nhei  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    NheI HF
    Description:
    NheI HF 5 000 units
    Catalog Number:
    r3131l
    Price:
    277
    Size:
    5 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs nhei
    NheI HF
    NheI HF 5 000 units
    https://www.bioz.com/result/nhei/product/New England Biolabs
    Average 90 stars, based on 175 article reviews
    Price from $9.99 to $1999.99
    nhei - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Rational design of a Kv1.3 channel-blocking antibody as a selective immunosuppressant
    Article Snippet: Paragraph title: Cloning of Antibody Expression Vector. ... The fusion gene fragments were assembled by overlap extension PCR and digested with the restriction enzymes EcoRI-HF and NheI-HF (New England Biolabs), followed by DNA gel extraction.

    Article Title: Yeast surface display platform for rapid discovery of conformationally selective nanobodies
    Article Snippet: Validation of the biochemical tractability of these synthetic nanobodies was carried out in Escherichia coli by amplifying the resulting mixture with primers pET26b_NbLib_GA_for and pET26b_NbLib_GA_rev and cloning into pET26b. .. 500 mL of BJ5465 yeast (MAT a ura352 trp1 leu2Δ1 his3Δ200 pep4::HIS3 prb1Δ1.6R can1 GAL) were grown to OD600 1.5 and transformed with 245 μg nanobody insert DNA and 50 μg of pYDS649 plasmid, digested with NheI-HF and BamHI-HF (New England BioLabs), using an ECM 830 Electroporator (BTX-Harvard Apparatus).

    Article Title: Upstream sequence-dependent suppression and AtxA-dependent activation of protective antigens in Bacillus anthracis
    Article Snippet: The atxA gene was amplified by polymerase chain reaction (PCR) using two primers with a restriction enzyme site, namely KpnI-AtxA-F and NheI-AtxA-R, and was then cloned into the pGEM-T-easy plasmid (Promega, Madison, WI, USA) according to manufacturer’s protocol ( ). .. After digestion by KpnI-HF (NEB, Ipswich, MA, USA) and NheI-HF (NEB, Ipswich, MA, USA), the full length of the atxA gene was inserted into a bait plasmid, pB1H2-ω2 (Addgene plasmid # 18038) ( ) and digested by KpnI-HF and XbaI (NEB, Ipswich, MA, USA); this construct expresses AtxA with the omega subunit of bacterial RNA polymerase.

    Article Title: CRISPR Activation Enhances In Vitro Potency of AAV Vectors Driven by Tissue-Specific Promoters
    Article Snippet: In addition, the CMV promoter cassette was removed by digestion with NheI-HF and SpeI-HF (NEB) and replaced with the GRK1 or CAR promoter sequences. .. Guide RNA sequences targeting either promoter were cloned between the SapI sites between the U6 promoter and scaffold.

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were contransformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified before experiments.

    Article Title: Detailed investigations of proximal tubular function in Imerslund-Gr?sbeck syndrome
    Article Snippet: .. Amplification products were cloned into expression vectors (pcDNA™ 3.1(+); Invitrogen, Taastrup, Denmark) using NheI-HF™ and Xho I restriction enzymes (New England Biolabs, Medinova Scientific A/S, Glostrup, Denmark) according to manufacturer’s guidelines (wt gAMN8-12 and del gAMN8-12) and subsequently transformed into competent cells (One Shot® TOP10; Invitrogen) for propagation. .. CHO-K1 cells were transiently transfected with either wt gAMN8-12 or del gAMN8-12 plasmids in duplicates and total RNA was isolated 48 hours after transfection (RNeasy Mini Kit; Qiagen, Ballerup, Denmark).

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: In short, libraries for in vivo screening were cloned by homologues recombination in yeast. .. Target vector pWHE601* was digested using AgeI-HF and NheI-HF (both NEB) and transformed into RS463α with a 10-molar excess of insert using Frozen-EZ Yeast Transformation II Kit (Zymo Research).

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: Paragraph title: Cloning and plasmids ... After restriction digest with NheI-HF and XhoI (NEB) of both the PCR product and pGL3 Enhancer vector (Promega), fragments were ligated at 4 °C overnight with T4 ligase (NEB).

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: Paragraph title: Plasmid cloning and doped pool generation ... The resulting PCR product was purified (QIAquick PCR Purification Kit, Qiagen), digested with AgeI-HF and NheI-HF (NEB) and ligated into equally digested pWHE601* with T4 DNA Ligase (NEB).

    Article Title: Reduction of nonspecificity motifs in synthetic antibody libraries
    Article Snippet: The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were co-transformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified prior to experiments.

    Amplification:

    Article Title: Rational design of a Kv1.3 channel-blocking antibody as a selective immunosuppressant
    Article Snippet: The DNA fragments encoding the heavy chains and light chains of Syn and BVK, along with the linkers (coiled-coil or β-strand) ( , ) were also synthesized by IDT and amplified by PCR. .. The fusion gene fragments were assembled by overlap extension PCR and digested with the restriction enzymes EcoRI-HF and NheI-HF (New England Biolabs), followed by DNA gel extraction.

    Article Title: Yeast surface display platform for rapid discovery of conformationally selective nanobodies
    Article Snippet: The nanobody DNA library pool was successively amplified for yeast transformations with pYDSFor1-pYDSRev1, pyDSFor2-pYDSRev2, and pYDSFor3-pYDSRev2 primers. .. 500 mL of BJ5465 yeast (MAT a ura352 trp1 leu2Δ1 his3Δ200 pep4::HIS3 prb1Δ1.6R can1 GAL) were grown to OD600 1.5 and transformed with 245 μg nanobody insert DNA and 50 μg of pYDS649 plasmid, digested with NheI-HF and BamHI-HF (New England BioLabs), using an ECM 830 Electroporator (BTX-Harvard Apparatus).

    Article Title: Upstream sequence-dependent suppression and AtxA-dependent activation of protective antigens in Bacillus anthracis
    Article Snippet: The atxA gene was amplified by polymerase chain reaction (PCR) using two primers with a restriction enzyme site, namely KpnI-AtxA-F and NheI-AtxA-R, and was then cloned into the pGEM-T-easy plasmid (Promega, Madison, WI, USA) according to manufacturer’s protocol ( ). .. After digestion by KpnI-HF (NEB, Ipswich, MA, USA) and NheI-HF (NEB, Ipswich, MA, USA), the full length of the atxA gene was inserted into a bait plasmid, pB1H2-ω2 (Addgene plasmid # 18038) ( ) and digested by KpnI-HF and XbaI (NEB, Ipswich, MA, USA); this construct expresses AtxA with the omega subunit of bacterial RNA polymerase.

    Article Title: CRISPR Activation Enhances In Vitro Potency of AAV Vectors Driven by Tissue-Specific Promoters
    Article Snippet: The eGFP-KASH coding sequence was removed by digestion with AgeI-HF and EcoRI-HIF (NEB, Ipswich, MA, USA) and the wild-type eGFP sequence was amplified and restored between these sites. .. In addition, the CMV promoter cassette was removed by digestion with NheI-HF and SpeI-HF (NEB) and replaced with the GRK1 or CAR promoter sequences.

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: The fragment before and containing the H2 was amplified with the pCTFwd Recomb and appropriate PreH2 primers, and the fragment after and also containing the H2 was amplified using the pcTRev Recomb and proper PostH2 primers (Primer sequences in Supplementary Table 1). .. The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs).

    Article Title: Detailed investigations of proximal tubular function in Imerslund-Gr?sbeck syndrome
    Article Snippet: .. Amplification products were cloned into expression vectors (pcDNA™ 3.1(+); Invitrogen, Taastrup, Denmark) using NheI-HF™ and Xho I restriction enzymes (New England Biolabs, Medinova Scientific A/S, Glostrup, Denmark) according to manufacturer’s guidelines (wt gAMN8-12 and del gAMN8-12) and subsequently transformed into competent cells (One Shot® TOP10; Invitrogen) for propagation. .. CHO-K1 cells were transiently transfected with either wt gAMN8-12 or del gAMN8-12 plasmids in duplicates and total RNA was isolated 48 hours after transfection (RNeasy Mini Kit; Qiagen, Ballerup, Denmark).

