hindiii  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    HindIII HF
    Description:
    HindIII HF 50 000 units
    Catalog Number:
    r3104l
    Price:
    244
    Size:
    50 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs hindiii
    HindIII HF
    HindIII HF 50 000 units
    https://www.bioz.com/result/hindiii/product/New England Biolabs
    Average 90 stars, based on 178 article reviews
    Price from $9.99 to $1999.99
    hindiii - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Metabolic engineering of Saccharomyces cerevisiae for de novo production of dihydrochalcones with known antioxidant, antidiabetic, and sweet tasting properties
    Article Snippet: .. Generally, cloning was done by restriction enzyme and ligation based cloning with HindIII HF, SacII , and T4 DNA ligase (all New England Biolabs, Ipswich, Massachusetts, USA) according to standard protocols ( ). .. Genes containing internal HindIII or SacII sites were cloned by In-Fusion (Takara, Kyoto, Japan) according to the manufacturer's instructions.

    Article Title: Heterologous Expression and Characterization of A Novel Ochratoxin A Degrading Enzyme, N-acyl-L-amino Acid Amidohydrolase, from Alcaligenes faecalis
    Article Snippet: Paragraph title: 4.3. Cloning of AfOTase Gene ... The gene was ligated into pET-28a (+) which was linearized by BamHI-HF and HindIII-HF (NEB).

    Article Title: Molecular Basis for the Evolution of Species-Specific Hemoglobin Capture by Staphylococcus aureus
    Article Snippet: Paragraph title: Hemoglobin cloning and genetic manipulation. ... Because of cDNA sequence homology, some primers were used for multiple species. pHb0.0-human was digested with PacI (NEB) and HindIII-HF (NEB), and the doubly digested vector was isolated by gel purification (Qiagen, Germantown, MD).

    Article Title: Use of Reverse Vaccinology in the Design and Construction of Nanoglycoconjugate Vaccines against Burkholderia pseudomallei
    Article Snippet: .. Sequences encoding OmpW (BMA2010 or BPSL2704), porin OpcP1 (BMAA1122 or BPSS0708), hemagglutinin (BMAA1324 or BPSS0908), Hcp1 (BMAA0742 or BPSS1498), FlgD (BMA3327 or BPSL0272), OpcP porin (BMAA1353 or BPSS0879), porin (BMAA0599 or BPSS0757), and FlgL (BMA3336 or BPSL0281) were amplified via Phusion polymerase (New England BioLabs) and cloned into a pET30a(+) expression vector using NdeI and XhoI or HindIII-HF (New England BioLabs) restriction sites (see Table S2). ..

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: The MGMT P/E region inserts were then PCR amplified with these two new primers from the identified positive pGEM-T-MGMT clones followed the PCR protocol described above. .. Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen).

    Article Title: Aldo-keto Reductase 1B15 (AKR1B15)
    Article Snippet: .. The PCR products were cloned into pET28a(+) (Novagen) via NdeI/XhoI, into pcDNA3.1(+) (Invitrogen) via NotI/XhoI, into N-Myc-pcDNA3 (modified pcDNA3 with an N-terminal Myc tag) via NotI/XhoI, into pcDNA4-Myc/HisB (Invitrogen) via HindIII/NotI, and into pIRES-hrGFP1α (Stratagene) via NotI/XhoI restriction sites, using HindIII, HindIII-HF, NdeI, NotI-HF, and XhoI restriction enzymes and T4 DNA ligase (New England Biolabs). .. The complete sequence of the inserts was verified by Sanger sequencing.

    Amplification:

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: .. SmURFP, TDsmURFP, and IFP2.0 were PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ HindIII and 3’ XhoI, HindIII-HF and XhoI digested (NEB), gel purified (Zymoclean Gel DNA Recovery Kit). .. PCDNA3 mAG-hGem(1/110) or mKO2-hCdtI(30/120) were digested with HindIII-HF and XhoI (NEB) to remove the FP and linker, dephosphorylated (SAP, Roche), and gel purified (Zymoclean Gel DNA Recovery Kit).

    Article Title: Metabolic engineering of Saccharomyces cerevisiae for de novo production of dihydrochalcones with known antioxidant, antidiabetic, and sweet tasting properties
    Article Snippet: Generally, cloning was done by restriction enzyme and ligation based cloning with HindIII HF, SacII , and T4 DNA ligase (all New England Biolabs, Ipswich, Massachusetts, USA) according to standard protocols ( ). .. E. coli was grown in LB medium prepared with 25 g/l of LB broth (Miller) and supplemented with 100 μg/l ampicillin for amplification of plasmids.

    Article Title: Heterologous Expression and Characterization of A Novel Ochratoxin A Degrading Enzyme, N-acyl-L-amino Acid Amidohydrolase, from Alcaligenes faecalis
    Article Snippet: Two primers, OD-F (CGCGGATCCCAAGCCAGTAATCCCATGATGG, with a BamHI site) and OD-R (CCCAAGCTTCTACGGTTTTTTGTGATCCATC, with a HindIII site) were used for PCR amplification and partial sequencing of the Af OTase gene. .. The gene was ligated into pET-28a (+) which was linearized by BamHI-HF and HindIII-HF (NEB).

    Article Title: Clonal analysis of lineage fate in native hematopoiesis
    Article Snippet: In order to improve the current technique, we have developed a method based on T7-polymerase linear amplification and recovery of integration sites (TARIS) ( ). .. For TARIS, the total purified DNA was subjected to enzymatic restriction with 10U of HindIII-HF (NEB) overnight.

