ecori  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    EcoRI 50 000 units
    Catalog Number:
    50 000 units
    Restriction Enzymes
    Buy from Supplier

    Structured Review

    New England Biolabs ecori
    EcoRI 50 000 units England Biolabs
    Average 99 stars, based on 497 article reviews
    Price from $9.99 to $1999.99
    ecori - by Bioz Stars, 2019-10
    99/100 stars


    Related Articles

    Clone Assay:

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The primers contained a flanking sequence recognized by restriction endonuclease enzymes BamHI and EcoRI, respectively, for the convenience of cloning manipulation. .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Constructs for all five isoforms were synthesized by Epoch labs in pBluescript (+) cloning vectors. .. Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis.

    Article Title: An Approach to Spatiotemporally Resolve Protein Interaction Networks in Living Cells
    Article Snippet: Amino-terminally FLAG-tagged human B2AR and murine DOR were amplified by PCR from previously described constructs ( ; ). .. Full length FLAG-DOR and the amino-terminal portion of FLAG-B2AR (1–382) were cloned using NheI and EcoRI (NEB), followed by a linker sequence, and APEX2 inserted with EcoRI and NotI (NEB). .. For FLAG-B2AR, the remaining portion of the receptor (383–413) was cloned 3′ to the APEX2 sequence, separated by a linker, with NotI and XbaI (NEB) (see ).

    Article Title: 14-3-3 Interaction with Histone H3 Involves a Dual Modification Pattern of Phosphoacetylation
    Article Snippet: In addition, BMH2 was amplified using the primers 5′-CGCGGATCCATGTCCCAAACTCGTGAAGAT-3′ and 5′-CCGGAATTCTTATTTGGTTGGTTCACCTTG-3′. .. The PCR product was digested with BamHI and EcoRI (New England Biolabs, Ipswich, MA) and cloned into the pGEX-4T-1 vector (GE Healthcare, Piscataway, NJ) digested with the same enzymes. .. The protein was expressed in E. coli BL21(DE3) cells and purified using glutathione Sepharose resin (GE Healthcare, Piscataway, NJ) per the manufacturer's recommendations.

    Article Title: Helicobacter pylori NikR Protein Exhibits Distinct Conformations When Bound to Different Promoters
    Article Snippet: Paragraph title: Promoter Fragments; Cloning and Labeling ... The final PCR product was digested with EcoRI (New England Biolabs, Beverly, MA) and KpnI (New England Biolabs) and ligated into pBluescript (Stratagene).

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Expression plasmids for recombinant TBSV, cucumber necrosis virus (CNV), and turnip crinkle virus (TCV) replicase proteins were constructed previously ( - ). .. The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB). .. Expression and purification of the recombinant TBSV, CNV, and TCV replicase proteins were carried out as described earlier ( , ).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ). .. Digestion reactions were separated in a 1% agarose gel, and the bands were excised by use of a QIAquick gel extraction kit (Qiagen).

    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: Paragraph title: Cloning, gene disruption, and generation of mutant strains. ... To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.


    Article Title: Sonic hedgehog promotes endothelial differentiation of bone marrow mesenchymal stem cells via VEGF-D
    Article Snippet: Then Shh fragments were ligated with vector which was digested with EcoRI and BamHI (NEB, USA). .. Briefly, HEK293NT cells were co-transfected with control vector or lentiviral plasmid carrying Shh fragments, along with lentiviral packaging mix.


    Article Title: Linearmycins Activate a Two-Component Signaling System Involved in Bacterial Competition and Biofilm Morphology
    Article Snippet: Using primers 173 and 174, we amplified a 200-bp DNA sequence containing the putative yfiLMN promoter with EcoRI and HindIII restriction sites. .. To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB).

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: Each reaction mixture was subjected to the following PCR amplification conditions: cycle 1, 95°C for 2 min; cycles 2 through 35, 95°C for 30 s, 55°C for 40 s, and 68°C for 80 s; and a final extension for 8 min at 68°C. .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The gene encoding prothymosin α was amplified from the plasmid by using the following primers: the forward primer sequence was 5′-CGC GGATCC ATGTCTGATGCAGCTGTAGATACC-3′, and the reverse primer sequence was 5′-CCG GAATTC GTCATCCTCGTCGGTCTTCTG-3′ (the bold nucleotides indicate the restriction endonuclease recognition site). .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: Each reaction mixture was subjected to the following PCR amplification conditions: cycle 1, consisting of 95°C for 2 min; cycles 2 through 35, consisting of 95°C for 30 s, 55°C for 40 s, and 68°C for 80 s; and a final extension for 5 min at 68°C. .. For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).

    Article Title: An Approach to Spatiotemporally Resolve Protein Interaction Networks in Living Cells
    Article Snippet: Amino-terminally FLAG-tagged human B2AR and murine DOR were amplified by PCR from previously described constructs ( ; ). .. Full length FLAG-DOR and the amino-terminal portion of FLAG-B2AR (1–382) were cloned using NheI and EcoRI (NEB), followed by a linker sequence, and APEX2 inserted with EcoRI and NotI (NEB).