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: For that, RT-PCR product of a defined round was amplified with CFX_HR_fwd (5′-CAA GCT ATA CCA AGC ATA CAA TCA ACT CCA AGC TAG ATC TAC CGG TGG GAG ACG CAA CTG AAT GAA-3′) and CFX_HR_rev (5′-CAA GAA TTG GGA CAA CTC CAG TGA AAA GTT CTT CTC CTT TGC TAG CGT GAC GCG ACT AGT TAC GGA-3′) to attach 46 bp overhang for recombination into pWHE601*. .. Target vector pWHE601* was digested using AgeI-HF and NheI-HF (both NEB) and transformed into RS463α with a 10-molar excess of insert using Frozen-EZ Yeast Transformation II Kit (Zymo Research).

    Article Title: Engineered charge redistribution of Gp2 proteins through guided diversity for improved PET imaging of epidermal growth factor receptor
    Article Snippet: .. Gp2-encoding regions in DNA recovered from the final lysate-extracted EGFR flow cytometry sort were amplified by polymerase chain reaction, digested with NheI-HF and BamHI-HF restriction enzymes (New England Biolabs, Ipswich, MA), and ligated into a pET-22b vector containing a C-terminal hexa-histidine (Novagen, EMD Millipore, Billerica, MA) with T4 DNA ligase (New England Biolabs). .. Plasmids were transformed via heat-shock into T7 Express Competent E. coli (New England Biolabs) and proper transformants selected on lysogeny broth (LB) plates containing 50 mg/L kanamycin.

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: Intron 1 of axolotl Col1a1 and intron 1 of Col12a1 were PCR amplified from genomic DNA using the primers listed below. .. After restriction digest with NheI-HF and XhoI (NEB) of both the PCR product and pGL3 Enhancer vector (Promega), fragments were ligated at 4 °C overnight with T4 ligase (NEB).

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: For cloning, two 30 bp overlapping oligonucleotides were designed and amplified using Q5® High-Fidelity DNA polymerase (NEB) according to the supplier's instructions. .. The resulting PCR product was purified (QIAquick PCR Purification Kit, Qiagen), digested with AgeI-HF and NheI-HF (NEB) and ligated into equally digested pWHE601* with T4 DNA Ligase (NEB).

    Article Title: Towards conformational fidelity of a quaternary HIV-1 epitope: computational design and directed evolution of a minimal V1V2 antigen
    Article Snippet: Products from this epPCR reaction were purified (Geneaid) and subjected to a second round of standard amplification using Phusion polymerase. .. Vector (250 μg of pCT) was prepared by restricting with BamHI-HF and NheI-HF (NEB).

    Article Title: Reduction of nonspecificity motifs in synthetic antibody libraries
    Article Snippet: For each motif, all positional variants of the H3-containing fragment were amplified with the pCTCON2 RecombFwd and appropriate PreH3 primers, and the fragment after and also containing the H3 was amplified using the pCTCON2 RecombRev and proper PostH3 primers (Primer sequences in ). .. The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs).

    Synthesized:

    Article Title: Rational design of a Kv1.3 channel-blocking antibody as a selective immunosuppressant
    Article Snippet: The DNA fragments encoding the heavy chains and light chains of Syn and BVK, along with the linkers (coiled-coil or β-strand) ( , ) were also synthesized by IDT and amplified by PCR. .. The fusion gene fragments were assembled by overlap extension PCR and digested with the restriction enzymes EcoRI-HF and NheI-HF (New England Biolabs), followed by DNA gel extraction.

    TA Cloning:

    Article Title: Detailed investigations of proximal tubular function in Imerslund-Gr?sbeck syndrome
    Article Snippet: Amplification products were cloned into expression vectors (pcDNA™ 3.1(+); Invitrogen, Taastrup, Denmark) using NheI-HF™ and Xho I restriction enzymes (New England Biolabs, Medinova Scientific A/S, Glostrup, Denmark) according to manufacturer’s guidelines (wt gAMN8-12 and del gAMN8-12) and subsequently transformed into competent cells (One Shot® TOP10; Invitrogen) for propagation. .. Splicing was analysed by RT-PCR (OneStep RT-PCR kit; Qiagen) using primers 5′-CACCTTCCTGGGTCTGCCTCAGTACC-3′ and 5′-GGCGCCACCAGCAGGACCAGCA-3′ according to manufacturer’s protocol. cDNA amplification products were cloned into vectors (pCR® II-TOPO® using TOPO TA cloning technique, Invitrogen) according to manufacturers protocol for subsequent sequencing.

    Construct:

    Article Title: Rational design of a Kv1.3 channel-blocking antibody as a selective immunosuppressant
    Article Snippet: The fusion gene fragments were assembled by overlap extension PCR and digested with the restriction enzymes EcoRI-HF and NheI-HF (New England Biolabs), followed by DNA gel extraction. .. The final expression vectors for the fusion antibodies were constructed by in-frame ligation of the assembled DNA into the pFuse backbone (Invivogen) using T4 DNA ligase.

    Article Title: Upstream sequence-dependent suppression and AtxA-dependent activation of protective antigens in Bacillus anthracis
    Article Snippet: .. After digestion by KpnI-HF (NEB, Ipswich, MA, USA) and NheI-HF (NEB, Ipswich, MA, USA), the full length of the atxA gene was inserted into a bait plasmid, pB1H2-ω2 (Addgene plasmid # 18038) ( ) and digested by KpnI-HF and XbaI (NEB, Ipswich, MA, USA); this construct expresses AtxA with the omega subunit of bacterial RNA polymerase. .. For the control transcription factor, pB1H2-ωL-Prd (Addgene plasmid # 18040), a bait plasmid expressing Paired, a well-characterized transcription factor, was used ( ).

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: Designed overlap sequences were located at the two ends of the scFv construct as well as directly in the H2 region. .. The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs).

    Article Title: Detailed investigations of proximal tubular function in Imerslund-Gr?sbeck syndrome
    Article Snippet: Paragraph title: Established constructs ... Amplification products were cloned into expression vectors (pcDNA™ 3.1(+); Invitrogen, Taastrup, Denmark) using NheI-HF™ and Xho I restriction enzymes (New England Biolabs, Medinova Scientific A/S, Glostrup, Denmark) according to manufacturer’s guidelines (wt gAMN8-12 and del gAMN8-12) and subsequently transformed into competent cells (One Shot® TOP10; Invitrogen) for propagation.

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol. .. The inserts were constructed with PCR using primers that encoded the peptide sequence flanked with at least 40 bp of the plasmid sequence on either side of the insertion site.

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: Primers: For-GGGGACAAGTTTGTACAAAAAAGCAGGCTgccaccatggactacaaagacg Rev-GGGGACCACTTTGTACAAGAAAGCTGGGTctagatcacaccttcctcttct COLL1A, COLXII and SALL4 constructs. .. After restriction digest with NheI-HF and XhoI (NEB) of both the PCR product and pGL3 Enhancer vector (Promega), fragments were ligated at 4 °C overnight with T4 ligase (NEB).

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: The resulting PCR product was purified (QIAquick PCR Purification Kit, Qiagen), digested with AgeI-HF and NheI-HF (NEB) and ligated into equally digested pWHE601* with T4 DNA Ligase (NEB). .. Doped pools were generated using the oligonucleotides AgeI_doped_fwd and NheI_[3.0/4.5/9.0/30.0]_doped_rev ( , Microsynth AG), respectively, with the construct ΔATG as template and amplified using Q5® High-Fidelity DNA polymerase (NEB) according to the supplier's instructions.