    Article Title: Molecular Basis for the Evolution of Species-Specific Hemoglobin Capture by Staphylococcus aureus
    Article Snippet: In general, each α- and β-globin gene cDNA was amplified from the template (above) using Phusion 2× master mix (Thermo, Waltham, MA) with primers that also had homology to pHb0.0. .. Because of cDNA sequence homology, some primers were used for multiple species. pHb0.0-human was digested with PacI (NEB) and HindIII-HF (NEB), and the doubly digested vector was isolated by gel purification (Qiagen, Germantown, MD).

    Article Title: A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human haematopoietic stem and progenitor cells
    Article Snippet: IL2RG targeted gDNA was then digested in HINDIII-HF and HEXB was digested in XbaI following the manufacturer’s instructions (New England Biolabs). .. Amplification was performed using in-out PCR (one primer binding to transgene insert in the genomic locus and other primer binding to the specific locus outside of the homology arm).

    Article Title: Use of Reverse Vaccinology in the Design and Construction of Nanoglycoconjugate Vaccines against Burkholderia pseudomallei
    Article Snippet: .. Sequences encoding OmpW (BMA2010 or BPSL2704), porin OpcP1 (BMAA1122 or BPSS0708), hemagglutinin (BMAA1324 or BPSS0908), Hcp1 (BMAA0742 or BPSS1498), FlgD (BMA3327 or BPSL0272), OpcP porin (BMAA1353 or BPSS0879), porin (BMAA0599 or BPSS0757), and FlgL (BMA3336 or BPSL0281) were amplified via Phusion polymerase (New England BioLabs) and cloned into a pET30a(+) expression vector using NdeI and XhoI or HindIII-HF (New England BioLabs) restriction sites (see Table S2). ..

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: The MGMT P/E region inserts were then PCR amplified with these two new primers from the identified positive pGEM-T-MGMT clones followed the PCR protocol described above. .. Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen).

    Article Title: Aldo-keto Reductase 1B15 (AKR1B15)
    Article Snippet: The protein-encoding sequences of the AKR1B15 splice variants AKR1B15.1 (Ensembl entry AKR1B15-201 , ENST00000423958) and AKR1B15.2 (Ensembl entry AKR1B15-001 , ENST00000457545) were amplified by PCR from cDNA libraries of testis and thymus, respectively, using Phusion High Fidelity polymerase (New England Biolabs) and transcript-specific primers with restriction enzyme sites ( ). .. The PCR products were cloned into pET28a(+) (Novagen) via NdeI/XhoI, into pcDNA3.1(+) (Invitrogen) via NotI/XhoI, into N-Myc-pcDNA3 (modified pcDNA3 with an N-terminal Myc tag) via NotI/XhoI, into pcDNA4-Myc/HisB (Invitrogen) via HindIII/NotI, and into pIRES-hrGFP1α (Stratagene) via NotI/XhoI restriction sites, using HindIII, HindIII-HF, NdeI, NotI-HF, and XhoI restriction enzymes and T4 DNA ligase (New England Biolabs).

    Article Title: A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human haematopoietic stem and progenitor cells
    Article Snippet: IL2RG targeted gDNA was then digested in HINDIII-HF and HEXB was digested in XbaI following the manufacturer’s instructions (New England Biolabs). .. Amplification was performed using in-out PCR (one primer binding to transgene insert in the genomic locus and other primer binding to the specific locus outside of the homology arm).

    Stable Transfection:

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: SmURFP, TDsmURFP, and IFP2.0 were PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ HindIII and 3’ XhoI, HindIII-HF and XhoI digested (NEB), gel purified (Zymoclean Gel DNA Recovery Kit). .. PCDNA3 X-hGem(1/110)/hCdtI(30/120) were ligated with smURFP, TDsmURFP, and IFP2.0 to create pCDNA3 smURFP/TDsmURFP/IFP2.0-hGem(1/110)/hCdtI(30/120), 6 plasmids with hygromycin B resistance to create stable cell lines.

    Construct:

    Article Title: Metabolic engineering of Saccharomyces cerevisiae for de novo production of dihydrochalcones with known antioxidant, antidiabetic, and sweet tasting properties
    Article Snippet: 2.2 Strains, plasmids, and media E. coli XL10 Gold (Agilent, Santa Clara, California, USA) cells were used for subcloning of genes. lists all plasmids constructed in this work. .. Generally, cloning was done by restriction enzyme and ligation based cloning with HindIII HF, SacII , and T4 DNA ligase (all New England Biolabs, Ipswich, Massachusetts, USA) according to standard protocols ( ).

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen). .. The positive pGL4.11-MGMT constructs were identified by gel verification and sequencing.

    Incubation:

    Article Title: Longitudinal assessment of neuronal 3D genomes in mouse prefrontal cortex
    Article Snippet: .. HindIII-HF was inactivated by the addition 86 μl of 10% SDS incubated for 30 min at 65 °C. .. Ligation mixture (7.61 ml) was added to each sample.

    Luciferase:

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: For promoter activity studies, the sequence-confirmed positive MGMT P/E region inserts were transferred to the luciferase reporter vector pGL4.11 [ luc2P ] (Promega). .. Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen).

    Activity Assay:

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: For promoter activity studies, the sequence-confirmed positive MGMT P/E region inserts were transferred to the luciferase reporter vector pGL4.11 [ luc2P ] (Promega). .. Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen).

    Expressing:

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: Paragraph title: Creating and imaging transiently/stably expressing FR/NIR FUCCI HEK293A cells ... SmURFP, TDsmURFP, and IFP2.0 were PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ HindIII and 3’ XhoI, HindIII-HF and XhoI digested (NEB), gel purified (Zymoclean Gel DNA Recovery Kit).