    Article Title: Vitamin K3 Induces the Expression of the Stenotrophomonas maltophilia SmeVWX Multidrug Efflux Pump
    Article Snippet: The 384-bp region between the smeRv gene (SMD_1762) and the smeU1 gene (SMD_1763), which contains the smeVWX promoter region, was amplified using the FailSafe PCR system (Epicentre) with primers SmeVWX_F (5′- GAATTC GATCCTGGACGTCG-3′, EcoRI site underlined) and SmeVWX_R (5′- AAGCTT GACATTTCCTCCCAAATC-3′, HindIII site underlined). .. The pPBT02 plasmid was extracted with the QIAprep Spin miniprep kit 250 (Qiagen), according to the manufacturer's instructions, and digested with EcoRI and HindIII restriction enzymes (New England BioLabs).

    Article Title: 14-3-3 Interaction with Histone H3 Involves a Dual Modification Pattern of Phosphoacetylation
    Article Snippet: In addition, BMH2 was amplified using the primers 5′-CGCGGATCCATGTCCCAAACTCGTGAAGAT-3′ and 5′-CCGGAATTCTTATTTGGTTGGTTCACCTTG-3′. .. The PCR product was digested with BamHI and EcoRI (New England Biolabs, Ipswich, MA) and cloned into the pGEX-4T-1 vector (GE Healthcare, Piscataway, NJ) digested with the same enzymes.

    Article Title: Sonic hedgehog promotes endothelial differentiation of bone marrow mesenchymal stem cells via VEGF-D
    Article Snippet: Shh fragments were amplified from rat genomic DNA using the primers as follows: sense, 5'-CGGAATTCGCCACC ATGCTGCTGCTGCTGGCCAG-3'; anti-sense, 5'-CGCGGATCC TCAGCTGGACTTGACTGCCATT-3'. .. Then Shh fragments were ligated with vector which was digested with EcoRI and BamHI (NEB, USA).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ).

    Article Title: Ochratoxin A Production and Amplified Fragment Length Polymorphism Analysis of Aspergillus carbonarius, Aspergillus tubingensis, and Aspergillus niger Strains Isolated from Grapes in Italy
    Article Snippet: Approximately 10 ng of genomic DNA from each isolate was cut with EcoRI and MseI (New England Biolabs, Hitchin, Hertfordshire, United Kingdom), and the DNA fragments were ligated to double-stranded restriction site-specific adaptors from the kit. .. A preselective PCR (72°C for 2 min; 20 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 2 min; and then holding at 4°C) was carried out in a 20-μl (final volume) mixture.

    DNA Ligation:

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ). .. Digestion reactions were separated in a 1% agarose gel, and the bands were excised by use of a QIAquick gel extraction kit (Qiagen).


    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Constructs for all five isoforms were synthesized by Epoch labs in pBluescript (+) cloning vectors. .. Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis.

    Article Title: Competitive Fitness of Essential Gene Knockdowns Reveals a Broad-Spectrum Antibacterial Inhibitor of the Cell Division Protein FtsZ
    Article Snippet: Briefly, a 996-bp fragment including the 3′ ends of WQ49_RS12570 and WQ49_RS12575, the intergenic region, the unique transposon sequence, and KpnI and EcoRI restriction sites was synthesized (IDT). .. The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327.

    Article Title: Replication of an Oxidized Abasic Site in Escherichia coli by a dNTP-Stabilized Misalignment Mechanism that Reads Upstream and Downstream Nucleotides
    Article Snippet: Oligonucleotides containing the C2′-oxidized abasic site (C2-AP) were synthesized as described ( ). .. T4 polynucleotide kinase, EcoR I, T4 DNA ligase, Bbs I, and Hae III were obtained from New England Biolabs.


    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: Splenocytes from heterozygous female adult GFPn transgenic mice were sorted into GFP+ and GFP− populations by using the DAKO Modular Flow cytometer. .. DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB).


    Article Title: Linearmycins Activate a Two-Component Signaling System Involved in Bacterial Competition and Biofilm Morphology
    Article Snippet: To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB). .. We transformed the PyiLMN - lacZ reporter plasmid into DS7817 to generate PDS0838 in the NCIB3610 strain background.

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Constructs for all five isoforms were synthesized by Epoch labs in pBluescript (+) cloning vectors. .. Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis.

    Article Title: An Approach to Spatiotemporally Resolve Protein Interaction Networks in Living Cells
    Article Snippet: Paragraph title: cDNA constructs ... Full length FLAG-DOR and the amino-terminal portion of FLAG-B2AR (1–382) were cloned using NheI and EcoRI (NEB), followed by a linker sequence, and APEX2 inserted with EcoRI and NotI (NEB).

    Article Title: Sonic hedgehog promotes endothelial differentiation of bone marrow mesenchymal stem cells via VEGF-D
    Article Snippet: Lentiviral vector containing Shh was constructed using vector pCDH-CMV-MCS-EF1-copGFP as backbone. .. Then Shh fragments were ligated with vector which was digested with EcoRI and BamHI (NEB, USA).