    Article Title: Towards conformational fidelity of a quaternary HIV-1 epitope: computational design and directed evolution of a minimal V1V2 antigen
    Article Snippet: Inserts for an sc-(V1V2)3 yeast display library were constructed by error-prone PCR (epPCR) as previously described , aiming for four amino acid mutations per gene. .. Vector (250 μg of pCT) was prepared by restricting with BamHI-HF and NheI-HF (NEB).

    Article Title: Reduction of nonspecificity motifs in synthetic antibody libraries
    Article Snippet: Designed overlap sequences were located at the two ends of the scFv construct as well as directly in the H3 region. .. The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs).

    Incubation:

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: Cells were filtered, washed twice in chilled BSS, resuspended in a 40-fold dilution of allophycocyanin (APC) rat anti-mouse (BD Biosciences) and a 100-fold dilution of phycoerythrin (PE) goat anti-rabbit (Sigma) secondary antibodies in BSS at a volume of 2 mL per 108 cells, and incubated in the dark for 15 min at 4 °C. .. For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol.

    Article Title: Engineered charge redistribution of Gp2 proteins through guided diversity for improved PET imaging of epidermal growth factor receptor
    Article Snippet: Gp2-encoding regions in DNA recovered from the final lysate-extracted EGFR flow cytometry sort were amplified by polymerase chain reaction, digested with NheI-HF and BamHI-HF restriction enzymes (New England Biolabs, Ipswich, MA), and ligated into a pET-22b vector containing a C-terminal hexa-histidine (Novagen, EMD Millipore, Billerica, MA) with T4 DNA ligase (New England Biolabs). .. Surviving colonies were added to 4 mL liquid LB/kanamycin (50 mg/L) and incubated in shake flasks at 37 °C, 250 rpm for 10–16 hours.

    Article Title: A SWI/SNF Chromatin Remodelling Protein Controls Cytokinin Production through the Regulation of Chromatin Architecture
    Article Snippet: Digestions were performed overnight at 37°C with 400U NheI-HF (NEB) for the IPT3 locus, 400U BglII (NEB) for the IPT7 locus or 400U MfeI (NEB) for the KRP7 locus. .. Restriction enzymes were inactivated by addition of 1,6% SDS and incubation at 65°C for 20min.

    Article Title: A new genome-mining tool redefines the lasso peptide biosynthetic landscape
    Article Snippet: .. These fractions were dephosphorylated by the addition of 20 µL of shrimp alkaline phosphatase and incubation at 37 °C for 1 h. DNA fragments were isolated by phenol:chloroform:isoamyl alcohol extraction and air dried for 3 h. The previously reported vector pJK050 was used for fosmid construction . pJK050 was doubly digested with NheI-HF and BamHI-HF (NEB) and dephosphorylated with shrimp alkaline phosphatase. .. Cut vector was purified with a GeneJET PCR Purification Kit (Thermo Scientific).

    Expressing:

    Article Title: Rational design of a Kv1.3 channel-blocking antibody as a selective immunosuppressant
    Article Snippet: Paragraph title: Cloning of Antibody Expression Vector. ... The fusion gene fragments were assembled by overlap extension PCR and digested with the restriction enzymes EcoRI-HF and NheI-HF (New England Biolabs), followed by DNA gel extraction.

    Article Title: Upstream sequence-dependent suppression and AtxA-dependent activation of protective antigens in Bacillus anthracis
    Article Snippet: After digestion by KpnI-HF (NEB, Ipswich, MA, USA) and NheI-HF (NEB, Ipswich, MA, USA), the full length of the atxA gene was inserted into a bait plasmid, pB1H2-ω2 (Addgene plasmid # 18038) ( ) and digested by KpnI-HF and XbaI (NEB, Ipswich, MA, USA); this construct expresses AtxA with the omega subunit of bacterial RNA polymerase. .. For the control transcription factor, pB1H2-ωL-Prd (Addgene plasmid # 18040), a bait plasmid expressing Paired, a well-characterized transcription factor, was used ( ).

    Article Title: Detailed investigations of proximal tubular function in Imerslund-Gr?sbeck syndrome
    Article Snippet: .. Amplification products were cloned into expression vectors (pcDNA™ 3.1(+); Invitrogen, Taastrup, Denmark) using NheI-HF™ and Xho I restriction enzymes (New England Biolabs, Medinova Scientific A/S, Glostrup, Denmark) according to manufacturer’s guidelines (wt gAMN8-12 and del gAMN8-12) and subsequently transformed into competent cells (One Shot® TOP10; Invitrogen) for propagation. .. CHO-K1 cells were transiently transfected with either wt gAMN8-12 or del gAMN8-12 plasmids in duplicates and total RNA was isolated 48 hours after transfection (RNeasy Mini Kit; Qiagen, Ballerup, Denmark).

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: To detect cell surface expression and binding, cells were filtered, washed twice in chilled BSS, resuspended in a 100-fold dilution of primary antibodies [mouse anti-HA (Roche) and rabbit anti-c-myc (Sigma)] in BSS at a volume of 2 mL per 108 cells and incubated for 15 min at 4 °C. .. For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol.

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: Target vector pWHE601* was digested using AgeI-HF and NheI-HF (both NEB) and transformed into RS463α with a 10-molar excess of insert using Frozen-EZ Yeast Transformation II Kit (Zymo Research). .. For the first screening round, cells were selected under the fluorescence binocular and checked for GFP expression.

    Article Title: Engineered charge redistribution of Gp2 proteins through guided diversity for improved PET imaging of epidermal growth factor receptor
    Article Snippet: Gp2-encoding regions in DNA recovered from the final lysate-extracted EGFR flow cytometry sort were amplified by polymerase chain reaction, digested with NheI-HF and BamHI-HF restriction enzymes (New England Biolabs, Ipswich, MA), and ligated into a pET-22b vector containing a C-terminal hexa-histidine (Novagen, EMD Millipore, Billerica, MA) with T4 DNA ligase (New England Biolabs). .. Saturated cultures were added to 100 mL of LB, incubated 37 °C, 250 rpm until reaching an optical density between 0.5 and 1.0 upon which 0.1 mL 0.5 mM isopropyl b-D-1-thiogalactopyranoside was added to induce protein expression.

    Transformation Assay:

    Article Title: Yeast surface display platform for rapid discovery of conformationally selective nanobodies
    Article Snippet: .. 500 mL of BJ5465 yeast (MAT a ura352 trp1 leu2Δ1 his3Δ200 pep4::HIS3 prb1Δ1.6R can1 GAL) were grown to OD600 1.5 and transformed with 245 μg nanobody insert DNA and 50 μg of pYDS649 plasmid, digested with NheI-HF and BamHI-HF (New England BioLabs), using an ECM 830 Electroporator (BTX-Harvard Apparatus). ..

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were contransformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified before experiments.

    Article Title: Detailed investigations of proximal tubular function in Imerslund-Gr?sbeck syndrome
    Article Snippet: .. Amplification products were cloned into expression vectors (pcDNA™ 3.1(+); Invitrogen, Taastrup, Denmark) using NheI-HF™ and Xho I restriction enzymes (New England Biolabs, Medinova Scientific A/S, Glostrup, Denmark) according to manufacturer’s guidelines (wt gAMN8-12 and del gAMN8-12) and subsequently transformed into competent cells (One Shot® TOP10; Invitrogen) for propagation. .. CHO-K1 cells were transiently transfected with either wt gAMN8-12 or del gAMN8-12 plasmids in duplicates and total RNA was isolated 48 hours after transfection (RNeasy Mini Kit; Qiagen, Ballerup, Denmark).

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: To clone the designed peptides, EBY100 yeast cells were transformed using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) according to the manufacturer’s protocol. .. For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol.