    Article Title: Metabolic engineering of Saccharomyces cerevisiae for de novo production of dihydrochalcones with known antioxidant, antidiabetic, and sweet tasting properties
    Article Snippet: Coding sequences for selected enzymes were cloned into expression cassettes of plasmids pEVE2176 to pEVE2181 for assembly by in vivo homologous recombination (see ). .. Generally, cloning was done by restriction enzyme and ligation based cloning with HindIII HF, SacII , and T4 DNA ligase (all New England Biolabs, Ipswich, Massachusetts, USA) according to standard protocols ( ).

    Article Title: Heterologous Expression and Characterization of A Novel Ochratoxin A Degrading Enzyme, N-acyl-L-amino Acid Amidohydrolase, from Alcaligenes faecalis
    Article Snippet: The gene was ligated into pET-28a (+) which was linearized by BamHI-HF and HindIII-HF (NEB). .. The vector pET-28a (+) with His6 -tags at the N-terminus was used for recombinant expression in this study.

    Article Title: Use of Reverse Vaccinology in the Design and Construction of Nanoglycoconjugate Vaccines against Burkholderia pseudomallei
    Article Snippet: .. Sequences encoding OmpW (BMA2010 or BPSL2704), porin OpcP1 (BMAA1122 or BPSS0708), hemagglutinin (BMAA1324 or BPSS0908), Hcp1 (BMAA0742 or BPSS1498), FlgD (BMA3327 or BPSL0272), OpcP porin (BMAA1353 or BPSS0879), porin (BMAA0599 or BPSS0757), and FlgL (BMA3336 or BPSL0281) were amplified via Phusion polymerase (New England BioLabs) and cloned into a pET30a(+) expression vector using NdeI and XhoI or HindIII-HF (New England BioLabs) restriction sites (see Table S2). ..

    Modification:

    Article Title: Aldo-keto Reductase 1B15 (AKR1B15)
    Article Snippet: .. The PCR products were cloned into pET28a(+) (Novagen) via NdeI/XhoI, into pcDNA3.1(+) (Invitrogen) via NotI/XhoI, into N-Myc-pcDNA3 (modified pcDNA3 with an N-terminal Myc tag) via NotI/XhoI, into pcDNA4-Myc/HisB (Invitrogen) via HindIII/NotI, and into pIRES-hrGFP1α (Stratagene) via NotI/XhoI restriction sites, using HindIII, HindIII-HF, NdeI, NotI-HF, and XhoI restriction enzymes and T4 DNA ligase (New England Biolabs). .. The complete sequence of the inserts was verified by Sanger sequencing.

    Western Blot:

    Article Title: Molecular Basis for the Evolution of Species-Specific Hemoglobin Capture by Staphylococcus aureus
    Article Snippet: The α-globin orthologs cloned from cDNA (with Coriell identifier [ID] numbers) are as follows: African green monkey (PR01193), black-and-white colobus (PR00240), white-handed gibbon (PR01131), Western lowland gorilla (AG05251), Francois’ leaf monkey (PR01099), black crested mangabey (PR01215), white-faced marmoset (PR00789), Nancy Ma’s night monkey (PR00627), patas monkey (AG06116), proboscis monkey, Allen’s swamp monkey (PR01231), talapoin (PR00716), and Wolf’s guenon (PR00486). .. Because of cDNA sequence homology, some primers were used for multiple species. pHb0.0-human was digested with PacI (NEB) and HindIII-HF (NEB), and the doubly digested vector was isolated by gel purification (Qiagen, Germantown, MD).

    Transformation Assay:

    Article Title: Molecular Basis for the Evolution of Species-Specific Hemoglobin Capture by Staphylococcus aureus
    Article Snippet: Because of cDNA sequence homology, some primers were used for multiple species. pHb0.0-human was digested with PacI (NEB) and HindIII-HF (NEB), and the doubly digested vector was isolated by gel purification (Qiagen, Germantown, MD). .. PCR products were assembled with digested pHb0.0, transformed to DH5α, reisolated with a Mini-prep (Thermo), and confirmed by sequencing (GeneWiz, South Plainfield, NJ) with primers pHb0.0_for/pHb0.0_rev.

    Article Title: Use of Reverse Vaccinology in the Design and Construction of Nanoglycoconjugate Vaccines against Burkholderia pseudomallei
    Article Snippet: Sequences encoding OmpW (BMA2010 or BPSL2704), porin OpcP1 (BMAA1122 or BPSS0708), hemagglutinin (BMAA1324 or BPSS0908), Hcp1 (BMAA0742 or BPSS1498), FlgD (BMA3327 or BPSL0272), OpcP porin (BMAA1353 or BPSS0879), porin (BMAA0599 or BPSS0757), and FlgL (BMA3336 or BPSL0281) were amplified via Phusion polymerase (New England BioLabs) and cloned into a pET30a(+) expression vector using NdeI and XhoI or HindIII-HF (New England BioLabs) restriction sites (see Table S2). .. Ligation, transformation, and expression were performed according to the manufacturer's directions (pET system; Novagen) with some modifications.

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: Based on the haplotypes determined by PHASE, PCR amplicons with target haplotypes were inserted into the cloning vector pGEM-T and transformed into the competent Escherichia coli cells JM109 following the recommendations of the manufacturer. .. Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen).