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Expression plasmids for recombinant TBSV, cucumber necrosis virus (CNV), and turnip crinkle virus (TCV) replicase proteins were constructed previously ( - ). .. The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB). .. Expression and purification of the recombinant TBSV, CNV, and TCV replicase proteins were carried out as described earlier ( , ).


    Article Title: Sonic hedgehog promotes endothelial differentiation of bone marrow mesenchymal stem cells via VEGF-D
    Article Snippet: Then Shh fragments were ligated with vector which was digested with EcoRI and BamHI (NEB, USA). .. Briefly, HEK293NT cells were co-transfected with control vector or lentiviral plasmid carrying Shh fragments, along with lentiviral packaging mix.


    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: Paragraph title: Plasmid expressing prothymosin α. ... The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Paragraph title: 2.3 Design and synthesis of pFastBac1 expression vectors ... Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis.

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Expression plasmids for recombinant TBSV, cucumber necrosis virus (CNV), and turnip crinkle virus (TCV) replicase proteins were constructed previously ( - ). .. The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB). .. Expression and purification of the recombinant TBSV, CNV, and TCV replicase proteins were carried out as described earlier ( , ).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ).

    RNA Sequencing Assay:

    Article Title: Competitive Fitness of Essential Gene Knockdowns Reveals a Broad-Spectrum Antibacterial Inhibitor of the Cell Division Protein FtsZ
    Article Snippet: Additionally, differential RNA sequencing (dRNA-seq) data for the region were examined, which found it to be transcriptionally inactive, at least in B. cenocepacia J2315 grown in biofilms ( ). .. The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327.

    Transformation Assay:

    Article Title: Linearmycins Activate a Two-Component Signaling System Involved in Bacterial Competition and Biofilm Morphology
    Article Snippet: To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB). .. To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB).

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA). .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: Vitamin K3 Induces the Expression of the Stenotrophomonas maltophilia SmeVWX Multidrug Efflux Pump
    Article Snippet: The PCR product was ligated into pGEM-T Easy vector (Promega), according to the manufacturer's instructions, obtaining the pPBT02 plasmid, which was introduced by transformation into E. coli OmniMAX (Invitrogen). .. The pPBT02 plasmid was extracted with the QIAprep Spin miniprep kit 250 (Qiagen), according to the manufacturer's instructions, and digested with EcoRI and HindIII restriction enzymes (New England BioLabs).

    Article Title: Competitive Fitness of Essential Gene Knockdowns Reveals a Broad-Spectrum Antibacterial Inhibitor of the Cell Division Protein FtsZ
    Article Snippet: Briefly, a 996-bp fragment including the 3′ ends of WQ49_RS12570 and WQ49_RS12575, the intergenic region, the unique transposon sequence, and KpnI and EcoRI restriction sites was synthesized (IDT). .. The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327. .. Using E. coli SY327/pRK2013 as a helper strain, pAH3 was introduced into K56-2 via triparental mating.

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB). .. Expression and purification of the recombinant TBSV, CNV, and TCV replicase proteins were carried out as described earlier ( , ).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ).


    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: Paragraph title: Sampling. ... For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ).


    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions. .. The digested DNA samples were then electrophoresed on a conventional 1% agarose gel.


    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: To obtain a pmtA pcs double mutant, pGemT- pmtA ::Kan was introduced by electroporation into B. abortus pcs , and the double recombination events (Kanr Amps ) were selected and confirmed by genomic PCR. .. To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.


    Article Title: Sonic hedgehog promotes endothelial differentiation of bone marrow mesenchymal stem cells via VEGF-D
    Article Snippet: Paragraph title: Reconstruction of Shh plasmid and lentivirus transfection ... Then Shh fragments were ligated with vector which was digested with EcoRI and BamHI (NEB, USA).

    Southern Blot:

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: That probe was then employed for Southern blotting to confirm the presence of a single intron insertion in the SM101:: sigF and SM101:: sigG mutants. .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: An aliquot (20 μl) of each PCR sample was electrophoresed on a 1.5% agarose gel and then visualized by staining with ethidium bromide. .. For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs). .. Each digested DNA was then run on a 1% agarose gel.

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB). .. DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB).


    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: Ligation products were transformed into One Shot chemically competent E. coli TOP10 cells and then screened accordingly ( ). .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ).

    Protease Inhibitor:

    Article Title: Steady-State and Pre-Steady-State Kinetic Analysis of Mycobacterium smegmatis Cysteine Ligase (MshC)
    Article Snippet: T4 DNA ligase and the restriction enzymes NdeI and EcoRI were from New England Biolabs. .. T4 DNA ligase and the restriction enzymes NdeI and EcoRI were from New England Biolabs.


    Article Title: Helicobacter pylori NikR Protein Exhibits Distinct Conformations When Bound to Different Promoters
    Article Snippet: The final PCR product was digested with EcoRI (New England Biolabs, Beverly, MA) and KpnI (New England Biolabs) and ligated into pBluescript (Stratagene). .. DNA sequences of the hybrid promoters were verified by sequencing (SeqWright).


    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: To examine the plasmid background in the newly generated transformant incompatibility group, PCR typing was performed ( ). .. For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ).

