Western immunoblot produced from an identically-loaded acrylamide gel to that presented in (b), run in parallel with the gel in (b), and probed with an α-6xHis antibody (see Methods). A band corresponding to the expected molecular weight of ChiA-3-6xHis (48.51 kDa) was detected in the cell pellet lysate of E. coli harbouring pMJD157 only (plasmid +). This size is consistent with the retention of the fusion protein without the cleavage of the putative signal sequence. Protein ladders: NEB #P7719S and #P7717S. EV = empty vector (pBAD33).
    Pbad33, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pbad33/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pbad33 - by Bioz Stars, 2021-07
    95/100 stars
    		  Buy from Supplier
    bamhi hf  (New England Biolabs)
    99
    New England Biolabs bamhi hf
    Molecular cloning of chiA-3 and expression of ChiA-3-6xHis. (a): Schematic of cloning strategy used to amplify and insert chiA-3 directionally into the <t>pBAD33</t> multiple cloning site (MCS), under the arabinose-inducible P BAD promoter, and to incorporate a C-terminal 6xHis tag as a translational fusion. A linker sequence was not incorporated between the C-terminus of ChiA-3 and the 6xHis tag. Figures are not to scale. (b): InstantBlue-stained acrylamide gel of proteins present in supernatants and cell pellet lysates from cultures grown at 23 °C supplemented with arabinose (induction +) or glucose (induction -). No induced bands were easily discerned. (c): Western immunoblot produced from an identically-loaded acrylamide gel to that presented in (b), run in parallel with the gel in (b), and probed with an α-6xHis antibody (see Methods). A band corresponding to the expected molecular weight of ChiA-3-6xHis (48.51 kDa) was detected in the cell pellet lysate of E. coli harbouring pMJD157 only (plasmid +). This size is consistent with the retention of the fusion protein without the cleavage of the putative signal sequence. Protein ladders: NEB #P7719S and #P7717S. EV = empty vector (pBAD33).
    Bamhi Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi hf/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bamhi hf - by Bioz Stars, 2021-07
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Molecular cloning of chiA-3 and expression of ChiA-3-6xHis. (a): Schematic of cloning strategy used to amplify and insert chiA-3 directionally into the pBAD33 multiple cloning site (MCS), under the arabinose-inducible P BAD promoter, and to incorporate a C-terminal 6xHis tag as a translational fusion. A linker sequence was not incorporated between the C-terminus of ChiA-3 and the 6xHis tag. Figures are not to scale. (b): InstantBlue-stained acrylamide gel of proteins present in supernatants and cell pellet lysates from cultures grown at 23 °C supplemented with arabinose (induction +) or glucose (induction -). No induced bands were easily discerned. (c): Western immunoblot produced from an identically-loaded acrylamide gel to that presented in (b), run in parallel with the gel in (b), and probed with an α-6xHis antibody (see Methods). A band corresponding to the expected molecular weight of ChiA-3-6xHis (48.51 kDa) was detected in the cell pellet lysate of E. coli harbouring pMJD157 only (plasmid +). This size is consistent with the retention of the fusion protein without the cleavage of the putative signal sequence. Protein ladders: NEB #P7719S and #P7717S. EV = empty vector (pBAD33).

    Journal: bioRxiv

    Article Title: gbpA and chiA genes are not uniformly distributed amongst diverse Vibrio cholerae

    doi: 10.1101/2021.02.11.430729

    Figure Lengend Snippet: Molecular cloning of chiA-3 and expression of ChiA-3-6xHis. (a): Schematic of cloning strategy used to amplify and insert chiA-3 directionally into the pBAD33 multiple cloning site (MCS), under the arabinose-inducible P BAD promoter, and to incorporate a C-terminal 6xHis tag as a translational fusion. A linker sequence was not incorporated between the C-terminus of ChiA-3 and the 6xHis tag. Figures are not to scale. (b): InstantBlue-stained acrylamide gel of proteins present in supernatants and cell pellet lysates from cultures grown at 23 °C supplemented with arabinose (induction +) or glucose (induction -). No induced bands were easily discerned. (c): Western immunoblot produced from an identically-loaded acrylamide gel to that presented in (b), run in parallel with the gel in (b), and probed with an α-6xHis antibody (see Methods). A band corresponding to the expected molecular weight of ChiA-3-6xHis (48.51 kDa) was detected in the cell pellet lysate of E. coli harbouring pMJD157 only (plasmid +). This size is consistent with the retention of the fusion protein without the cleavage of the putative signal sequence. Protein ladders: NEB #P7719S and #P7717S. EV = empty vector (pBAD33).