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: .. Target vector pWHE601* was digested using AgeI-HF and NheI-HF (both NEB) and transformed into RS463α with a 10-molar excess of insert using Frozen-EZ Yeast Transformation II Kit (Zymo Research). .. Transformed cells were spread on several SCD-ura plates in a way that assures a moderate colony density which simplifies picking clones.

    Article Title: Engineered charge redistribution of Gp2 proteins through guided diversity for improved PET imaging of epidermal growth factor receptor
    Article Snippet: Gp2-encoding regions in DNA recovered from the final lysate-extracted EGFR flow cytometry sort were amplified by polymerase chain reaction, digested with NheI-HF and BamHI-HF restriction enzymes (New England Biolabs, Ipswich, MA), and ligated into a pET-22b vector containing a C-terminal hexa-histidine (Novagen, EMD Millipore, Billerica, MA) with T4 DNA ligase (New England Biolabs). .. Plasmids were transformed via heat-shock into T7 Express Competent E. coli (New England Biolabs) and proper transformants selected on lysogeny broth (LB) plates containing 50 mg/L kanamycin.

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: Ligated plasmids were transformed into DH5α E. coli (Invitrogen). .. After restriction digest with NheI-HF and XhoI (NEB) of both the PCR product and pGL3 Enhancer vector (Promega), fragments were ligated at 4 °C overnight with T4 ligase (NEB).

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: The resulting PCR product was purified (QIAquick PCR Purification Kit, Qiagen), digested with AgeI-HF and NheI-HF (NEB) and ligated into equally digested pWHE601* with T4 DNA Ligase (NEB). .. Transformation of the ligation mixture was done after butanol precipitation into NEB® 10-beta Competent Escherichia coli (High Efficiency) according to the supplier's protocol.

    Article Title: Towards conformational fidelity of a quaternary HIV-1 epitope: computational design and directed evolution of a minimal V1V2 antigen
    Article Snippet: Vector (250 μg of pCT) was prepared by restricting with BamHI-HF and NheI-HF (NEB). .. Cells were transformed at 1.2 kV and 25 μF using a Gene Pulser Xcell (Bio-Rad), recovered in a 1:1 mixture of 1 M sorbitol:YPD at 30°C for 1 h. Cells were transferred to 1 L SDCAA media, and serial dilutions were plated on SDCAA plates for 2 days at 30°C to estimate library diversity.

    Article Title: Reduction of nonspecificity motifs in synthetic antibody libraries
    Article Snippet: The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were co-transformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified prior to experiments.

    Transfection:

    Article Title: Detailed investigations of proximal tubular function in Imerslund-Gr?sbeck syndrome
    Article Snippet: Amplification products were cloned into expression vectors (pcDNA™ 3.1(+); Invitrogen, Taastrup, Denmark) using NheI-HF™ and Xho I restriction enzymes (New England Biolabs, Medinova Scientific A/S, Glostrup, Denmark) according to manufacturer’s guidelines (wt gAMN8-12 and del gAMN8-12) and subsequently transformed into competent cells (One Shot® TOP10; Invitrogen) for propagation. .. CHO-K1 cells were transiently transfected with either wt gAMN8-12 or del gAMN8-12 plasmids in duplicates and total RNA was isolated 48 hours after transfection (RNeasy Mini Kit; Qiagen, Ballerup, Denmark).

    Sequencing:

    Article Title: CRISPR Activation Enhances In Vitro Potency of AAV Vectors Driven by Tissue-Specific Promoters
    Article Snippet: The eGFP-KASH coding sequence was removed by digestion with AgeI-HF and EcoRI-HIF (NEB, Ipswich, MA, USA) and the wild-type eGFP sequence was amplified and restored between these sites. .. In addition, the CMV promoter cassette was removed by digestion with NheI-HF and SpeI-HF (NEB) and replaced with the GRK1 or CAR promoter sequences.

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were contransformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified before experiments.

    Article Title: Detailed investigations of proximal tubular function in Imerslund-Gr?sbeck syndrome
    Article Snippet: Amplification products were cloned into expression vectors (pcDNA™ 3.1(+); Invitrogen, Taastrup, Denmark) using NheI-HF™ and Xho I restriction enzymes (New England Biolabs, Medinova Scientific A/S, Glostrup, Denmark) according to manufacturer’s guidelines (wt gAMN8-12 and del gAMN8-12) and subsequently transformed into competent cells (One Shot® TOP10; Invitrogen) for propagation. .. Splicing was analysed by RT-PCR (OneStep RT-PCR kit; Qiagen) using primers 5′-CACCTTCCTGGGTCTGCCTCAGTACC-3′ and 5′-GGCGCCACCAGCAGGACCAGCA-3′ according to manufacturer’s protocol. cDNA amplification products were cloned into vectors (pCR® II-TOPO® using TOPO TA cloning technique, Invitrogen) according to manufacturers protocol for subsequent sequencing.

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol. .. The inserts were constructed with PCR using primers that encoded the peptide sequence flanked with at least 40 bp of the plasmid sequence on either side of the insertion site.

    Article Title: Reduction of nonspecificity motifs in synthetic antibody libraries
    Article Snippet: The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were co-transformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified prior to experiments.

    Ligation:

    Article Title: Rational design of a Kv1.3 channel-blocking antibody as a selective immunosuppressant
    Article Snippet: The fusion gene fragments were assembled by overlap extension PCR and digested with the restriction enzymes EcoRI-HF and NheI-HF (New England Biolabs), followed by DNA gel extraction. .. The final expression vectors for the fusion antibodies were constructed by in-frame ligation of the assembled DNA into the pFuse backbone (Invivogen) using T4 DNA ligase.

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: After restriction digest with NheI-HF and XhoI (NEB) of both the PCR product and pGL3 Enhancer vector (Promega), fragments were ligated at 4 °C overnight with T4 ligase (NEB). .. DH5α E. coli were transformed with ligation reactions and selected for using ampicillin.

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: The resulting PCR product was purified (QIAquick PCR Purification Kit, Qiagen), digested with AgeI-HF and NheI-HF (NEB) and ligated into equally digested pWHE601* with T4 DNA Ligase (NEB). .. Again, digestion and ligation into pWHE601* followed.

    Serial Dilution:

    Article Title: A new genome-mining tool redefines the lasso peptide biosynthetic landscape
    Article Snippet: The DNA solution was split into 14 fractions and Sau3AI (NEB) was added to each in a 2-fold serial dilution, starting with 2.5 µL of Sau3AI into 400 µL of DNA solution. .. These fractions were dephosphorylated by the addition of 20 µL of shrimp alkaline phosphatase and incubation at 37 °C for 1 h. DNA fragments were isolated by phenol:chloroform:isoamyl alcohol extraction and air dried for 3 h. The previously reported vector pJK050 was used for fosmid construction . pJK050 was doubly digested with NheI-HF and BamHI-HF (NEB) and dephosphorylated with shrimp alkaline phosphatase.

    Generated:

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: The resulting PCR product was purified (QIAquick PCR Purification Kit, Qiagen), digested with AgeI-HF and NheI-HF (NEB) and ligated into equally digested pWHE601* with T4 DNA Ligase (NEB). .. Doped pools were generated using the oligonucleotides AgeI_doped_fwd and NheI_[3.0/4.5/9.0/30.0]_doped_rev ( , Microsynth AG), respectively, with the construct ΔATG as template and amplified using Q5® High-Fidelity DNA polymerase (NEB) according to the supplier's instructions.