    Article Title: Helicobacter pylori NikR Protein Exhibits Distinct Conformations When Bound to Different Promoters
    Article Snippet: Hybrid nixA-ureA promoter fragments were generated by two sequential rounds of PCR using overlap extension with two oligonucleotides that contained the base mutations and flanking primers designed to amplify ∼200–400 bp of DNA spanning the nixA or ureA promoters and genes ( ). .. The final PCR product was digested with EcoRI (New England Biolabs, Beverly, MA) and KpnI (New England Biolabs) and ligated into pBluescript (Stratagene).

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Expression plasmids for recombinant TBSV, cucumber necrosis virus (CNV), and turnip crinkle virus (TCV) replicase proteins were constructed previously ( - ). .. The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB). .. Expression and purification of the recombinant TBSV, CNV, and TCV replicase proteins were carried out as described earlier ( , ).

    DNA Sequencing:

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA). .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: Vitamin K3 Induces the Expression of the Stenotrophomonas maltophilia SmeVWX Multidrug Efflux Pump
    Article Snippet: The pPBT02 plasmid was extracted with the QIAprep Spin miniprep kit 250 (Qiagen), according to the manufacturer's instructions, and digested with EcoRI and HindIII restriction enzymes (New England BioLabs). .. The pPBT02 plasmid was extracted with the QIAprep Spin miniprep kit 250 (Qiagen), according to the manufacturer's instructions, and digested with EcoRI and HindIII restriction enzymes (New England BioLabs).


    Article Title: Linearmycins Activate a Two-Component Signaling System Involved in Bacterial Competition and Biofilm Morphology
    Article Snippet: Using primers 173 and 174, we amplified a 200-bp DNA sequence containing the putative yfiLMN promoter with EcoRI and HindIII restriction sites. .. To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB).

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: A digoxigenin (DIG)-labeled, intron sequence-specific probe was prepared, as described previously , using primers IBS and EBS1d and a DIG-labeling kit (Roche). .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The primers contained a flanking sequence recognized by restriction endonuclease enzymes BamHI and EcoRI, respectively, for the convenience of cloning manipulation. .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: An Approach to Spatiotemporally Resolve Protein Interaction Networks in Living Cells
    Article Snippet: Amino-terminally FLAG-tagged human B2AR and murine DOR were amplified by PCR from previously described constructs ( ; ). .. Full length FLAG-DOR and the amino-terminal portion of FLAG-B2AR (1–382) were cloned using NheI and EcoRI (NEB), followed by a linker sequence, and APEX2 inserted with EcoRI and NotI (NEB). .. For FLAG-B2AR, the remaining portion of the receptor (383–413) was cloned 3′ to the APEX2 sequence, separated by a linker, with NotI and XbaI (NEB) (see ).

    Article Title: Competitive Fitness of Essential Gene Knockdowns Reveals a Broad-Spectrum Antibacterial Inhibitor of the Cell Division Protein FtsZ
    Article Snippet: Briefly, a 996-bp fragment including the 3′ ends of WQ49_RS12570 and WQ49_RS12575, the intergenic region, the unique transposon sequence, and KpnI and EcoRI restriction sites was synthesized (IDT). .. The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327.

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB). .. DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB).


    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA). .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA).

    Article Title: 14-3-3 Interaction with Histone H3 Involves a Dual Modification Pattern of Phosphoacetylation
    Article Snippet: Paragraph title: Plasmids and recombinant proteins. ... The PCR product was digested with BamHI and EcoRI (New England Biolabs, Ipswich, MA) and cloned into the pGEX-4T-1 vector (GE Healthcare, Piscataway, NJ) digested with the same enzymes.

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Paragraph title: Expression and purification of recombinant replicase proteins from Escherichia coli . ... The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ). .. Gel-purified amplicons were ligated into EcoRI-digested pBHR1 by using a Fast-Link DNA ligation kit (Epicentre) and were chemically transformed into E. coli TOP10.

    Nucleic Acid Electrophoresis:

    Article Title: Replication of an Oxidized Abasic Site in Escherichia coli by a dNTP-Stabilized Misalignment Mechanism that Reads Upstream and Downstream Nucleotides
    Article Snippet: T4 polynucleotide kinase, EcoR I, T4 DNA ligase, Bbs I, and Hae III were obtained from New England Biolabs. .. T4 polynucleotide kinase, EcoR I, T4 DNA ligase, Bbs I, and Hae III were obtained from New England Biolabs.

    Gene Knockout:

    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: Double recombination events (Kanr Amps or Gmr Amps ) were selected, and the corresponding gene knockout was confirmed by genomic PCR. .. To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.


    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: Briefly, DNA from wild-type SM101, the sigF -null mutant, or the sigG -null mutant was isolated using the MasterPure Gram-positive DNA purification kit (Epicentre, Wisconsin). .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: Paragraph title: PCR and Southern blot analyses of the SM101 codY -null mutant and complemented strain. ... For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).

    Article Title: Helicobacter pylori NikR Protein Exhibits Distinct Conformations When Bound to Different Promoters
    Article Snippet: The final PCR product was digested with EcoRI (New England Biolabs, Beverly, MA) and KpnI (New England Biolabs) and ligated into pBluescript (Stratagene). .. DNA sequences of the hybrid promoters were verified by sequencing (SeqWright).