    Gel Purification:

    Article Title: Molecular Basis for the Evolution of Species-Specific Hemoglobin Capture by Staphylococcus aureus
    Article Snippet: .. Because of cDNA sequence homology, some primers were used for multiple species. pHb0.0-human was digested with PacI (NEB) and HindIII-HF (NEB), and the doubly digested vector was isolated by gel purification (Qiagen, Germantown, MD). .. PCR products were assembled with digested pHb0.0, transformed to DH5α, reisolated with a Mini-prep (Thermo), and confirmed by sequencing (GeneWiz, South Plainfield, NJ) with primers pHb0.0_for/pHb0.0_rev.

    Countercurrent Chromatography:

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: To facilitate ligation into pGL4.11, we incorporated a KpnI restriction site (bold underlined) into the forward primer: 5′- GGT ACC TCC GGG GGC CAG AAG TTT GAA-3′ and a HindIII restriction site (bold underlined) into the reverse primer: 5′- AAG CTT ACC CCC GCC ACA CGC CAG TCC-3′. .. Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen).

    Transfection:

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: SmURFP, TDsmURFP, and IFP2.0 were PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ HindIII and 3’ XhoI, HindIII-HF and XhoI digested (NEB), gel purified (Zymoclean Gel DNA Recovery Kit). .. HEK293A cells were transfected with Lipofectamine 2000 (Life Technologies) on glass bottom dishes (grown and transfected as described above).

    Southern Blot:

    Article Title: Human herpesvirus–encoded kinase induces B cell lymphomas in vivo
    Article Snippet: Paragraph title: Southern blot. ... Fifteen micrograms of DNA from each mouse was double digested with BamHI-HF and HindIII-HF (New England BioLabs) and single digested using AflII (New England BioLabs) in a total volume of 100 μl at 37°C overnight.

    Ligation:

    Article Title: Metabolic engineering of Saccharomyces cerevisiae for de novo production of dihydrochalcones with known antioxidant, antidiabetic, and sweet tasting properties
    Article Snippet: .. Generally, cloning was done by restriction enzyme and ligation based cloning with HindIII HF, SacII , and T4 DNA ligase (all New England Biolabs, Ipswich, Massachusetts, USA) according to standard protocols ( ). .. Genes containing internal HindIII or SacII sites were cloned by In-Fusion (Takara, Kyoto, Japan) according to the manufacturer's instructions.

    Article Title: Clonal analysis of lineage fate in native hematopoiesis
    Article Snippet: Our original technique for molecular identification of Tn integration sites was based on ligation-mediated PCRs (LM-PCR). .. For TARIS, the total purified DNA was subjected to enzymatic restriction with 10U of HindIII-HF (NEB) overnight.

    Article Title: Use of Reverse Vaccinology in the Design and Construction of Nanoglycoconjugate Vaccines against Burkholderia pseudomallei
    Article Snippet: Sequences encoding OmpW (BMA2010 or BPSL2704), porin OpcP1 (BMAA1122 or BPSS0708), hemagglutinin (BMAA1324 or BPSS0908), Hcp1 (BMAA0742 or BPSS1498), FlgD (BMA3327 or BPSL0272), OpcP porin (BMAA1353 or BPSS0879), porin (BMAA0599 or BPSS0757), and FlgL (BMA3336 or BPSL0281) were amplified via Phusion polymerase (New England BioLabs) and cloned into a pET30a(+) expression vector using NdeI and XhoI or HindIII-HF (New England BioLabs) restriction sites (see Table S2). .. Ligation, transformation, and expression were performed according to the manufacturer's directions (pET system; Novagen) with some modifications.

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: To facilitate ligation into pGL4.11, we incorporated a KpnI restriction site (bold underlined) into the forward primer: 5′- GGT ACC TCC GGG GGC CAG AAG TTT GAA-3′ and a HindIII restriction site (bold underlined) into the reverse primer: 5′- AAG CTT ACC CCC GCC ACA CGC CAG TCC-3′. .. Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen).

    Imaging:

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: Paragraph title: Creating and imaging transiently/stably expressing FR/NIR FUCCI HEK293A cells ... SmURFP, TDsmURFP, and IFP2.0 were PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ HindIII and 3’ XhoI, HindIII-HF and XhoI digested (NEB), gel purified (Zymoclean Gel DNA Recovery Kit).

    Sequencing:

    Article Title: Heterologous Expression and Characterization of A Novel Ochratoxin A Degrading Enzyme, N-acyl-L-amino Acid Amidohydrolase, from Alcaligenes faecalis
    Article Snippet: Two primers, OD-F (CGCGGATCCCAAGCCAGTAATCCCATGATGG, with a BamHI site) and OD-R (CCCAAGCTTCTACGGTTTTTTGTGATCCATC, with a HindIII site) were used for PCR amplification and partial sequencing of the Af OTase gene. .. The gene was ligated into pET-28a (+) which was linearized by BamHI-HF and HindIII-HF (NEB).

    Article Title: Molecular Basis for the Evolution of Species-Specific Hemoglobin Capture by Staphylococcus aureus
    Article Snippet: .. Because of cDNA sequence homology, some primers were used for multiple species. pHb0.0-human was digested with PacI (NEB) and HindIII-HF (NEB), and the doubly digested vector was isolated by gel purification (Qiagen, Germantown, MD). .. PCR products were assembled with digested pHb0.0, transformed to DH5α, reisolated with a Mini-prep (Thermo), and confirmed by sequencing (GeneWiz, South Plainfield, NJ) with primers pHb0.0_for/pHb0.0_rev.