    DNA Sequencing:

    Article Title: Rational design of a Kv1.3 channel-blocking antibody as a selective immunosuppressant
    Article Snippet: The fusion gene fragments were assembled by overlap extension PCR and digested with the restriction enzymes EcoRI-HF and NheI-HF (New England Biolabs), followed by DNA gel extraction. .. The sequences of the resulting mammalian expression vectors were confirmed by DNA sequencing (GENEWIZ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Detailed investigations of proximal tubular function in Imerslund-Gr?sbeck syndrome
    Article Snippet: Amplification products were cloned into expression vectors (pcDNA™ 3.1(+); Invitrogen, Taastrup, Denmark) using NheI-HF™ and Xho I restriction enzymes (New England Biolabs, Medinova Scientific A/S, Glostrup, Denmark) according to manufacturer’s guidelines (wt gAMN8-12 and del gAMN8-12) and subsequently transformed into competent cells (One Shot® TOP10; Invitrogen) for propagation. .. Splicing was analysed by RT-PCR (OneStep RT-PCR kit; Qiagen) using primers 5′-CACCTTCCTGGGTCTGCCTCAGTACC-3′ and 5′-GGCGCCACCAGCAGGACCAGCA-3′ according to manufacturer’s protocol. cDNA amplification products were cloned into vectors (pCR® II-TOPO® using TOPO TA cloning technique, Invitrogen) according to manufacturers protocol for subsequent sequencing.

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: For that, RT-PCR product of a defined round was amplified with CFX_HR_fwd (5′-CAA GCT ATA CCA AGC ATA CAA TCA ACT CCA AGC TAG ATC TAC CGG TGG GAG ACG CAA CTG AAT GAA-3′) and CFX_HR_rev (5′-CAA GAA TTG GGA CAA CTC CAG TGA AAA GTT CTT CTC CTT TGC TAG CGT GAC GCG ACT AGT TAC GGA-3′) to attach 46 bp overhang for recombination into pWHE601*. .. Target vector pWHE601* was digested using AgeI-HF and NheI-HF (both NEB) and transformed into RS463α with a 10-molar excess of insert using Frozen-EZ Yeast Transformation II Kit (Zymo Research).

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: After restriction digest with NheI-HF and XhoI (NEB) of both the PCR product and pGL3 Enhancer vector (Promega), fragments were ligated at 4 °C overnight with T4 ligase (NEB). .. ColI Intron For pGL3 NheI: CATG GCTAGC CAAGAAGACGGTAAGTAGCAC ColI Intron full Rev: CATG CTCGAG TCGCACACGCAGATCGTG Col XII Intron For pGL3 NheI: CATG GCTAGC CAAGCAACCAGGGGAGGA ColXII intron full Rev: CATG CTCGAG CCACAGAGGCGGCTCCAGATTGTG Full-length axolotl Sall4 was cloned out of RNA extracted from a 14-day post injury skin wound using the primers listed below using Qiagen One Step RT-PCR kit following manufacturer’s protocol.

    Binding Assay:

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: To detect cell surface expression and binding, cells were filtered, washed twice in chilled BSS, resuspended in a 100-fold dilution of primary antibodies [mouse anti-HA (Roche) and rabbit anti-c-myc (Sigma)] in BSS at a volume of 2 mL per 108 cells and incubated for 15 min at 4 °C. .. For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol.

    Cellular Antioxidant Activity Assay:

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol. .. The transformation mixture was spread onto SD + CAA plates ( ) (5 g/L casamino acids, 1.7 g/L yeast nitrogen base, 5 g/L ammonium sulfate, 10.2 g/L Na2 HPO4 -7H2 O and 8.6 g/L NaH2 PO4 -H2 O, 2% glucose, 15–18 g/L agar, 182 g/L sorbitol) and grown at 30 °C for 2–3 d. To confirm each strain, colony PCR followed by sequencing was performed on single colonies.

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: For that, RT-PCR product of a defined round was amplified with CFX_HR_fwd (5′-CAA GCT ATA CCA AGC ATA CAA TCA ACT CCA AGC TAG ATC TAC CGG TGG GAG ACG CAA CTG AAT GAA-3′) and CFX_HR_rev (5′-CAA GAA TTG GGA CAA CTC CAG TGA AAA GTT CTT CTC CTT TGC TAG CGT GAC GCG ACT AGT TAC GGA-3′) to attach 46 bp overhang for recombination into pWHE601*. .. Target vector pWHE601* was digested using AgeI-HF and NheI-HF (both NEB) and transformed into RS463α with a 10-molar excess of insert using Frozen-EZ Yeast Transformation II Kit (Zymo Research).

    Molecular Weight:

    Article Title: A new genome-mining tool redefines the lasso peptide biosynthetic landscape
    Article Snippet: Fosmid library generation High molecular weight DNA was resuspended in 600 µL TE buffer (10 mM Tris, 1 mM EDTA, pH 8), 330 µL 10x CutSmart buffer (NEB), and 2310 µL DNase-free water. .. These fractions were dephosphorylated by the addition of 20 µL of shrimp alkaline phosphatase and incubation at 37 °C for 1 h. DNA fragments were isolated by phenol:chloroform:isoamyl alcohol extraction and air dried for 3 h. The previously reported vector pJK050 was used for fosmid construction . pJK050 was doubly digested with NheI-HF and BamHI-HF (NEB) and dephosphorylated with shrimp alkaline phosphatase.

    DNA Extraction:

    Article Title: Upstream sequence-dependent suppression and AtxA-dependent activation of protective antigens in Bacillus anthracis
    Article Snippet: CZC5 ( ) using a PowerFecal DNA isolation kit (MO BIO, Carlsbad, CA, USA) according to the manufacturer’s protocol. .. After digestion by KpnI-HF (NEB, Ipswich, MA, USA) and NheI-HF (NEB, Ipswich, MA, USA), the full length of the atxA gene was inserted into a bait plasmid, pB1H2-ω2 (Addgene plasmid # 18038) ( ) and digested by KpnI-HF and XbaI (NEB, Ipswich, MA, USA); this construct expresses AtxA with the omega subunit of bacterial RNA polymerase.

    Article Title: Towards conformational fidelity of a quaternary HIV-1 epitope: computational design and directed evolution of a minimal V1V2 antigen
    Article Snippet: Vector (250 μg of pCT) was prepared by restricting with BamHI-HF and NheI-HF (NEB). .. Vector was gel extracted using a DNA Extraction Maxi Kit (Geneaid), and both insert and vector were ethanol-precipitated with Pellet Paint (Millipore), and resuspended in water.

    Nucleic Acid Electrophoresis:

    Article Title: A new genome-mining tool redefines the lasso peptide biosynthetic landscape
    Article Snippet: Digest reactions were incubated at 37 °C for 1 h and were then inactivated by incubation at 75 °C for 30 min. Fractions were analyzed by field-inversion gel electrophoresis, and fractions containing approximately 40 kb pieces of DNA were utilized in cosmid construction. .. These fractions were dephosphorylated by the addition of 20 µL of shrimp alkaline phosphatase and incubation at 37 °C for 1 h. DNA fragments were isolated by phenol:chloroform:isoamyl alcohol extraction and air dried for 3 h. The previously reported vector pJK050 was used for fosmid construction . pJK050 was doubly digested with NheI-HF and BamHI-HF (NEB) and dephosphorylated with shrimp alkaline phosphatase.

    In Vivo:

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: Paragraph title: In vivo screening ... Target vector pWHE601* was digested using AgeI-HF and NheI-HF (both NEB) and transformed into RS463α with a 10-molar excess of insert using Frozen-EZ Yeast Transformation II Kit (Zymo Research).

    Fluorescence:

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: Target vector pWHE601* was digested using AgeI-HF and NheI-HF (both NEB) and transformed into RS463α with a 10-molar excess of insert using Frozen-EZ Yeast Transformation II Kit (Zymo Research). .. For the first screening round, cells were selected under the fluorescence binocular and checked for GFP expression.

    Mutagenesis:

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: Paragraph title: Mutant construction ... The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs).