    Article Title: Competitive Fitness of Essential Gene Knockdowns Reveals a Broad-Spectrum Antibacterial Inhibitor of the Cell Division Protein FtsZ
    Article Snippet: The method of Flannagan et al. was used for mutant construction ( ). .. The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327.

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: Paragraph title: Cloning of B. mallei QS genes, mutant construction, gene disruption, and mutant confirmation. ... Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ).

    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: Paragraph title: Cloning, gene disruption, and generation of mutant strains. ... To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.


    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: Briefly, DNA from wild-type SM101, the sigF -null mutant, or the sigG -null mutant was isolated using the MasterPure Gram-positive DNA purification kit (Epicentre, Wisconsin). .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions. .. The digested DNA samples were then electrophoresed on a conventional 1% agarose gel.

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Constructs for all five isoforms were synthesized by Epoch labs in pBluescript (+) cloning vectors. .. Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis. .. Each FGF2 isoform was subcloned in pFastBac1 (Life Technologies) vector using the same restriction sites as above, which ensured directional insertion of the genes for each FGF2 isoform.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: DNA was isolated from wild-type strain SM101, the codY -null mutant SM101:: codY , and the complemented strain SM101 codY comp by using the MasterPure Gram-positive bacterial DNA purification kit. .. For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).

    AST Assay:

    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: Where available, ertapenem MIC results from a VITEK2 AST GN-70 test kit (bioMérieux, Durham, NC) were obtained retrospectively from laboratory records. .. For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ).

    Flow Cytometry:

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: Splenocytes from heterozygous female adult GFPn transgenic mice were sorted into GFP+ and GFP− populations by using the DAKO Modular Flow cytometer. .. DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB).


    Article Title: Helicobacter pylori NikR Protein Exhibits Distinct Conformations When Bound to Different Promoters
    Article Snippet: Paragraph title: Promoter Fragments; Cloning and Labeling ... The final PCR product was digested with EcoRI (New England Biolabs, Beverly, MA) and KpnI (New England Biolabs) and ligated into pBluescript (Stratagene).

    Article Title: Ochratoxin A Production and Amplified Fragment Length Polymorphism Analysis of Aspergillus carbonarius, Aspergillus tubingensis, and Aspergillus niger Strains Isolated from Grapes in Italy
    Article Snippet: Approximately 10 ng of genomic DNA from each isolate was cut with EcoRI and MseI (New England Biolabs, Hitchin, Hertfordshire, United Kingdom), and the DNA fragments were ligated to double-stranded restriction site-specific adaptors from the kit. .. Four separate primer combinations were utilized for the selective amplification: EcoRI+AC and MseI+CC; EcoRI+AT and MseI+CG; EcoRI+AC and MseI+CA; and EcoRI+G and MseI+CT.


    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Each construct was designed as a 6xHis-tag fusion protein with a tobacco etch virus (TEV) recognition site between the 6xHis-tag and the protein to aid with tag removal after purification if necessary. .. Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis.

    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: Purified plasmid DNA was electroporated into electrocompetent E. coli Genehog cells (Invitrogen, Carlsbad, CA) as previously described ( ). .. For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ).

    Article Title: 14-3-3 Interaction with Histone H3 Involves a Dual Modification Pattern of Phosphoacetylation
    Article Snippet: Recombinant protein was expressed in Escherichia coli BL21(DE3) cells (Stratagene, La Jolla, CA), purified using Ni2+ -nitrilotriacetic acid agarose resin (Qiagen, Valencia, CA) per the manufacturer's recommendations, and concentrated to 12 mg/ml. .. The PCR product was digested with BamHI and EcoRI (New England Biolabs, Ipswich, MA) and cloned into the pGEX-4T-1 vector (GE Healthcare, Piscataway, NJ) digested with the same enzymes.

    Article Title: A Mutational Analysis Defines Vibrio fischeri LuxR Binding Sites
    Article Snippet: For purification of chromosomal DNA, PCR products, and plasmids, we used Qiagen kits (Germantown, MD) according to the manufacturer's procedures. .. We obtained T4 polynucleotide kinase, T4 DNA ligase, and EcoRI from New England Biolabs (Ipswich, MA), and BamHI was obtained from Roche.

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Paragraph title: Expression and purification of recombinant replicase proteins from Escherichia coli . ... The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ). .. Digestion reactions were separated in a 1% agarose gel, and the bands were excised by use of a QIAquick gel extraction kit (Qiagen).

    Article Title: Replication of an Oxidized Abasic Site in Escherichia coli by a dNTP-Stabilized Misalignment Mechanism that Reads Upstream and Downstream Nucleotides
    Article Snippet: Purified oligonucleotides were characterized by ESI-MS using an LCQ-Deca after precipitating them from NH4 OAc ( ). .. T4 polynucleotide kinase, EcoR I, T4 DNA ligase, Bbs I, and Hae III were obtained from New England Biolabs.