    Article Snippet: The amplicon was purified and digested using 30 units of SacI-HF and SalI-HF (NEB, #R3156S and R3138S respectively) at 37 °C for 45 min. pBAD33 was similarly treated with SacI-HF and SalI-HF, and after 15 min incubation at 37 °C, the plasmid digestion was supplemented with 1.5 units of recombinant shrimp alkaline phosphatase (rSAP; NEB #M0371S).

    Techniques: Molecular Cloning, Expressing, Clone Assay, Sequencing, Staining, Acrylamide Gel Assay, Western Blot, Produced, Molecular Weight, Plasmid Preparation

    EFF-1 in BWM enables VSVΔG-AFF-1 and VSVΔG-G spreading along fused muscles (A-L) Z-stack projections of wt-like (A-F) and Unc+Dpy animals (G-L) expressing myo-3p:: EFF-1 and myo-3p:: mCherry infected with VSVΔG-AFF-1 (35-63 IU red pins) or VSVΔG-G (3*10 5 IU; white pins). Insets and their corresponding images (yellow frames). Arrows, individual infected (cyan) BWMs. Dashed lines outline grouped BWMs that express myo-3p ::mCherry and myo-3p:: EFF-1 (magenta) and infected with virus (cyan) showing spreading of GFP. Scale bars, 100 µm. (M-N) Number of BWM cells/worm expressing EFF-1 (magenta cell), infected (cyan cell) or expressing EFF-1 and infected (magenta and cyan). wt-like (circles) and Unc+Dpy (triangles). Each point represents a single worm. (O-P) Quantitation of multinucleation of infected BWMs. Each dot represents an average number of nuclei/ GFP(+) BWM, calculated from 1-6 multinucleated BWMs of a single worm. (M and O) wt-like n=6 and Unc+Dpy n=10 animals. (N and P) wt-like n=9 and Unc+Dpy n=7 animals. Black horizontal lines, average ± SEM. Student’s t-test, *** p

    Journal: bioRxiv

    Article Title: Tissue-specific delivery system via AFF-1-coated pseudotyped Vesicular Stomatitis Virus in C. elegans

    doi: 10.1101/2020.05.17.099622

    Figure Lengend Snippet: EFF-1 in BWM enables VSVΔG-AFF-1 and VSVΔG-G spreading along fused muscles (A-L) Z-stack projections of wt-like (A-F) and Unc+Dpy animals (G-L) expressing myo-3p:: EFF-1 and myo-3p:: mCherry infected with VSVΔG-AFF-1 (35-63 IU red pins) or VSVΔG-G (3*10 5 IU; white pins). Insets and their corresponding images (yellow frames). Arrows, individual infected (cyan) BWMs. Dashed lines outline grouped BWMs that express myo-3p ::mCherry and myo-3p:: EFF-1 (magenta) and infected with virus (cyan) showing spreading of GFP. Scale bars, 100 µm. (M-N) Number of BWM cells/worm expressing EFF-1 (magenta cell), infected (cyan cell) or expressing EFF-1 and infected (magenta and cyan). wt-like (circles) and Unc+Dpy (triangles). Each point represents a single worm. (O-P) Quantitation of multinucleation of infected BWMs. Each dot represents an average number of nuclei/ GFP(+) BWM, calculated from 1-6 multinucleated BWMs of a single worm. (M and O) wt-like n=6 and Unc+Dpy n=10 animals. (N and P) wt-like n=9 and Unc+Dpy n=7 animals. Black horizontal lines, average ± SEM. Student’s t-test, *** p

    Article Snippet: DNA constructs The myo-3p ::EFF-1 plasmid was constructed by cloning the myo-3 promoter region from myo-3p ::mCherry plasmid with Sal I (New England BioLabs Cat#R3138) and Nhe I (ThermoFisher Cat# FD0974) and inserting it into the hsp16-2 :: EFF-1 plasmid cut with the same enzymes to replace the original heat shock promoter.

    Techniques: Expressing, Infection, Quantitation Assay

    EFF-1 ectopic expression in BWMs results in Uncoordinated and Dumpy (Unc+Dpy) phenotypes Mixed population of worms with extrachromosomal pmyo-3::mCherry and pmyo-3::EFF-1 . White arrowhead point to mCherry(+) worm that is Unc+Dpy. White arrow point to mCherry(+) worm that is wt-like. Yellow arrowhead points to a wt-like mCherry(-) worm, which left the frame within seconds. Elapsed time (seconds) indicated in top left corner.