    Article Title: Detailed investigations of proximal tubular function in Imerslund-Gr?sbeck syndrome
    Article Snippet: Amplification products were cloned into expression vectors (pcDNA™ 3.1(+); Invitrogen, Taastrup, Denmark) using NheI-HF™ and Xho I restriction enzymes (New England Biolabs, Medinova Scientific A/S, Glostrup, Denmark) according to manufacturer’s guidelines (wt gAMN8-12 and del gAMN8-12) and subsequently transformed into competent cells (One Shot® TOP10; Invitrogen) for propagation. .. The c.3335G > A (p.Gly1112Glu) identified in family 5, was introduced into a previously described fragment of human cubilin, encoding CUB domains 5–8 [ ], through site-directed, ligase-independent mutagenesis (SLIM)[ ] using the following primers (Ft: 5′-CAGAGATGAAGGCTATGAAAAATCACCATTGCTGGG-3′; Rt: 5′-TCATAGCCTTCATCTCTGATTTCCAGAAAATCTGTA-3′; Fs: 5′-AAAATCACCATTGCTGGG-3′; Rs: 5′-ATTTCCAGAAAATCTGTA-3′).

    Isolation:

    Article Title: Detailed investigations of proximal tubular function in Imerslund-Gr?sbeck syndrome
    Article Snippet: Amplification products were cloned into expression vectors (pcDNA™ 3.1(+); Invitrogen, Taastrup, Denmark) using NheI-HF™ and Xho I restriction enzymes (New England Biolabs, Medinova Scientific A/S, Glostrup, Denmark) according to manufacturer’s guidelines (wt gAMN8-12 and del gAMN8-12) and subsequently transformed into competent cells (One Shot® TOP10; Invitrogen) for propagation. .. CHO-K1 cells were transiently transfected with either wt gAMN8-12 or del gAMN8-12 plasmids in duplicates and total RNA was isolated 48 hours after transfection (RNeasy Mini Kit; Qiagen, Ballerup, Denmark).

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: Plasmid DNA was then isolated using Qiagen’s Midiprep kit per manufacturer’s instructions. .. After restriction digest with NheI-HF and XhoI (NEB) of both the PCR product and pGL3 Enhancer vector (Promega), fragments were ligated at 4 °C overnight with T4 ligase (NEB).

    Article Title: A SWI/SNF Chromatin Remodelling Protein Controls Cytokinin Production through the Regulation of Chromatin Architecture
    Article Snippet: Cross-linked plantlets were ground and nuclei were isolated and treated with SDS 0,3% at 65°C for 40min. .. Digestions were performed overnight at 37°C with 400U NheI-HF (NEB) for the IPT3 locus, 400U BglII (NEB) for the IPT7 locus or 400U MfeI (NEB) for the KRP7 locus.

    Article Title: A new genome-mining tool redefines the lasso peptide biosynthetic landscape
    Article Snippet: .. These fractions were dephosphorylated by the addition of 20 µL of shrimp alkaline phosphatase and incubation at 37 °C for 1 h. DNA fragments were isolated by phenol:chloroform:isoamyl alcohol extraction and air dried for 3 h. The previously reported vector pJK050 was used for fosmid construction . pJK050 was doubly digested with NheI-HF and BamHI-HF (NEB) and dephosphorylated with shrimp alkaline phosphatase. .. Cut vector was purified with a GeneJET PCR Purification Kit (Thermo Scientific).

    Flow Cytometry:

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: Cells were filtered and washed 2× in chilled BSS before resuspending the labeled cells in BSS and using a BD FACSAria flow cytometer or a BD FACSCanto and FACSDiva software for cell sorting or analysis. .. For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol.

    Article Title: Engineered charge redistribution of Gp2 proteins through guided diversity for improved PET imaging of epidermal growth factor receptor
    Article Snippet: .. Gp2-encoding regions in DNA recovered from the final lysate-extracted EGFR flow cytometry sort were amplified by polymerase chain reaction, digested with NheI-HF and BamHI-HF restriction enzymes (New England Biolabs, Ipswich, MA), and ligated into a pET-22b vector containing a C-terminal hexa-histidine (Novagen, EMD Millipore, Billerica, MA) with T4 DNA ligase (New England Biolabs). .. Plasmids were transformed via heat-shock into T7 Express Competent E. coli (New England Biolabs) and proper transformants selected on lysogeny broth (LB) plates containing 50 mg/L kanamycin.

    Labeling:

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: Cells were filtered and washed 2× in chilled BSS before resuspending the labeled cells in BSS and using a BD FACSAria flow cytometer or a BD FACSCanto and FACSDiva software for cell sorting or analysis. .. For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol.

    Cytometry:

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: Cells were filtered and washed 2× in chilled BSS before resuspending the labeled cells in BSS and using a BD FACSAria flow cytometer or a BD FACSCanto and FACSDiva software for cell sorting or analysis. .. For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol.

    Article Title: Engineered charge redistribution of Gp2 proteins through guided diversity for improved PET imaging of epidermal growth factor receptor
    Article Snippet: .. Gp2-encoding regions in DNA recovered from the final lysate-extracted EGFR flow cytometry sort were amplified by polymerase chain reaction, digested with NheI-HF and BamHI-HF restriction enzymes (New England Biolabs, Ipswich, MA), and ligated into a pET-22b vector containing a C-terminal hexa-histidine (Novagen, EMD Millipore, Billerica, MA) with T4 DNA ligase (New England Biolabs). .. Plasmids were transformed via heat-shock into T7 Express Competent E. coli (New England Biolabs) and proper transformants selected on lysogeny broth (LB) plates containing 50 mg/L kanamycin.

    Polymerase Chain Reaction:

    Article Title: Rational design of a Kv1.3 channel-blocking antibody as a selective immunosuppressant
    Article Snippet: .. The fusion gene fragments were assembled by overlap extension PCR and digested with the restriction enzymes EcoRI-HF and NheI-HF (New England Biolabs), followed by DNA gel extraction. .. The final expression vectors for the fusion antibodies were constructed by in-frame ligation of the assembled DNA into the pFuse backbone (Invivogen) using T4 DNA ligase.

    Article Title: Upstream sequence-dependent suppression and AtxA-dependent activation of protective antigens in Bacillus anthracis
    Article Snippet: The atxA gene was amplified by polymerase chain reaction (PCR) using two primers with a restriction enzyme site, namely KpnI-AtxA-F and NheI-AtxA-R, and was then cloned into the pGEM-T-easy plasmid (Promega, Madison, WI, USA) according to manufacturer’s protocol ( ). .. After digestion by KpnI-HF (NEB, Ipswich, MA, USA) and NheI-HF (NEB, Ipswich, MA, USA), the full length of the atxA gene was inserted into a bait plasmid, pB1H2-ω2 (Addgene plasmid # 18038) ( ) and digested by KpnI-HF and XbaI (NEB, Ipswich, MA, USA); this construct expresses AtxA with the omega subunit of bacterial RNA polymerase.

    Article Title: Detailed investigations of proximal tubular function in Imerslund-Gr?sbeck syndrome
    Article Snippet: Established constructs The genomic fragments comprising AMN exon 8 to exon 12 (c.782-1327) were amplified through PCR from a healthy control subject and the index patient of family 3 (homozygous for c.1006 + 11_1008del) using the following AMN specific primers; 5′-CCCTCCCGCTAGCATGGCCGTTGTGTTGCTGACCCA-3′ containing the NheI restriction site and an in frame ATG start codon and primer 5′-ATTCCCCTCGAGTCATGACGAAGTAACTGTGGCTGGT-3′ containing the Xho I restriction site and an in frame TGA stop codon. .. Amplification products were cloned into expression vectors (pcDNA™ 3.1(+); Invitrogen, Taastrup, Denmark) using NheI-HF™ and Xho I restriction enzymes (New England Biolabs, Medinova Scientific A/S, Glostrup, Denmark) according to manufacturer’s guidelines (wt gAMN8-12 and del gAMN8-12) and subsequently transformed into competent cells (One Shot® TOP10; Invitrogen) for propagation.

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol. .. The inserts were constructed with PCR using primers that encoded the peptide sequence flanked with at least 40 bp of the plasmid sequence on either side of the insertion site.