    Polymerase Chain Reaction:

    Article Title: Linearmycins Activate a Two-Component Signaling System Involved in Bacterial Competition and Biofilm Morphology
    Article Snippet: Using primers 173 and 174, we amplified a 200-bp DNA sequence containing the putative yfiLMN promoter with EcoRI and HindIII restriction sites. .. To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB). .. We ligated the digested products together using T4 DNA ligase (NEB).

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: An aliquot (20 μl) of each PCR sample was electrophoresed on a 1.5% agarose gel and was then visualized by staining with ethidium bromide. .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The primers contained a flanking sequence recognized by restriction endonuclease enzymes BamHI and EcoRI, respectively, for the convenience of cloning manipulation. .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA). .. The cleaved products were ligated using T4 ligase.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: Paragraph title: PCR and Southern blot analyses of the SM101 codY -null mutant and complemented strain. ... For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).

    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: To examine the plasmid background in the newly generated transformant incompatibility group, PCR typing was performed ( ). .. For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ).

    Article Title: An Approach to Spatiotemporally Resolve Protein Interaction Networks in Living Cells
    Article Snippet: Amino-terminally FLAG-tagged human B2AR and murine DOR were amplified by PCR from previously described constructs ( ; ). .. Full length FLAG-DOR and the amino-terminal portion of FLAG-B2AR (1–382) were cloned using NheI and EcoRI (NEB), followed by a linker sequence, and APEX2 inserted with EcoRI and NotI (NEB).

    Article Title: Vitamin K3 Induces the Expression of the Stenotrophomonas maltophilia SmeVWX Multidrug Efflux Pump
    Article Snippet: The PCR product was ligated into pGEM-T Easy vector (Promega), according to the manufacturer's instructions, obtaining the pPBT02 plasmid, which was introduced by transformation into E. coli OmniMAX (Invitrogen). .. The pPBT02 plasmid was extracted with the QIAprep Spin miniprep kit 250 (Qiagen), according to the manufacturer's instructions, and digested with EcoRI and HindIII restriction enzymes (New England BioLabs).

    Article Title: 14-3-3 Interaction with Histone H3 Involves a Dual Modification Pattern of Phosphoacetylation
    Article Snippet: In addition, BMH2 was amplified using the primers 5′-CGCGGATCCATGTCCCAAACTCGTGAAGAT-3′ and 5′-CCGGAATTCTTATTTGGTTGGTTCACCTTG-3′. .. The PCR product was digested with BamHI and EcoRI (New England Biolabs, Ipswich, MA) and cloned into the pGEX-4T-1 vector (GE Healthcare, Piscataway, NJ) digested with the same enzymes. .. The protein was expressed in E. coli BL21(DE3) cells and purified using glutathione Sepharose resin (GE Healthcare, Piscataway, NJ) per the manufacturer's recommendations.

    Article Title: A Mutational Analysis Defines Vibrio fischeri LuxR Binding Sites
    Article Snippet: For PCR amplifications, we used an Expand Long Template system (Roche, Indianapolis, IN). .. We obtained T4 polynucleotide kinase, T4 DNA ligase, and EcoRI from New England Biolabs (Ipswich, MA), and BamHI was obtained from Roche.

    Article Title: Helicobacter pylori NikR Protein Exhibits Distinct Conformations When Bound to Different Promoters
    Article Snippet: Hybrid nixA-ureA promoter fragments were generated by two sequential rounds of PCR using overlap extension with two oligonucleotides that contained the base mutations and flanking primers designed to amplify ∼200–400 bp of DNA spanning the nixA or ureA promoters and genes ( ). .. The final PCR product was digested with EcoRI (New England Biolabs, Beverly, MA) and KpnI (New England Biolabs) and ligated into pBluescript (Stratagene). .. DNA sequences of the hybrid promoters were verified by sequencing (SeqWright).

    Article Title: Competitive Fitness of Essential Gene Knockdowns Reveals a Broad-Spectrum Antibacterial Inhibitor of the Cell Division Protein FtsZ
    Article Snippet: The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327. .. The fragment was digested with KpnI and EcoRI (NEB), ligated into pGPI-SceI to create pAH3, and then transformed into E. coli SY327.

    Article Title: Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication
    Article Snippet: Expression plasmids for recombinant TBSV, cucumber necrosis virus (CNV), and turnip crinkle virus (TCV) replicase proteins were constructed previously ( - ). .. The expression construct for TCV p28C was generated by cloning a PCR product obtained with primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT) by using the full-length TCV clone as a template at the EcoRI and XbaI sites in pMal-c2x (NEB). .. Expression and purification of the recombinant TBSV, CNV, and TCV replicase proteins were carried out as described earlier ( , ).

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ).

    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: To obtain a pmtA pcs double mutant, pGemT- pmtA ::Kan was introduced by electroporation into B. abortus pcs , and the double recombination events (Kanr Amps ) were selected and confirmed by genomic PCR. .. To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.

    Article Title: Ochratoxin A Production and Amplified Fragment Length Polymorphism Analysis of Aspergillus carbonarius, Aspergillus tubingensis, and Aspergillus niger Strains Isolated from Grapes in Italy
    Article Snippet: Approximately 10 ng of genomic DNA from each isolate was cut with EcoRI and MseI (New England Biolabs, Hitchin, Hertfordshire, United Kingdom), and the DNA fragments were ligated to double-stranded restriction site-specific adaptors from the kit. .. A preselective PCR (72°C for 2 min; 20 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 2 min; and then holding at 4°C) was carried out in a 20-μl (final volume) mixture.