    Article Title: Use of Reverse Vaccinology in the Design and Construction of Nanoglycoconjugate Vaccines against Burkholderia pseudomallei
    Article Snippet: Sequences encoding OmpW (BMA2010 or BPSL2704), porin OpcP1 (BMAA1122 or BPSS0708), hemagglutinin (BMAA1324 or BPSS0908), Hcp1 (BMAA0742 or BPSS1498), FlgD (BMA3327 or BPSL0272), OpcP porin (BMAA1353 or BPSS0879), porin (BMAA0599 or BPSS0757), and FlgL (BMA3336 or BPSL0281) were amplified via Phusion polymerase (New England BioLabs) and cloned into a pET30a(+) expression vector using NdeI and XhoI or HindIII-HF (New England BioLabs) restriction sites (see Table S2). .. Upon confirmation of successful gene insertion via gel electrophoresis and directional sequencing (UTMB Genomics Core), plasmids were transformed into BL21(DE3) competent E. coli (New England BioLabs) via heat shock treatment.

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: For promoter activity studies, the sequence-confirmed positive MGMT P/E region inserts were transferred to the luciferase reporter vector pGL4.11 [ luc2P ] (Promega). .. Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen).

    Article Title: Aldo-keto Reductase 1B15 (AKR1B15)
    Article Snippet: The PCR products were cloned into pET28a(+) (Novagen) via NdeI/XhoI, into pcDNA3.1(+) (Invitrogen) via NotI/XhoI, into N-Myc-pcDNA3 (modified pcDNA3 with an N-terminal Myc tag) via NotI/XhoI, into pcDNA4-Myc/HisB (Invitrogen) via HindIII/NotI, and into pIRES-hrGFP1α (Stratagene) via NotI/XhoI restriction sites, using HindIII, HindIII-HF, NdeI, NotI-HF, and XhoI restriction enzymes and T4 DNA ligase (New England Biolabs). .. The complete sequence of the inserts was verified by Sanger sequencing.

    Binding Assay:

    Article Title: A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human haematopoietic stem and progenitor cells
    Article Snippet: IL2RG targeted gDNA was then digested in HINDIII-HF and HEXB was digested in XbaI following the manufacturer’s instructions (New England Biolabs). .. Amplification was performed using in-out PCR (one primer binding to transgene insert in the genomic locus and other primer binding to the specific locus outside of the homology arm).

    Article Title: A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human haematopoietic stem and progenitor cells
    Article Snippet: IL2RG targeted gDNA was then digested in HINDIII-HF and HEXB was digested in XbaI following the manufacturer’s instructions (New England Biolabs). .. Amplification was performed using in-out PCR (one primer binding to transgene insert in the genomic locus and other primer binding to the specific locus outside of the homology arm).

    DNA Extraction:

    Article Title: A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human haematopoietic stem and progenitor cells
    Article Snippet: All gDNA samples used in ddPCR were first extracted using QuickExtract™ DNA Extraction Solution (Epicentre). .. IL2RG targeted gDNA was then digested in HINDIII-HF and HEXB was digested in XbaI following the manufacturer’s instructions (New England Biolabs).

    Article Title: A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human haematopoietic stem and progenitor cells
    Article Snippet: All gDNA samples used in ddPCR were first extracted using QuickExtract™ DNA Extraction Solution (Epicentre). .. IL2RG targeted gDNA was then digested in HINDIII-HF and HEXB was digested in XbaI following the manufacturer’s instructions (New England Biolabs).

    Nucleic Acid Electrophoresis:

    Article Title: Use of Reverse Vaccinology in the Design and Construction of Nanoglycoconjugate Vaccines against Burkholderia pseudomallei
    Article Snippet: Sequences encoding OmpW (BMA2010 or BPSL2704), porin OpcP1 (BMAA1122 or BPSS0708), hemagglutinin (BMAA1324 or BPSS0908), Hcp1 (BMAA0742 or BPSS1498), FlgD (BMA3327 or BPSL0272), OpcP porin (BMAA1353 or BPSS0879), porin (BMAA0599 or BPSS0757), and FlgL (BMA3336 or BPSL0281) were amplified via Phusion polymerase (New England BioLabs) and cloned into a pET30a(+) expression vector using NdeI and XhoI or HindIII-HF (New England BioLabs) restriction sites (see Table S2). .. Upon confirmation of successful gene insertion via gel electrophoresis and directional sequencing (UTMB Genomics Core), plasmids were transformed into BL21(DE3) competent E. coli (New England BioLabs) via heat shock treatment.

    Article Title: Human herpesvirus–encoded kinase induces B cell lymphomas in vivo
    Article Snippet: Fifteen micrograms of DNA from each mouse was double digested with BamHI-HF and HindIII-HF (New England BioLabs) and single digested using AflII (New England BioLabs) in a total volume of 100 μl at 37°C overnight. .. The samples were subjected to gel electrophoresis at 25 V overnight and stained with ethidium bromide.

    In Vivo:

    Article Title: Metabolic engineering of Saccharomyces cerevisiae for de novo production of dihydrochalcones with known antioxidant, antidiabetic, and sweet tasting properties
    Article Snippet: Coding sequences for selected enzymes were cloned into expression cassettes of plasmids pEVE2176 to pEVE2181 for assembly by in vivo homologous recombination (see ). .. Generally, cloning was done by restriction enzyme and ligation based cloning with HindIII HF, SacII , and T4 DNA ligase (all New England Biolabs, Ipswich, Massachusetts, USA) according to standard protocols ( ).