    Journal: bioRxiv

    Article Title: Tissue-specific delivery system via AFF-1-coated pseudotyped Vesicular Stomatitis Virus in C. elegans

    doi: 10.1101/2020.05.17.099622

    Figure Lengend Snippet: EFF-1 ectopic expression in BWMs results in Uncoordinated and Dumpy (Unc+Dpy) phenotypes Mixed population of worms with extrachromosomal pmyo-3::mCherry and pmyo-3::EFF-1 . White arrowhead point to mCherry(+) worm that is Unc+Dpy. White arrow point to mCherry(+) worm that is wt-like. Yellow arrowhead points to a wt-like mCherry(-) worm, which left the frame within seconds. Elapsed time (seconds) indicated in top left corner.

    Article Snippet: DNA constructs The myo-3p ::EFF-1 plasmid was constructed by cloning the myo-3 promoter region from myo-3p ::mCherry plasmid with Sal I (New England BioLabs Cat#R3138) and Nhe I (ThermoFisher Cat# FD0974) and inserting it into the hsp16-2 :: EFF-1 plasmid cut with the same enzymes to replace the original heat shock promoter.

    Techniques: Expressing

    EFF-1 expression in BWMs produces Unc+Dpy worms with multinucleated cells (A-H) Images of fluorescent Z-stack projections and respective DIC of animals with extrachromosomal myo-3p ::EFF-1, myo-3p ::mCherry. (G) White arrowhead, bridge formed between 2 BWMs from opposing quadrants. Yellow arrows, myo-3p ::mCherry accumulations also in DIC (H). Asterisks, clustered nuclei within one BWM. Scale bars, 100 µm. (I) Number of nuclei per myo-3p ::mCherry (+) BWM cell in L2s. wt-like (n=12); Unc+Dpy (n=15). Each dot represents the average number of nuclei/BWM cell/worm. Total average ± SEM for each phenotype. Two tailed Student’s t-test p

    Journal: bioRxiv

    Article Title: Tissue-specific delivery system via AFF-1-coated pseudotyped Vesicular Stomatitis Virus in C. elegans

    doi: 10.1101/2020.05.17.099622

    Figure Lengend Snippet: EFF-1 expression in BWMs produces Unc+Dpy worms with multinucleated cells (A-H) Images of fluorescent Z-stack projections and respective DIC of animals with extrachromosomal myo-3p ::EFF-1, myo-3p ::mCherry. (G) White arrowhead, bridge formed between 2 BWMs from opposing quadrants. Yellow arrows, myo-3p ::mCherry accumulations also in DIC (H). Asterisks, clustered nuclei within one BWM. Scale bars, 100 µm. (I) Number of nuclei per myo-3p ::mCherry (+) BWM cell in L2s. wt-like (n=12); Unc+Dpy (n=15). Each dot represents the average number of nuclei/BWM cell/worm. Total average ± SEM for each phenotype. Two tailed Student’s t-test p

    Article Snippet: DNA constructs The myo-3p ::EFF-1 plasmid was constructed by cloning the myo-3 promoter region from myo-3p ::mCherry plasmid with Sal I (New England BioLabs Cat#R3138) and Nhe I (ThermoFisher Cat# FD0974) and inserting it into the hsp16-2 :: EFF-1 plasmid cut with the same enzymes to replace the original heat shock promoter.

    Techniques: Expressing, Two Tailed Test

    VSVΔG-AFF-1 does not infect PVD and other sensory neurons ectopically expressing AFF-1/EFF-1 (A-C) SDC microscope Z-stack projections of animals infected with 82-103 IU VSVΔG-AFF-1 (red pins). (For genotypes and quantitation see Table S2 ). Scale bar, 100 µm. (A) Young adult expressing mCherry in PVD. (B) eff-1(ts) adult expressing AFF-1 in PVD. (C) eff-1(ts) adult expressing EFF-1 and dsRed in 12 sensory neurons. See also Table S2 and Movie S2 .

    Journal: bioRxiv

    Article Title: Tissue-specific delivery system via AFF-1-coated pseudotyped Vesicular Stomatitis Virus in C. elegans

    doi: 10.1101/2020.05.17.099622

    Figure Lengend Snippet: VSVΔG-AFF-1 does not infect PVD and other sensory neurons ectopically expressing AFF-1/EFF-1 (A-C) SDC microscope Z-stack projections of animals infected with 82-103 IU VSVΔG-AFF-1 (red pins). (For genotypes and quantitation see Table S2 ). Scale bar, 100 µm. (A) Young adult expressing mCherry in PVD. (B) eff-1(ts) adult expressing AFF-1 in PVD. (C) eff-1(ts) adult expressing EFF-1 and dsRed in 12 sensory neurons. See also Table S2 and Movie S2 .