    Mouse Assay:

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: Splenocytes from heterozygous female adult GFPn transgenic mice were sorted into GFP+ and GFP− populations by using the DAKO Modular Flow cytometer. .. DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB).

    Plasmid Preparation:

    Article Title: Linearmycins Activate a Two-Component Signaling System Involved in Bacterial Competition and Biofilm Morphology
    Article Snippet: Using primers 173 and 174, we amplified a 200-bp DNA sequence containing the putative yfiLMN promoter with EcoRI and HindIII restriction sites. .. To generate transcriptional fusions to lacZ , we digested the PCR product and plasmid pDG1661 ( amyE ::RBSspoVG - lacZ cat spc bla ) ( ) with EcoRI and HindIII (NEB). .. We ligated the digested products together using T4 DNA ligase (NEB).

    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The primers contained a flanking sequence recognized by restriction endonuclease enzymes BamHI and EcoRI, respectively, for the convenience of cloning manipulation. .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA). .. The cleaved products were ligated using T4 ligase.

    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: For CAV1016, the bla KPC plasmid background has been previously described ( ). .. For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ). .. Total RNA was extracted from E. coli transformants containing parent plasmid Tn 4401 a, Tn 4401 b, and Tn 4401 h using an RNeasy minikit (Qiagen, GmBH, Hilden, Germany).

    Article Title: Vitamin K3 Induces the Expression of the Stenotrophomonas maltophilia SmeVWX Multidrug Efflux Pump
    Article Snippet: The construction was verified by DNA sequencing. .. The pPBT02 plasmid was extracted with the QIAprep Spin miniprep kit 250 (Qiagen), according to the manufacturer's instructions, and digested with EcoRI and HindIII restriction enzymes (New England BioLabs). .. The product corresponding to the smeVWX promoter region was purified with the purification kit (GE Healthcare) from a 1% agarose gel and cloned into pSEVA237Y using the same restriction enzymes and the T4 DNA ligase (New England BioLabs).

    Article Title: 14-3-3 Interaction with Histone H3 Involves a Dual Modification Pattern of Phosphoacetylation
    Article Snippet: In addition, BMH2 was amplified using the primers 5′-CGCGGATCCATGTCCCAAACTCGTGAAGAT-3′ and 5′-CCGGAATTCTTATTTGGTTGGTTCACCTTG-3′. .. The PCR product was digested with BamHI and EcoRI (New England Biolabs, Ipswich, MA) and cloned into the pGEX-4T-1 vector (GE Healthcare, Piscataway, NJ) digested with the same enzymes. .. The protein was expressed in E. coli BL21(DE3) cells and purified using glutathione Sepharose resin (GE Healthcare, Piscataway, NJ) per the manufacturer's recommendations.

    Article Title: Sonic hedgehog promotes endothelial differentiation of bone marrow mesenchymal stem cells via VEGF-D
    Article Snippet: Shh fragments were amplified from rat genomic DNA using the primers as follows: sense, 5'-CGGAATTCGCCACC ATGCTGCTGCTGCTGGCCAG-3'; anti-sense, 5'-CGCGGATCC TCAGCTGGACTTGACTGCCATT-3'. .. Then Shh fragments were ligated with vector which was digested with EcoRI and BamHI (NEB, USA). .. The reconstructed plasmid was verified by Sanger sequencing.

    Article Title: Quorum Sensing: a Transcriptional Regulatory System Involved in the Pathogenicity of Burkholderia mallei
    Article Snippet: For gene expression in E. coli TOP10 cells, the B. mallei luxI genes were PCR amplified as described above, cloned into pCR2.1-TOPO, and chemically transformed into E. coli TOP10. .. Plasmid purification was performed by using a QIAprep Spin miniprep kit (Qiagen, Valencia, Calif.), and the resulting clones were digested with EcoRI (New England Biolabs, Beverly, Mass.) by standard methods ( ). .. Digestion reactions were separated in a 1% agarose gel, and the bands were excised by use of a QIAquick gel extraction kit (Qiagen).

    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: Both amplicons were ligated into pGemTeasy (Promega Corp.) to generate the intermediate vectors pGemT- pmtA and pGemT- pcs . pGemT- pmtA was subsequently digested with ClaI (NEB, Inc.) and ligated into a kanamycin resistance cassette from pUC4K to generate the plasmid pGemT- pmtA ::Kan. pGemT- pcs was digested with HindIII (NEB, Inc.) and ligated into the accI gene conferring resistance to gentamicin to generate pGemT- pcs ::Gm. .. To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.


    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB). .. Digested DNA was analyzed by Southern blot with the GFPn coding sequence as a probe.