    Isolation:

    Article Title: Molecular Basis for the Evolution of Species-Specific Hemoglobin Capture by Staphylococcus aureus
    Article Snippet: .. Because of cDNA sequence homology, some primers were used for multiple species. pHb0.0-human was digested with PacI (NEB) and HindIII-HF (NEB), and the doubly digested vector was isolated by gel purification (Qiagen, Germantown, MD). .. PCR products were assembled with digested pHb0.0, transformed to DH5α, reisolated with a Mini-prep (Thermo), and confirmed by sequencing (GeneWiz, South Plainfield, NJ) with primers pHb0.0_for/pHb0.0_rev.

    Article Title: Use of Reverse Vaccinology in the Design and Construction of Nanoglycoconjugate Vaccines against Burkholderia pseudomallei
    Article Snippet: B. mallei ATCC 23344 DNA was isolated via the Qiagen DNeasy blood and tissue kit, according to the manufacturer's directions. .. Sequences encoding OmpW (BMA2010 or BPSL2704), porin OpcP1 (BMAA1122 or BPSS0708), hemagglutinin (BMAA1324 or BPSS0908), Hcp1 (BMAA0742 or BPSS1498), FlgD (BMA3327 or BPSL0272), OpcP porin (BMAA1353 or BPSS0879), porin (BMAA0599 or BPSS0757), and FlgL (BMA3336 or BPSL0281) were amplified via Phusion polymerase (New England BioLabs) and cloned into a pET30a(+) expression vector using NdeI and XhoI or HindIII-HF (New England BioLabs) restriction sites (see Table S2).

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: The plasmids from positive colonies were isolated by QIAprep Spin Miniprep Kit (Qiagen) and digested with EcoRI (NEB, Ipswich, MA) for gel verification and sequencing. .. Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen).

    Article Title: Human herpesvirus–encoded kinase induces B cell lymphomas in vivo
    Article Snippet: Mouse genomic DNA was isolated from spleens using the DNeasy Blood and Tissue Kit from QIAGEN. .. Fifteen micrograms of DNA from each mouse was double digested with BamHI-HF and HindIII-HF (New England BioLabs) and single digested using AflII (New England BioLabs) in a total volume of 100 μl at 37°C overnight.

    Subcloning:

    Article Title: Metabolic engineering of Saccharomyces cerevisiae for de novo production of dihydrochalcones with known antioxidant, antidiabetic, and sweet tasting properties
    Article Snippet: 2.2 Strains, plasmids, and media E. coli XL10 Gold (Agilent, Santa Clara, California, USA) cells were used for subcloning of genes. lists all plasmids constructed in this work. .. Generally, cloning was done by restriction enzyme and ligation based cloning with HindIII HF, SacII , and T4 DNA ligase (all New England Biolabs, Ipswich, Massachusetts, USA) according to standard protocols ( ).

    Article Title: Molecular Basis for the Evolution of Species-Specific Hemoglobin Capture by Staphylococcus aureus
    Article Snippet: Because of cDNA sequence homology, some primers were used for multiple species. pHb0.0-human was digested with PacI (NEB) and HindIII-HF (NEB), and the doubly digested vector was isolated by gel purification (Qiagen, Germantown, MD). .. Chimeric hemoglobins were prepared by subcloning the α-globins.

    Purification:

    Article Title: Microscopic mechanism of DNA damage searching by hOGG1
    Article Snippet: Oligonucleotide and protein reagents Oligonucleotides were purchased from Integrated DNA Technologies ( www.idtdna.com ), Midland ( www.oligos.com ) or Eurofins ( www.operon.com ) and purified by denaturing polyacrylamide gel electrophoresis. hOGG1 and human apurinic/apyrimidinic endonuclease 1 (APE1) were prepared as described ( ). .. T4 polynucleotide kinase, terminal transferase, T4 DNA ligase, NtBbvCI, BamHI-HF and HindIII-HF were purchased from New England Biolabs.

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: .. SmURFP, TDsmURFP, and IFP2.0 were PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ HindIII and 3’ XhoI, HindIII-HF and XhoI digested (NEB), gel purified (Zymoclean Gel DNA Recovery Kit). .. PCDNA3 mAG-hGem(1/110) or mKO2-hCdtI(30/120) were digested with HindIII-HF and XhoI (NEB) to remove the FP and linker, dephosphorylated (SAP, Roche), and gel purified (Zymoclean Gel DNA Recovery Kit).

    Article Title: Defining CRISPR-Cas9 genome-wide nuclease activities with CIRCLE-seq
    Article Snippet: .. R3104L) 10× CutSmart Buffer (New England BioLabs) supplied with Hind III-HF MinElute PCR purification kit (50) (Qiagen, cat.no. .. 28004) Elution buffer (Qiagen) supplied with MinElute PCR purification kit MEGAshortscript T7 Kit (25 rxns) (Thermo Fisher Scientific, cat.no.

    Article Title: Clonal analysis of lineage fate in native hematopoiesis
    Article Snippet: .. For TARIS, the total purified DNA was subjected to enzymatic restriction with 10U of HindIII-HF (NEB) overnight. .. TARIS adaptor primer was hybridized and extended using 1U Klenow DNA polymerase (NEB) for 2h.

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: .. Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen). .. The purified MGMT P/E DNA fragments were inserted into pGL4.11 vector and transformed into the competent E. coli JM109 cells.

    Polymerase Chain Reaction:

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: .. SmURFP, TDsmURFP, and IFP2.0 were PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ HindIII and 3’ XhoI, HindIII-HF and XhoI digested (NEB), gel purified (Zymoclean Gel DNA Recovery Kit). .. PCDNA3 mAG-hGem(1/110) or mKO2-hCdtI(30/120) were digested with HindIII-HF and XhoI (NEB) to remove the FP and linker, dephosphorylated (SAP, Roche), and gel purified (Zymoclean Gel DNA Recovery Kit).