    Article Snippet: DNA constructs The myo-3p ::EFF-1 plasmid was constructed by cloning the myo-3 promoter region from myo-3p ::mCherry plasmid with Sal I (New England BioLabs Cat#R3138) and Nhe I (ThermoFisher Cat# FD0974) and inserting it into the hsp16-2 :: EFF-1 plasmid cut with the same enzymes to replace the original heat shock promoter.

    Techniques: Expressing, Microscopy, Infection, Quantitation Assay

    EFF-1 expression in BWMs induces their fusion ( A-C ) Confocal images of wt-like adult worms with membrane bound ( MB ) myo-3p::MB::YFP (cyan) and extrachromosomal array containing myo-3p:: EFF-1, myo-3p:: mCherry (magenta). ( D-F ) Confocal images of Unc+Dpy [ myo-3p::MB::YFP (cyan); myo-3p::EFF-1, myo-3p::mCherry] . Arrows, unfused BWMs with MB (cyan). Note only two unfused BWMs, all the others appear fused with no MB separating them. Insets correspond to white-dotted area. Scale bars 100 µm. See also Movie S1.

    Journal: bioRxiv

    Article Title: Tissue-specific delivery system via AFF-1-coated pseudotyped Vesicular Stomatitis Virus in C. elegans

    doi: 10.1101/2020.05.17.099622

    Figure Lengend Snippet: EFF-1 expression in BWMs induces their fusion ( A-C ) Confocal images of wt-like adult worms with membrane bound ( MB ) myo-3p::MB::YFP (cyan) and extrachromosomal array containing myo-3p:: EFF-1, myo-3p:: mCherry (magenta). ( D-F ) Confocal images of Unc+Dpy [ myo-3p::MB::YFP (cyan); myo-3p::EFF-1, myo-3p::mCherry] . Arrows, unfused BWMs with MB (cyan). Note only two unfused BWMs, all the others appear fused with no MB separating them. Insets correspond to white-dotted area. Scale bars 100 µm. See also Movie S1.

    Article Snippet: DNA constructs The myo-3p ::EFF-1 plasmid was constructed by cloning the myo-3 promoter region from myo-3p ::mCherry plasmid with Sal I (New England BioLabs Cat#R3138) and Nhe I (ThermoFisher Cat# FD0974) and inserting it into the hsp16-2 :: EFF-1 plasmid cut with the same enzymes to replace the original heat shock promoter.

    Techniques: Expressing

    Retargeting of VSVΔG-AFF-1 to body wall muscle cells Wild-type worms and animals with extrachromosomal array containing myo-3p:: EFF-1 and myo-3p:: mCherry were injected with VSVΔG-AFF-1 (35-63 IU, red pins; n=39 wt, n=50 wt-like and n=27 Unc+Dpy worms) or VSVΔG-G (3*10 5 IU, white pins; n=30 wt-like and 14 Unc+Dpy) respectively. Wt worms injected with VSVΔG-G (2300-4700 IU, n=56) were taken from figure 2I . Animals were analysed by SDC microscopy. Data represents average percentage of worms with GFP(+) BWMs ± SEM. Student’s t-test: *p

    Journal: bioRxiv

    Article Title: Tissue-specific delivery system via AFF-1-coated pseudotyped Vesicular Stomatitis Virus in C. elegans

    doi: 10.1101/2020.05.17.099622

    Figure Lengend Snippet: Retargeting of VSVΔG-AFF-1 to body wall muscle cells Wild-type worms and animals with extrachromosomal array containing myo-3p:: EFF-1 and myo-3p:: mCherry were injected with VSVΔG-AFF-1 (35-63 IU, red pins; n=39 wt, n=50 wt-like and n=27 Unc+Dpy worms) or VSVΔG-G (3*10 5 IU, white pins; n=30 wt-like and 14 Unc+Dpy) respectively. Wt worms injected with VSVΔG-G (2300-4700 IU, n=56) were taken from figure 2I . Animals were analysed by SDC microscopy. Data represents average percentage of worms with GFP(+) BWMs ± SEM. Student’s t-test: *p

    Article Snippet: DNA constructs The myo-3p ::EFF-1 plasmid was constructed by cloning the myo-3 promoter region from myo-3p ::mCherry plasmid with Sal I (New England BioLabs Cat#R3138) and Nhe I (ThermoFisher Cat# FD0974) and inserting it into the hsp16-2 :: EFF-1 plasmid cut with the same enzymes to replace the original heat shock promoter.

    Techniques: Injection, Microscopy