    Agarose Gel Electrophoresis:

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: An aliquot (20 μl) of each PCR sample was electrophoresed on a 1.5% agarose gel and was then visualized by staining with ethidium bromide. .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: High Molecular Weight FGF2 Isoforms Demonstrate Canonical Receptor-Mediated Activity and Support Human Embryonic Stem Cell Self-Renewal
    Article Snippet: Constructs for all five isoforms were synthesized by Epoch labs in pBluescript (+) cloning vectors. .. Inserts for all five FGF2 isoforms were digested using EcoRI and HidIII (New England Biolabs) restriction and isolated by agarose gel electrophoresis. .. Each FGF2 isoform was subcloned in pFastBac1 (Life Technologies) vector using the same restriction sites as above, which ensured directional insertion of the genes for each FGF2 isoform.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: An aliquot (20 μl) of each PCR sample was electrophoresed on a 1.5% agarose gel and then visualized by staining with ethidium bromide. .. For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).

    Article Title: Enhanced Klebsiella pneumoniae Carbapenemase Expression from a Novel Tn4401 Deletion
    Article Snippet: For CAV1016, the bla KPC plasmid background has been previously described ( ). .. For plasmid size estimation, BamHI and EcoRI (New England BioLabs, Ipswich, MA) digested and undigested plasmid extractions were run on a 0.8% agarose gel over 8 h at 70 V with V517 and Hyperladder I (Bioline, Taunton, MA) to estimate plasmid size as previously described ( ). .. Total RNA was extracted from E. coli transformants containing parent plasmid Tn 4401 a, Tn 4401 b, and Tn 4401 h using an RNeasy minikit (Qiagen, GmBH, Hilden, Germany).

    Transgenic Assay:

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: Splenocytes from heterozygous female adult GFPn transgenic mice were sorted into GFP+ and GFP− populations by using the DAKO Modular Flow cytometer. .. DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB). .. One-third of the EcoRI-digested DNA was digested with SmaI (NEB), and one-third was digested with XmaI (NEB).


    Article Title: Brucella abortus Synthesizes Phosphatidylcholine from Choline Provided by the Host
    Article Snippet: These vectors were introduced into B. abortus 2308 by electroporation to obtain the corresponding knockout mutants. .. To generate the corresponding complementing plasmids, both amplicons were digested with EcoRI (NEB, Inc.) and ligated into pBBR4 under the lac promoter.

    DNA Methylation Assay:

    Article Title: A DNA insulator prevents repression of a targeted X-linked transgene but not its random or imprinted X inactivation
    Article Snippet: Paragraph title: DNA Methylation Analysis. ... DNA from ≈3 × 106 GFP+ and 3 × 106 GFP− cells from the three GFPn transgenic lines was digested with EcoRI (NEB).

    Oligonucleotide Synthesis:

    Article Title: Replication of an Oxidized Abasic Site in Escherichia coli by a dNTP-Stabilized Misalignment Mechanism that Reads Upstream and Downstream Nucleotides
    Article Snippet: T4 polynucleotide kinase, EcoR I, T4 DNA ligase, Bbs I, and Hae III were obtained from New England Biolabs. .. T4 polynucleotide kinase, EcoR I, T4 DNA ligase, Bbs I, and Hae III were obtained from New England Biolabs.

    DNA Purification:

    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: Briefly, DNA from wild-type SM101, the sigF -null mutant, or the sigG -null mutant was isolated using the MasterPure Gram-positive DNA purification kit (Epicentre, Wisconsin). .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: DNA was isolated from wild-type strain SM101, the codY -null mutant SM101:: codY , and the complemented strain SM101 codY comp by using the MasterPure Gram-positive bacterial DNA purification kit. .. For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).


    Article Title: Boosting Immune Response to Hepatitis B DNA Vaccine by Coadministration of Prothymosin ?-Expressing Plasmid
    Article Snippet: The primers contained a flanking sequence recognized by restriction endonuclease enzymes BamHI and EcoRI, respectively, for the convenience of cloning manipulation. .. The PCR fragment and plasmid vector pcDNA3/flag (containing a Flag tag; Invitrogen, CA) were cleaved by BamHI and EcoRI (New England BioLabs, MA). .. The cleaved products were ligated using T4 ligase.


    Article Title: Evaluating the Involvement of Alternative Sigma Factors SigF and SigG in Clostridium perfringens Sporulation and Enterotoxin Synthesis
    Article Snippet: An aliquot (20 μl) of each PCR sample was electrophoresed on a 1.5% agarose gel and was then visualized by staining with ethidium bromide. .. A 2.5-μg aliquot of each isolated DNA sample was digested overnight with EcoRI according to the manufacturer's (New England Biolabs) instructions.

    Article Title: CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101
    Article Snippet: An aliquot (20 μl) of each PCR sample was electrophoresed on a 1.5% agarose gel and then visualized by staining with ethidium bromide. .. For intron Southern blot analysis, aliquots of DNA (3 μg) from SM101 and SM101:: codY were digested overnight with EcoRI at 37°C, according to the manufacturer's instructions (New England BioLabs).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs ecori hf
    Ecori Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more hf/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    ecori hf - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    New England Biolabs ecori
    Ecori, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 497 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more England Biolabs
    Average 99 stars, based on 497 article reviews
    Price from $9.99 to $1999.99
    ecori - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results