    Article Title: Defining CRISPR-Cas9 genome-wide nuclease activities with CIRCLE-seq
    Article Snippet: .. R3104L) 10× CutSmart Buffer (New England BioLabs) supplied with Hind III-HF MinElute PCR purification kit (50) (Qiagen, cat.no. .. 28004) Elution buffer (Qiagen) supplied with MinElute PCR purification kit MEGAshortscript T7 Kit (25 rxns) (Thermo Fisher Scientific, cat.no.

    Article Title: Heterologous Expression and Characterization of A Novel Ochratoxin A Degrading Enzyme, N-acyl-L-amino Acid Amidohydrolase, from Alcaligenes faecalis
    Article Snippet: Two primers, OD-F (CGCGGATCCCAAGCCAGTAATCCCATGATGG, with a BamHI site) and OD-R (CCCAAGCTTCTACGGTTTTTTGTGATCCATC, with a HindIII site) were used for PCR amplification and partial sequencing of the Af OTase gene. .. The gene was ligated into pET-28a (+) which was linearized by BamHI-HF and HindIII-HF (NEB).

    Article Title: Molecular Basis for the Evolution of Species-Specific Hemoglobin Capture by Staphylococcus aureus
    Article Snippet: Because of cDNA sequence homology, some primers were used for multiple species. pHb0.0-human was digested with PacI (NEB) and HindIII-HF (NEB), and the doubly digested vector was isolated by gel purification (Qiagen, Germantown, MD). .. PCR products were assembled with digested pHb0.0, transformed to DH5α, reisolated with a Mini-prep (Thermo), and confirmed by sequencing (GeneWiz, South Plainfield, NJ) with primers pHb0.0_for/pHb0.0_rev.

    Article Title: A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human haematopoietic stem and progenitor cells
    Article Snippet: Paragraph title: Gene targeting analysis by digital droplet PCR (ddPCR) ... IL2RG targeted gDNA was then digested in HINDIII-HF and HEXB was digested in XbaI following the manufacturer’s instructions (New England Biolabs).

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: Paragraph title: PCR-based method. ... Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen).

    Article Title: Aldo-keto Reductase 1B15 (AKR1B15)
    Article Snippet: .. The PCR products were cloned into pET28a(+) (Novagen) via NdeI/XhoI, into pcDNA3.1(+) (Invitrogen) via NotI/XhoI, into N-Myc-pcDNA3 (modified pcDNA3 with an N-terminal Myc tag) via NotI/XhoI, into pcDNA4-Myc/HisB (Invitrogen) via HindIII/NotI, and into pIRES-hrGFP1α (Stratagene) via NotI/XhoI restriction sites, using HindIII, HindIII-HF, NdeI, NotI-HF, and XhoI restriction enzymes and T4 DNA ligase (New England Biolabs). .. The complete sequence of the inserts was verified by Sanger sequencing.

    Positron Emission Tomography:

    Article Title: Heterologous Expression and Characterization of A Novel Ochratoxin A Degrading Enzyme, N-acyl-L-amino Acid Amidohydrolase, from Alcaligenes faecalis
    Article Snippet: .. The gene was ligated into pET-28a (+) which was linearized by BamHI-HF and HindIII-HF (NEB). .. The vector pET-28a (+) with His6 -tags at the N-terminus was used for recombinant expression in this study.

    Article Title: Use of Reverse Vaccinology in the Design and Construction of Nanoglycoconjugate Vaccines against Burkholderia pseudomallei
    Article Snippet: Sequences encoding OmpW (BMA2010 or BPSL2704), porin OpcP1 (BMAA1122 or BPSS0708), hemagglutinin (BMAA1324 or BPSS0908), Hcp1 (BMAA0742 or BPSS1498), FlgD (BMA3327 or BPSL0272), OpcP porin (BMAA1353 or BPSS0879), porin (BMAA0599 or BPSS0757), and FlgL (BMA3336 or BPSL0281) were amplified via Phusion polymerase (New England BioLabs) and cloned into a pET30a(+) expression vector using NdeI and XhoI or HindIII-HF (New England BioLabs) restriction sites (see Table S2). .. Ligation, transformation, and expression were performed according to the manufacturer's directions (pET system; Novagen) with some modifications.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Microscopic mechanism of DNA damage searching by hOGG1
    Article Snippet: Oligonucleotide and protein reagents Oligonucleotides were purchased from Integrated DNA Technologies ( www.idtdna.com ), Midland ( www.oligos.com ) or Eurofins ( www.operon.com ) and purified by denaturing polyacrylamide gel electrophoresis. hOGG1 and human apurinic/apyrimidinic endonuclease 1 (APE1) were prepared as described ( ). .. T4 polynucleotide kinase, terminal transferase, T4 DNA ligase, NtBbvCI, BamHI-HF and HindIII-HF were purchased from New England Biolabs.

    Gel Extraction:

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: .. Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen). .. The purified MGMT P/E DNA fragments were inserted into pGL4.11 vector and transformed into the competent E. coli JM109 cells.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Defining CRISPR-Cas9 genome-wide nuclease activities with CIRCLE-seq
    Article Snippet: .. R3104L) 10× CutSmart Buffer (New England BioLabs) supplied with Hind III-HF MinElute PCR purification kit (50) (Qiagen, cat.no. .. 28004) Elution buffer (Qiagen) supplied with MinElute PCR purification kit MEGAshortscript T7 Kit (25 rxns) (Thermo Fisher Scientific, cat.no.