    Article Title: Engineered charge redistribution of Gp2 proteins through guided diversity for improved PET imaging of epidermal growth factor receptor
    Article Snippet: .. Gp2-encoding regions in DNA recovered from the final lysate-extracted EGFR flow cytometry sort were amplified by polymerase chain reaction, digested with NheI-HF and BamHI-HF restriction enzymes (New England Biolabs, Ipswich, MA), and ligated into a pET-22b vector containing a C-terminal hexa-histidine (Novagen, EMD Millipore, Billerica, MA) with T4 DNA ligase (New England Biolabs). .. Plasmids were transformed via heat-shock into T7 Express Competent E. coli (New England Biolabs) and proper transformants selected on lysogeny broth (LB) plates containing 50 mg/L kanamycin.

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: .. After restriction digest with NheI-HF and XhoI (NEB) of both the PCR product and pGL3 Enhancer vector (Promega), fragments were ligated at 4 °C overnight with T4 ligase (NEB). .. DH5α E. coli were transformed with ligation reactions and selected for using ampicillin.

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: .. The resulting PCR product was purified (QIAquick PCR Purification Kit, Qiagen), digested with AgeI-HF and NheI-HF (NEB) and ligated into equally digested pWHE601* with T4 DNA Ligase (NEB). .. Doped pools were generated using the oligonucleotides AgeI_doped_fwd and NheI_[3.0/4.5/9.0/30.0]_doped_rev ( , Microsynth AG), respectively, with the construct ΔATG as template and amplified using Q5® High-Fidelity DNA polymerase (NEB) according to the supplier's instructions.

    Article Title: Towards conformational fidelity of a quaternary HIV-1 epitope: computational design and directed evolution of a minimal V1V2 antigen
    Article Snippet: Inserts for an sc-(V1V2)3 yeast display library were constructed by error-prone PCR (epPCR) as previously described , aiming for four amino acid mutations per gene. .. Vector (250 μg of pCT) was prepared by restricting with BamHI-HF and NheI-HF (NEB).

    Article Title: A new genome-mining tool redefines the lasso peptide biosynthetic landscape
    Article Snippet: These fractions were dephosphorylated by the addition of 20 µL of shrimp alkaline phosphatase and incubation at 37 °C for 1 h. DNA fragments were isolated by phenol:chloroform:isoamyl alcohol extraction and air dried for 3 h. The previously reported vector pJK050 was used for fosmid construction . pJK050 was doubly digested with NheI-HF and BamHI-HF (NEB) and dephosphorylated with shrimp alkaline phosphatase. .. Cut vector was purified with a GeneJET PCR Purification Kit (Thermo Scientific).

    Gel Extraction:

    Article Title: Rational design of a Kv1.3 channel-blocking antibody as a selective immunosuppressant
    Article Snippet: .. The fusion gene fragments were assembled by overlap extension PCR and digested with the restriction enzymes EcoRI-HF and NheI-HF (New England Biolabs), followed by DNA gel extraction. .. The final expression vectors for the fusion antibodies were constructed by in-frame ligation of the assembled DNA into the pFuse backbone (Invivogen) using T4 DNA ligase.

    Activated Clotting Time Assay:

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: For that, RT-PCR product of a defined round was amplified with CFX_HR_fwd (5′-CAA GCT ATA CCA AGC ATA CAA TCA ACT CCA AGC TAG ATC TAC CGG TGG GAG ACG CAA CTG AAT GAA-3′) and CFX_HR_rev (5′-CAA GAA TTG GGA CAA CTC CAG TGA AAA GTT CTT CTC CTT TGC TAG CGT GAC GCG ACT AGT TAC GGA-3′) to attach 46 bp overhang for recombination into pWHE601*. .. Target vector pWHE601* was digested using AgeI-HF and NheI-HF (both NEB) and transformed into RS463α with a 10-molar excess of insert using Frozen-EZ Yeast Transformation II Kit (Zymo Research).

    Purification:

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: .. The resulting PCR product was purified (QIAquick PCR Purification Kit, Qiagen), digested with AgeI-HF and NheI-HF (NEB) and ligated into equally digested pWHE601* with T4 DNA Ligase (NEB). .. Doped pools were generated using the oligonucleotides AgeI_doped_fwd and NheI_[3.0/4.5/9.0/30.0]_doped_rev ( , Microsynth AG), respectively, with the construct ΔATG as template and amplified using Q5® High-Fidelity DNA polymerase (NEB) according to the supplier's instructions.

    Article Title: Towards conformational fidelity of a quaternary HIV-1 epitope: computational design and directed evolution of a minimal V1V2 antigen
    Article Snippet: Products from this epPCR reaction were purified (Geneaid) and subjected to a second round of standard amplification using Phusion polymerase. .. Vector (250 μg of pCT) was prepared by restricting with BamHI-HF and NheI-HF (NEB).

    Article Title: A new genome-mining tool redefines the lasso peptide biosynthetic landscape
    Article Snippet: These fractions were dephosphorylated by the addition of 20 µL of shrimp alkaline phosphatase and incubation at 37 °C for 1 h. DNA fragments were isolated by phenol:chloroform:isoamyl alcohol extraction and air dried for 3 h. The previously reported vector pJK050 was used for fosmid construction . pJK050 was doubly digested with NheI-HF and BamHI-HF (NEB) and dephosphorylated with shrimp alkaline phosphatase. .. Cut vector was purified with a GeneJET PCR Purification Kit (Thermo Scientific).

    Plasmid Preparation:

    Article Title: Rational design of a Kv1.3 channel-blocking antibody as a selective immunosuppressant
    Article Snippet: Paragraph title: Cloning of Antibody Expression Vector. ... The fusion gene fragments were assembled by overlap extension PCR and digested with the restriction enzymes EcoRI-HF and NheI-HF (New England Biolabs), followed by DNA gel extraction.

    Article Title: Yeast surface display platform for rapid discovery of conformationally selective nanobodies
    Article Snippet: .. 500 mL of BJ5465 yeast (MAT a ura352 trp1 leu2Δ1 his3Δ200 pep4::HIS3 prb1Δ1.6R can1 GAL) were grown to OD600 1.5 and transformed with 245 μg nanobody insert DNA and 50 μg of pYDS649 plasmid, digested with NheI-HF and BamHI-HF (New England BioLabs), using an ECM 830 Electroporator (BTX-Harvard Apparatus). ..

    Article Title: Upstream sequence-dependent suppression and AtxA-dependent activation of protective antigens in Bacillus anthracis
    Article Snippet: .. After digestion by KpnI-HF (NEB, Ipswich, MA, USA) and NheI-HF (NEB, Ipswich, MA, USA), the full length of the atxA gene was inserted into a bait plasmid, pB1H2-ω2 (Addgene plasmid # 18038) ( ) and digested by KpnI-HF and XbaI (NEB, Ipswich, MA, USA); this construct expresses AtxA with the omega subunit of bacterial RNA polymerase. .. For the control transcription factor, pB1H2-ωL-Prd (Addgene plasmid # 18040), a bait plasmid expressing Paired, a well-characterized transcription factor, was used ( ).

    Article Title: CRISPR Activation Enhances In Vitro Potency of AAV Vectors Driven by Tissue-Specific Promoters
    Article Snippet: Paragraph title: Plasmid Generation ... In addition, the CMV promoter cassette was removed by digestion with NheI-HF and SpeI-HF (NEB) and replaced with the GRK1 or CAR promoter sequences.

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: .. The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were contransformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified before experiments.

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: .. For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol. .. The inserts were constructed with PCR using primers that encoded the peptide sequence flanked with at least 40 bp of the plasmid sequence on either side of the insertion site.

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: .. Target vector pWHE601* was digested using AgeI-HF and NheI-HF (both NEB) and transformed into RS463α with a 10-molar excess of insert using Frozen-EZ Yeast Transformation II Kit (Zymo Research). .. Transformed cells were spread on several SCD-ura plates in a way that assures a moderate colony density which simplifies picking clones.