    Plasmid Preparation:

    Article Title: A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein
    Article Snippet: HindIII-HF and XbaI (NEB) digested PCR fragments were gel purified (Zymoclean Gel DNA Recovery Kit) and were ligated (T4 DNA Ligase, Life Technologies) into a similarly digested pCDNA3 vector, creating initial pCDNA3 mAG-hGem(1/110) or mKO2-hCdtI(30/120) vectors. .. SmURFP, TDsmURFP, and IFP2.0 were PCR amplified using Phusion High-Fidelity DNA Polymerase (NEB) with primers containing 5’ HindIII and 3’ XhoI, HindIII-HF and XhoI digested (NEB), gel purified (Zymoclean Gel DNA Recovery Kit).

    Article Title: Heterologous Expression and Characterization of A Novel Ochratoxin A Degrading Enzyme, N-acyl-L-amino Acid Amidohydrolase, from Alcaligenes faecalis
    Article Snippet: The gene was ligated into pET-28a (+) which was linearized by BamHI-HF and HindIII-HF (NEB). .. The vector pET-28a (+) with His6 -tags at the N-terminus was used for recombinant expression in this study.

    Article Title: Molecular Basis for the Evolution of Species-Specific Hemoglobin Capture by Staphylococcus aureus
    Article Snippet: .. Because of cDNA sequence homology, some primers were used for multiple species. pHb0.0-human was digested with PacI (NEB) and HindIII-HF (NEB), and the doubly digested vector was isolated by gel purification (Qiagen, Germantown, MD). .. PCR products were assembled with digested pHb0.0, transformed to DH5α, reisolated with a Mini-prep (Thermo), and confirmed by sequencing (GeneWiz, South Plainfield, NJ) with primers pHb0.0_for/pHb0.0_rev.

    Article Title: Use of Reverse Vaccinology in the Design and Construction of Nanoglycoconjugate Vaccines against Burkholderia pseudomallei
    Article Snippet: .. Sequences encoding OmpW (BMA2010 or BPSL2704), porin OpcP1 (BMAA1122 or BPSS0708), hemagglutinin (BMAA1324 or BPSS0908), Hcp1 (BMAA0742 or BPSS1498), FlgD (BMA3327 or BPSL0272), OpcP porin (BMAA1353 or BPSS0879), porin (BMAA0599 or BPSS0757), and FlgL (BMA3336 or BPSL0281) were amplified via Phusion polymerase (New England BioLabs) and cloned into a pET30a(+) expression vector using NdeI and XhoI or HindIII-HF (New England BioLabs) restriction sites (see Table S2). ..

    Article Title: Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents
    Article Snippet: .. Both the amplicons and pGL4.11 vector were double digested by HindIII-HF and KpnI-HF (NEB) and then gel purified by QIAquick Gel Extraction Kit (Qiagen). .. The purified MGMT P/E DNA fragments were inserted into pGL4.11 vector and transformed into the competent E. coli JM109 cells.

    Article Title: Human herpesvirus–encoded kinase induces B cell lymphomas in vivo
    Article Snippet: Fifteen micrograms of DNA from each mouse was double digested with BamHI-HF and HindIII-HF (New England BioLabs) and single digested using AflII (New England BioLabs) in a total volume of 100 μl at 37°C overnight. .. Plasmid vPK at 0.01 ng or 0.001 ng was double digested with 15 μg of DNA from WT mouse spleens under the same conditions.

    Recombinant:

    Article Title: Heterologous Expression and Characterization of A Novel Ochratoxin A Degrading Enzyme, N-acyl-L-amino Acid Amidohydrolase, from Alcaligenes faecalis
    Article Snippet: The gene was ligated into pET-28a (+) which was linearized by BamHI-HF and HindIII-HF (NEB). .. The vector pET-28a (+) with His6 -tags at the N-terminus was used for recombinant expression in this study.

    Article Title: Metabolically Stabilized Double Stranded mRNA Polyplexes
    Article Snippet: .. Luc-UTR 80A pcDNA 3.1 (-) was digested sequentially with HindIII-HF and BsmBI and dephosphorylated using recombinant shrimp alkaline phosphatase (rSAP). .. A hybridized T7 promoter DNA insert (IDT) was annealed and ligated to linearized Luc-UTR 80A pcDNA 3.1 (-) using T4 DNA ligase.

    Staining:

    Article Title: Human herpesvirus–encoded kinase induces B cell lymphomas in vivo
    Article Snippet: Fifteen micrograms of DNA from each mouse was double digested with BamHI-HF and HindIII-HF (New England BioLabs) and single digested using AflII (New England BioLabs) in a total volume of 100 μl at 37°C overnight. .. The samples were subjected to gel electrophoresis at 25 V overnight and stained with ethidium bromide.

    Homologous Recombination:

    Article Title: Metabolic engineering of Saccharomyces cerevisiae for de novo production of dihydrochalcones with known antioxidant, antidiabetic, and sweet tasting properties
    Article Snippet: Coding sequences for selected enzymes were cloned into expression cassettes of plasmids pEVE2176 to pEVE2181 for assembly by in vivo homologous recombination (see ). .. Generally, cloning was done by restriction enzyme and ligation based cloning with HindIII HF, SacII , and T4 DNA ligase (all New England Biolabs, Ipswich, Massachusetts, USA) according to standard protocols ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs r3104l
    R3104l, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/r3104l/product/New England Biolabs
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    r3104l - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results