    Article Title: Engineered charge redistribution of Gp2 proteins through guided diversity for improved PET imaging of epidermal growth factor receptor
    Article Snippet: .. Gp2-encoding regions in DNA recovered from the final lysate-extracted EGFR flow cytometry sort were amplified by polymerase chain reaction, digested with NheI-HF and BamHI-HF restriction enzymes (New England Biolabs, Ipswich, MA), and ligated into a pET-22b vector containing a C-terminal hexa-histidine (Novagen, EMD Millipore, Billerica, MA) with T4 DNA ligase (New England Biolabs). .. Plasmids were transformed via heat-shock into T7 Express Competent E. coli (New England Biolabs) and proper transformants selected on lysogeny broth (LB) plates containing 50 mg/L kanamycin.

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: .. After restriction digest with NheI-HF and XhoI (NEB) of both the PCR product and pGL3 Enhancer vector (Promega), fragments were ligated at 4 °C overnight with T4 ligase (NEB). .. DH5α E. coli were transformed with ligation reactions and selected for using ampicillin.

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: Paragraph title: Plasmid cloning and doped pool generation ... The resulting PCR product was purified (QIAquick PCR Purification Kit, Qiagen), digested with AgeI-HF and NheI-HF (NEB) and ligated into equally digested pWHE601* with T4 DNA Ligase (NEB).

    Article Title: Towards conformational fidelity of a quaternary HIV-1 epitope: computational design and directed evolution of a minimal V1V2 antigen
    Article Snippet: .. Vector (250 μg of pCT) was prepared by restricting with BamHI-HF and NheI-HF (NEB). .. Vector was gel extracted using a DNA Extraction Maxi Kit (Geneaid), and both insert and vector were ethanol-precipitated with Pellet Paint (Millipore), and resuspended in water.

    Article Title: Reduction of nonspecificity motifs in synthetic antibody libraries
    Article Snippet: .. The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were co-transformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified prior to experiments.

    Article Title: A new genome-mining tool redefines the lasso peptide biosynthetic landscape
    Article Snippet: .. These fractions were dephosphorylated by the addition of 20 µL of shrimp alkaline phosphatase and incubation at 37 °C for 1 h. DNA fragments were isolated by phenol:chloroform:isoamyl alcohol extraction and air dried for 3 h. The previously reported vector pJK050 was used for fosmid construction . pJK050 was doubly digested with NheI-HF and BamHI-HF (NEB) and dephosphorylated with shrimp alkaline phosphatase. .. Cut vector was purified with a GeneJET PCR Purification Kit (Thermo Scientific).

    Software:

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: Cells were filtered and washed 2× in chilled BSS before resuspending the labeled cells in BSS and using a BD FACSAria flow cytometer or a BD FACSCanto and FACSDiva software for cell sorting or analysis. .. For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol.

    Positron Emission Tomography:

    Article Title: Engineered charge redistribution of Gp2 proteins through guided diversity for improved PET imaging of epidermal growth factor receptor
    Article Snippet: .. Gp2-encoding regions in DNA recovered from the final lysate-extracted EGFR flow cytometry sort were amplified by polymerase chain reaction, digested with NheI-HF and BamHI-HF restriction enzymes (New England Biolabs, Ipswich, MA), and ligated into a pET-22b vector containing a C-terminal hexa-histidine (Novagen, EMD Millipore, Billerica, MA) with T4 DNA ligase (New England Biolabs). .. Plasmids were transformed via heat-shock into T7 Express Competent E. coli (New England Biolabs) and proper transformants selected on lysogeny broth (LB) plates containing 50 mg/L kanamycin.

    Next-Generation Sequencing:

    Article Title: Yeast surface display platform for rapid discovery of conformationally selective nanobodies
    Article Snippet: 500 mL of BJ5465 yeast (MAT a ura352 trp1 leu2Δ1 his3Δ200 pep4::HIS3 prb1Δ1.6R can1 GAL) were grown to OD600 1.5 and transformed with 245 μg nanobody insert DNA and 50 μg of pYDS649 plasmid, digested with NheI-HF and BamHI-HF (New England BioLabs), using an ECM 830 Electroporator (BTX-Harvard Apparatus). .. Three cultures of 5×105 yeast were inoculated in Trp dropout medium (US Biological) and grown overnight at 30 °C for whole library next generation sequencing reactions.

    Concentration Assay:

    Article Title: Yeast surface display platform for rapid discovery of conformationally selective nanobodies
    Article Snippet: 1 μL of each mixed pool at 10 μM concentration and at 5-fold sequential dilutions was subsequently used to prepare 50 μl OE-PCR reactions using Phusion polymerase. .. 500 mL of BJ5465 yeast (MAT a ura352 trp1 leu2Δ1 his3Δ200 pep4::HIS3 prb1Δ1.6R can1 GAL) were grown to OD600 1.5 and transformed with 245 μg nanobody insert DNA and 50 μg of pYDS649 plasmid, digested with NheI-HF and BamHI-HF (New England BioLabs), using an ECM 830 Electroporator (BTX-Harvard Apparatus).

    Article Title: A new genome-mining tool redefines the lasso peptide biosynthetic landscape
    Article Snippet: These fractions were dephosphorylated by the addition of 20 µL of shrimp alkaline phosphatase and incubation at 37 °C for 1 h. DNA fragments were isolated by phenol:chloroform:isoamyl alcohol extraction and air dried for 3 h. The previously reported vector pJK050 was used for fosmid construction . pJK050 was doubly digested with NheI-HF and BamHI-HF (NEB) and dephosphorylated with shrimp alkaline phosphatase. .. A portion (5 µL) was removed as a control and 1 µL of high concentration T4 ligase (NEB, 2,000,000 U/mL) was added to the remainder.

    CTG Assay:

    Article Title: Riboswitching with ciprofloxacin—development and characterization of a novel RNA regulator
    Article Snippet: For that, RT-PCR product of a defined round was amplified with CFX_HR_fwd (5′-CAA GCT ATA CCA AGC ATA CAA TCA ACT CCA AGC TAG ATC TAC CGG TGG GAG ACG CAA CTG AAT GAA-3′) and CFX_HR_rev (5′-CAA GAA TTG GGA CAA CTC CAG TGA AAA GTT CTT CTC CTT TGC TAG CGT GAC GCG ACT AGT TAC GGA-3′) to attach 46 bp overhang for recombination into pWHE601*. .. Target vector pWHE601* was digested using AgeI-HF and NheI-HF (both NEB) and transformed into RS463α with a 10-molar excess of insert using Frozen-EZ Yeast Transformation II Kit (Zymo Research).

    FACS:

    Article Title: Peptide design by optimization on a data-parameterized protein interaction landscape
    Article Snippet: Cells were filtered and washed 2× in chilled BSS before resuspending the labeled cells in BSS and using a BD FACSAria flow cytometer or a BD FACSCanto and FACSDiva software for cell sorting or analysis. .. For a plasmid backbone, we used the Puma PCT plasmid ( ) and digested it with XhoI (NEB) and NheI-HF (NEB) according to the manufacturer’s protocol.

    Homologous Recombination:

    Article Title: Nonspecificity in a nonimmune human scFv repertoire
    Article Snippet: .. The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were contransformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified before experiments.

    Article Title: Reduction of nonspecificity motifs in synthetic antibody libraries
    Article Snippet: .. The pCTCON2 vector was prepared for homologous recombination by digestion with SalI-HF followed by digestion with NheI-HF and BamI-HF (New England Biolabs). .. The two scFv fragments along with the digested vector were co-transformed into chemically competent yeast using the Frozen-EZ Yeast Transformation II Kit (Zymo Research) and resultant clones were sequence verified prior to experiments.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs nhei hf
    Nhei Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nhei hf/product/New England Biolabs
    Average 90 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    nhei hf - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results